CN108220218A - A kind of clostridium and its application through there is phosphorylation function kinase gene to be transformed - Google Patents
A kind of clostridium and its application through there is phosphorylation function kinase gene to be transformed Download PDFInfo
- Publication number
- CN108220218A CN108220218A CN201810106983.5A CN201810106983A CN108220218A CN 108220218 A CN108220218 A CN 108220218A CN 201810106983 A CN201810106983 A CN 201810106983A CN 108220218 A CN108220218 A CN 108220218A
- Authority
- CN
- China
- Prior art keywords
- clostridium
- kinase gene
- phosphorylation function
- transformed
- kinase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/16—Butanols
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of clostridium through there is the kinase gene of phosphorylation function to be transformed and its application；This method is the method by there is the transformation of the kinase gene of phosphorylation function to improve butanol yield, specifically knocking out in clostridium has phosphorylation function to obtain kinases (including histidine kinase, serine kinase, threonine kinase) gene, so as to regulate and control downstream gene expression.The present invention is knocked out or is overexpressed after having the kinase gene of phosphorylation function, the butanol yield of mutant strain has significant change relative to wild strain, and some kinases participate in sporogenesis and cellular morphology variation, clostridium cell are made to keep high vigor state, so as to improve the butanol synthesis capability of cell.Clostridium of the present invention through there is the kinase gene of phosphorylation function to be transformed has good application prospect in terms of butanol is produced.
Description
Technical field
The invention belongs to microbial engineering fields, and in particular to a kind of through there is the transformation of phosphorylation function kinase gene
Clostridium and the method by there is the transformation of phosphorylation function kinase gene to improve butanol yield.
Background technology
Butanol is a kind of important industrial chemicals and a kind of novel bioenergy.Compared with ethyl alcohol, butanol has energy
Metric density is high, and steam pressure is small, and corrosivity is small, convenient for pipeline, can be mixed with gasoline with arbitrary ratio, without to vehicle
Be transformed etc. advantages (Biotechnology Advances, 2013,31:1575-1587).Fourth is produced by clostridial fermentation
Alcohol, since tunning butanol has very strong toxicity inhibition effect to strain so that the butanol concentration of fermentation termination is usually not
More than 2.0% (w/v).With the fast development of Protocols in Molecular Biology, molecular modification is carried out to the clostridium for producing butanol, is to improve
The most basic method of bioanalysis production butanol economy.At present, is focused primarily upon to the genetic modification for producing Clostridium acetobutylicum research generation
Thank to pathway gene, the highest butanol concentration of report is 17.2g/L, encounters bottleneck, is sought to further improve butanol concentration needs
Look for new target gene.
Kinases is the enzyme that phosphorylation reaction occurs for a kind of catalytic proteins, is primarily involved in the signal transduction process of cell, into
And regulate and control complicated vital movement.In eucaryote, kinases mainly includes serine kinase, threonine kinase and tyrosine-kinase
Enzyme, and be mainly histidine kinase and corresponding modulin composition two-component signal transduction system in prokaryotes.There is phosphorus
The kinases of function is acidified in clostridium acetobutylicum, Clostridium beijerinckii, clostridium saccharobutyricum, clostridium saccharoacetoperbutylicum and Yang Shi clostridiums etc.
It is widely present in clostridium.For example, 35 histidine kinases, 2 serine kinases and 3 silk ammonia are included in clostridium acetobutylicum
Acid/threonine kinase.These kinases for having phosphorylation function can transmit phosphate group in clostridium, activate downstream albumen, therefore
There may be regulating and controlling effect to clostridium physiological metabolism, it is also possible to influence the synthesis of clostridium metabolite.At present, not yet studies have reported that
Serine/threonine etc. has the influence of the kinases of phosphorylation function to the Product formation regulating and controlling effect of clostridium acetobutylicum.
Invention content
The present invention relates to a kind of clostridium through there is the kinase gene of phosphorylation function to be transformed, to having phosphorylation in clostridium
The kinase-encoding gene of function is transformed, regulating cell metabolism and butanol anabolism, and then changes butanol yield.Used
Clostridium be clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium
Beijerinckii), clostridium saccharoacetoperbutylicum (Clostridium saccharoperbutylacetonicum), sugared butyric acid
Clostridium (Clostridium saccharobutylicum), Yang Shi clostridiums (clostridium ljungdahlii) and other shuttles
Bacterium, particular by transformation clostridium have phosphorylation function kinase-encoding gene (selected from cac3319, cac0323,
Cac0903, cac2730, cac0437, cac0404, cac1728, cac2400, cac0579 or cac1235), regulate and control clostridium
Cell metabolism and solvent anabolism, and then provide a kind of by there is the kinase gene of phosphorylation function transformation regulation and control butanol to synthesize
Method.Systematically study single or multiple cell metabolisms of the kinases to clostridium for having phosphorylation function, solvent synthesis and the side of body
Compel the regulation and control of patience, and have the regulating and controlling effect of phosphorylation function kinases by high density fermentation reinforcing, be the uniqueness of the present invention
Place.
The present invention by histidine kinase encoding gene cac3319, cac0323 for being transformed in clostridium, cac0903,
Cac2730, cac0437, serine kinase enzyme coding gene cac0579, cac1235 and serine/threonine kinase encoding gene
Cac0404, cac1728, cac2400 regulate and control downstream gene expression, mainly include sporogenesis related gene, stress resistance base
Cause, cell metabolism related gene and solvent synthetic gene, to regulate and control the synthesis of butanol, so as to fulfill the purpose of the present invention.It is described
The method of transformation specifically, knock out or be overexpressed the kinase gene cac3319, the cac0323 that have phosphorylation function in clostridium,
Cac0903 or cac1728.
For in techniques described above scheme, in the case of preferred, the method for the transformation is knocks out clostridium acetobutylicum
In have phosphorylation function kinase gene cac3319, embodiment is with clostridium acetobutylicum (Clostridium
Acetobutylicum) correlative study has been carried out for ATCC 55025.During butanol is produced in fermentation, cellular morphology begins cell
It is eventually rod-like structure, the production solvent phase does not expand, latter stage not self-dissolving of fermenting.
For in techniques described above scheme, in the case of preferred, the method for the transformation is knocks out acetone-butanol simultaneously
There are phosphorylation function kinase gene cac3319 and cac0323, the acetone fourth of double kinase-deads prepared by this method in clostridium
Alcohol clostridium, fermentation butyl alcohol yield are further improved relative to single kinase gene is knocked out.Cell fermentation produce butanol during,
Cellular morphology is always rod-like structure, and the production solvent phase does not expand, latter stage not self-dissolving of fermenting.
For in techniques described above scheme, in the case of preferred, the kinase gene for having phosphorylation function of the invention strikes
Except the gene disruption technique realization by II class intrones.
For in techniques described above scheme, in the case of preferred, the II class introne gene knockout used carriers
For pSY6, pMTL007 etc..
For in techniques described above scheme, in the case of preferred, the II class Intron insertion target gene site
Be be located at target gene fragment go forward 30% sequence.
For in techniques described above scheme, in the case of preferred, the gene overexpression used carrier is pIMP1-
Thl, PMTL82151 etc..
Another aspect of the present invention is that the open application to clostridium acetobutylicum described above utilizes the knockout
There is the kinase gene cac3319 of phosphorylation function in clostridium acetobutylicum；Or it knocks out have phosphorylation in clostridium acetobutylicum simultaneously
The clostridium acetobutylicum of double kinase-deads of the kinase gene cac3319 and cac0323 of function, is carried out by fibre bed reactor
High density fermentation, butanol yield further improve.
For in techniques described above scheme, in the case of preferred, fermentation process is cultivated using usual manner, fermentation
Temperature is that 35-42 DEG C, fermentation time 30-100h, fermentation process pH variation modification scope is 4.2-6.2.
For in techniques described above scheme, in the case of preferred, fermentation process pH is controlled in 5.0-6.2.The pH
Regulation and control pass through addition alkaline solution realization automatically, NaOH, NH4OH etc. can be used.
For in techniques described above scheme, in the case of preferred, histidine kinase deactivated strain of the invention passes through height
Density fermentation strengthens the regulating and controlling effect for having phosphorylation function kinases, further improves fermentation termination solvent strength.The high density
Cell used in fermentation fixes material and is selected from wooden unit, ceramics, sponge, towel, resin, activated carbon, zeolite etc..
Description of the drawings
Figure 1A is the plasmid pSY6 collection of illustrative plates that subcarrier is included comprising II classes；Figure 1B is II class Intron insertion schematic diagrames；Figure
1C is bacterium colony PCR verification results；
Fig. 2 is gene overexpression plasmid pIMP1-thl collection of illustrative plates
Fig. 3 A are wild strain ATCC 55025 and have the butanol yield of phosphorylation function kinase-dead bacterial strain；Fig. 3 B are to contain
There is the butanol yield that empty plasmid pIMP1-thl and cac0323 are overexpressed bacterial strain
Fig. 4 is the scanning electron microscope (SEM) photograph of wild strain ATCC 55025 and cac3319 mutant strains in the different fermentations time；
Fig. 5 is the fermentation dynamics curve of wild strain ATCC 55025 and cac3319 and the bis- knock-out bacterial strains of cac0323；
Fig. 6 is the high density fermentation kinetic curve of the bis- knock-out bacterial strains of cac3319 and cac0323.
Specific embodiment
The present invention is described in further detail below in conjunction with specific embodiment.
In the examples below, unless otherwise specified, used experimental method is conventional method, material therefor, examination
Agent etc. can be bought from biological or chemical company.
The cell metabolism situation of the present invention is characterized by cellular morphology variation and cell cracking state, is sent out especially by field
Penetrate scanning electron microscope characterization.
Embodiment 1
The present embodiment includes the following steps：
(1) vector construction
Gene knockout：PSY6 plasmids to contain II class intrones pass through Overlap extension PCR pair as carrier, such as Figure 1A
The sub-piece therein that includes is transformed, and makes it have specific recognition target gene function, and is inserted into purpose site and is blocked purpose
Gene expression, such as schematic diagram 1B.Overlap extension PCR primer is designed by " Clostron " website (www.clostron.com),
Algorithm according to being delivered in document treats the insertion point knocked out in gene and is predicted (Journal of Molecular
Biology,2004,336:421-439), primer sequence such as table 1.First round PCR uses primer I BS and EBS respectively
Universal amplifications include sub-piece 1, and using primer EBS1d, EBS2 amplifications include sub-piece 2, reaction system and reaction condition
Such as table 2, the second wheel PCR is amplified to include sub-piece 1 and include sub-piece 2 as template and is entirely included sub-piece, reaction system
With condition such as table 3, AxyPrep PCR cleaning agents box purified pcr products are used.The PCR product and pSY6 plasmids of purifying are used
BsrGI and XhoI digestion with restriction enzyme, digestion system such as table 4, pSY6 plasmid enzyme restrictions product use AxyPrep DNA gels
QIAquick Gel Extraction Kit carries out product purification, the plasmid fragments of purifying is connected with sub-piece is included by ligase, coupled reaction body
System such as table 5.Connection product imports Escherichia coli amplification, and using AxyPrep Plasmid DNA small volume of reagent box extraction plasmid, carries out
Sequence verification.Construction of recombinant plasmid is completed, and is transferred to Escherichia coli and is carried out methylation reaction, extraction plasmid is for use.
Gene overexpression：Using clostridium acetobutylicum ATCC55025 genomic DNAs template, with cac0323-OS and
Cac0323-OA is primer (primer sequence such as table 1), carries out PCR reactions, and reaction system and reaction condition are as shown in table 6, purifying
PCR product and pIMP1-thl (Fig. 2) plasmid digestion with restriction enzyme, digestion system be changed to except restriction enzyme
EcoRI and SmaI, other carry out product such as table 4, pIMP1 plasmid enzyme restrictions product using AxyPrep DNA gels QIAquick Gel Extraction Kit
Purifying, the plasmid fragments of purifying is connected with cac0323 genetic fragments by ligase, coupled reaction plasmid and segment are changed to
PIMP1-thl and cac0323 segments, other are such as table 5.Connection product imports Escherichia coli amplification, and uses AxyPrep plasmids
DNA small volume of reagent box extracts plasmid, carries out sequence verification.Construction of recombinant plasmid is completed, and is transferred to Escherichia coli and methylate instead
Should, extraction plasmid is for use.
1 the present embodiment the primer sequence of table
2 first round of table PCR reaction systems and reaction condition
Table 3 second takes turns PCR reaction systems and reaction condition
4 endonuclease reaction system of table
5 coupled reaction system of table
Table 6PCR reaction systems and reaction condition
(2) there is phosphorylation function kinase gene that strain construction is transformed
Under anaerobic condition, take and cultivated in CGM activation mediums, OD600Clostridium acetobutylicum cell for 0.4-0.6 is trained
Nutrient solution, 4000rpm centrifugation 10min, removes supernatant, adds in ETM buffer solutions (280mM sucrose, the 0.6mM of the precooling of 30mL ice
Na2HPO4, 4.4mM NaH2PO4, 9mM MgCl2) be resuspended, 10min is stood, 4000rpm centrifugation 10min remove supernatant, add in
2.5mL ET buffer solutions (280mM sucrose, 0.6mM Na2HPO4, 4.4mM NaH2PO4) be resuspended be prepared into competent cell, take
The addition of 190 μ L competent cells methylates plasmid, and competent cell and plasmid mixed liquor are transferred to 0.2cm's by ice bath after mixing
Electric conversion is carried out in electric revolving cup, after adding in the mixing fully of CGM culture solutions immediately, is all added in the culture medium of other same volume,
37 DEG C of cultures, then take 150 μ L culture solutions to be coated in the CGM agar cultures containing Erythromycinresistant, and picking single bacterium colony carries out
Bacterium colony PCR verifies that primer sequence such as table 7, screening includes the mutant bacteria of sub-piece insertion target gene, intronless with II classes
The bacterial strain PCR product size of insertion is 500bp or so, and the bacterial strain PCR product size for having Intron insertion is 1700bp or so, such as
Shown in Fig. 1 C.Then positive bacterium colony passes on the CGM tablets of non-resistant, until resistance is lost, obtains having for nonreactive line flag
The kinase-dead bacterial strain of phosphorylation function.
7 the present embodiment the primer sequence of table
| Primer | Sequence (5 ' -3 ') |
| cac3319-F | GGGATAGCTTTATTGGTACTG |
| cac3319-R | GCTTTGAATAGACTCCACAC |
| cac0323-F | GGTCGTTACATTAAGGTATGG |
| cac0323-R | CCATAAGGGTACTACTTAAGGC |
| cac0903-F | CTTGATTTTAACTGCCGGA |
| cac0903-R | AATAGAATTTGGTTGCCGC |
| cac2730-F | CCAATGAGCTTTTGACAGTAG |
| cac2730-R | CACATAACTACTGCCTACTTCC |
| cac0404-F | ATGGTGAAAAGTGATATC |
| cac0404-R | GATATCACTTTTCACCAT |
| cac1728-F | TTTAAATCGTCATGTGGCTG |
| cac1728-R | CCCTGTGCTTGTTCTGGCGAT |
Embodiment 2
There is the kinase-dead strain fermentation production butanol of phosphorylation function
The present embodiment mainly includes the following steps that：Seed culture medium used be CGM culture mediums, CGM culture mediums before use,
Logical nitrogen deoxygenation 20min, then 121 DEG C of sterilizing 15min, are cooled to room temperature, and the 2mL histidines of -80 DEG C of Storage in refrigerator of access swash
Enzyme inactivates bacterium.After cultivating 16-20h under the conditions of 37 DEG C, P2 fermentation mediums are accessed, anaerobic fermentation is carried out in fermentation tank, fermented
Culture medium before the use, is passed through nitrogen deoxygenation, 37 DEG C, mixing speed 150rpm of fermentation temperature, when zymotic fluid pH is less than 5.0
Afterwards, fermentation pH is controlled to maintain more than 5.0 by auto-feeding 50% (v/v) ammonium hydroxide.Timing sampling detects cell concentration and molten
Agent content.
CGM culture mediums：20g containing glucose in every liter of culture medium, dusty yeast 2g, tryptone 4g, potassium dihydrogen phosphate 0.5g,
Dipotassium hydrogen phosphate 0.5g, ammonium acetate 2.2g and mineral mixture.Wherein, the composition of mineral mixture is：Every liter of culture medium
In containing 7 Magnesium sulfate heptahydrate 0.1g, 7 ferrous sulfate hydrate 0.015g, 2 calcium chloride hydrate 0.015g, 1 hydrated manganese sulfate 0.01g, chlorine
Change cobalt 0.02g and zinc sulfate 0.002g.
P2 fermentation mediums：80g containing glucose, dusty yeast 1g, potassium dihydrogen phosphate 0.5g, phosphoric acid hydrogen two in every liter of culture medium
Potassium 0.5g, ammonium acetate 2.2g, mineral mixture and vitamin.Wherein, the composition of mineral mixture is：In every liter of culture medium
Containing 7 Magnesium sulfate heptahydrate 0.2g, 7 ferrous sulfate hydrate 0.01g, 1 hydrated manganese sulfate 0.01g and sodium chloride 0.01g；The group of vitamin
Become：0.001g containing p-aminobenzoic acid, vitamin B1 0.001g and biotin 0.00001g in every liter of culture medium.
Acetone, butanol and ethyl alcohol are detected using conventional gas-chromatography.Glucose, acetic acid and butyric acid are using routine
Liquid chromatogram is detected.
As a result as shown in Figure 3A, starting strain ATCC55025 butanol yield is 11.1g/L, and knockout has phosphorylation function
Kinase gene cac0903, cac0323, cac3319, cac1728, butanol yield are respectively increased to 16.4g/L, 14.6g/L,
12.1g/L and 14.7g/L, has been respectively increased 47.7%, 31.5%, 9.0% and 32.4% compared with starting strain；Such as Fig. 3 B institutes
Show, be overexpressed the kinase gene cac0323 for having phosphorylation function, butanol output increased to 15.2g/L compares butanol production with zero load
Amount 11.9g/L, which is compared, improves 27.7%.Fermentation results show can have the kinase gene of phosphorylation function to carry by transformation
High butanol yield.
Embodiment 3
The cellular morphology for having the kinase-dead bacterial strain of phosphorylation function detects
Starting strain ATCC55025, the cellular morphology variation that cac3319 knocks out bacterium and cac0437 knockout bacterium pass through scanning
Electronic Speculum is observed.Specific steps include, materials：In the sour phase (8h) of production, acid is produced to production solvent tour (16h), production solvent phase (32h)
And decline phase (72h), 4mL fermentation cultures 8000rpm is taken to centrifuge 5min, supernatant is abandoned, is cleaned with the PBS of 0.1mol/L
10min is repeated 3 times；It is fixed：Centrifugation abandons supernatant and adds in 2.5% glutaraldehyde fixation more than 2h immediately after cleaning；Cleaning：0.1mol/
The PBS cleaning 10min of L, this step are repeated 3 times；Dehydration：With 50%, 70%, 90%, 95% tert-butyl alcohol stepwise disposal sample
Each 10min handles sample 10min with the pure tert-butyl alcohol again, this step is repeated 3 times；It is dry：To immerse the sample of the pure tert-butyl alcohol together with
The tert-butyl alcohol is as in 4 DEG C of refrigerators, making the liquid tert-butyl alcohol freeze for solid-state, to be put into bottle,suction and vacuumize, the tert-butyl alcohol is made to distil, sample
Product are dried；Metal spraying：Sample is adhered on sample stage, the metal spraying in ion sputtering instrument；It is seen finally by field emission scanning electron microscope
It examines.
The results are shown in Figure 4 for the scanning electron microscope of clostridium cell, when fermentation proceeds to 8h and 16h, wild strain and group ammonia
Acid kinase deactivated strain is there is no occurring apparent variation in cellular morphology, and in 32h, wild strain presents typically
The metamorphosis that centre is expanded, clostridium acetobutylicum is in the typical cellular morphology variation of production solvent phase when being considered, in 72h, carefully
There is the hole of dissolved form in cellular surface, and aqtocytolysis phenomenon is apparent.And cac3319 knocks out bacterium cell there is no presentations and to swell shape
State also illustrates that histidine kinase deactivated strain in entire fermentation period, is protected always that autolysis does not occur after fermentation
High vigor state is held, the high butanol synthesis capability for histidine kinase deactivated strain provides basis.
Embodiment 4
The bis- fibre bed reactor immobilization fermentations for knocking out bacterium of cac3319 and cac0323
Bacterium is knocked out as starting strain using cac3319, cac0323 is knocked out and expresses to obtain double knockouts of cac3319 and cac0323
Bacterium carries out Batch fermentation and immobilization fermentation, Batch fermentation such as embodiment 3, immobilization fermentation：Routinely step carries out batch third
Ketone Clostridium acetobutylicum ferments, in cell growth to OD600During maximum value, bacterium solution is made in fermentation tank and fiber with the flow velocity of 0.5L/min
It is recycled in bed reactor, the towel using steel wire as support is housed inside fibre bed reactor, to fixed clostridium cell.Reaction
After 2h, the zymotic fluid in reaction system is drained and only, then adds in fresh P2 culture mediums, cycle for 24 hours, drains reactant again
The zymotic fluid of system adds in fresh P2 culture mediums and carries out high density fermentation.Timing sampling detects cell concentration and solvent content.
The results are shown in Figure 5 for the bis- Batch fermentations for knocking out bacterium of cac3319 and cac0323, acetone, butanol and ethanol production point
Indescribably up to 6.8g/L, 18.2g/L and 3.7g/L, compared with starting strain ATCC 55025, butanol output increased 64.0%.
The results are shown in Figure 6 for the bis- high density fermentations for knocking out bacterium of cac3319 and cac0323, and acetone, butanol and ethanol production further carry
Up to 8.9g/L, 20.7g/L and 3.0g/L, total solvent yield reach 32.6g/L, with compared with starting strain ATCC 55025,
Butanol output increased 86.5%.Illustrate under the conditions of high-density cells, cac3319 and the bis- knockout bacterium of cac0323 are to solvent
Tolerance and solvent synthesis capability are significantly increased.By simultaneously knock out have phosphorylation function kinase gene cac3319 and
Cac0323, butanol yield breach the bottleneck of 20g/L in immobilization fermentation, further to realize that microbial fermentation produces fourth
The industrialization of alcohol provides technical support.
Claims (9)
1. a kind of clostridium through there is the kinase gene of phosphorylation function to be transformed, which is characterized in that the clostridium is that have phosphoric acid to it
The kinase-encoding gene for changing function is transformed, regulation and control and butanol anabolism, and then changes butanol yield.
2. the clostridium according to claim 1 through there is the kinase gene of phosphorylation function to be transformed, which is characterized in that used
Clostridium be clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium
Beijerinckii), clostridium saccharoacetoperbutylicum (Clostridium saccharoperbutylacetonicum), sugared butyric acid
Clostridium (Clostridium saccharobutylicum) or Yang Shi clostridiums (clostridium ljungdahlii).
3. the clostridium according to claim 1 or 2 through there is the kinase gene of phosphorylation function to be transformed, which is characterized in that institute
The kinase gene of transformation is selected from cac3319, cac0323, cac0903, cac2730, cac0437, cac0404, cac1728,
There is the kinases of phosphorylation function in cac2400, cac0579, cac1235 and clostridium.
4. the clostridium according to claim 3 through there is the kinase gene of phosphorylation function to be transformed, which is characterized in that described to change
The method made is to knock out or be overexpressed the kinase gene cac3319, the cac0323 that have phosphorylation function in clostridium acetobutylicum,
Cac1728 and/or cac0903.
5. the clostridium according to claim 4 through there is the kinase gene of phosphorylation function to be transformed, which is characterized in that described to change
The method made is that knocking out in clostridium acetobutylicum has phosphorylation function kinase gene cac3319, and the clostridium cell is fermenting
During producing butanol, cellular morphology is always rod-like structure, and the production solvent phase does not expand, latter stage not self-dissolving of fermenting.
6. the clostridium according to claim 4 through there is the kinase gene of phosphorylation function to be transformed, which is characterized in that described to change
The method made is, while knocks out in clostridium acetobutylicum and have a phosphorylation function kinase gene cac3319 and cac0323, described
Clostridium cell fermentation produce butanol during, cellular morphology is always rod-like structure, production the solvent phase do not expand, fermentation latter stage not from
It is molten.
7. such as the application of clostridium described in claim 5 or 6 through there is the kinase gene of phosphorylation function to be transformed, feature exists
In using the clostridium acetobutylicum described in claim 5 or 6, passing through fibre bed reactor and carry out high density fermentation, butanol yield
It further improves.
8. application according to claim 7, which is characterized in that in the process of high-density fermentation, fermentation temperature 35-42
DEG C, fermentation time 30-100h, fermentation process pH are 4.2-6.2.
9. application according to claim 7, which is characterized in that cell used in the high density fermentation fixes material choosing
From at least one of wooden unit, ceramics, sponge, towel, resin, activated carbon, zeolite.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810106983.5A CN108220218B (en) | 2018-02-02 | 2018-02-02 | Microbial strain modified by kinase gene with phosphorylation function and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810106983.5A CN108220218B (en) | 2018-02-02 | 2018-02-02 | Microbial strain modified by kinase gene with phosphorylation function and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108220218A true CN108220218A (en) | 2018-06-29 |
| CN108220218B CN108220218B (en) | 2021-09-14 |
Family
ID=62669583
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810106983.5A Active CN108220218B (en) | 2018-02-02 | 2018-02-02 | Microbial strain modified by kinase gene with phosphorylation function and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220218B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111088267A (en) * | 2019-12-18 | 2020-05-01 | 南京工业大学 | Method for improving cell density of liquid fermentation of clostridium solvolyticum |
| CN113122564A (en) * | 2021-04-09 | 2021-07-16 | 大连理工大学 | Multi-gene combined editing and screening method for microorganisms |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101328486A (en) * | 2007-06-18 | 2008-12-24 | 中国科学院上海生命科学研究院 | Recombinant plasmid for acetone-butanol clostridium gene disruption |
| CN101519673A (en) * | 2008-02-27 | 2009-09-02 | 中国科学院上海生命科学研究院 | Method for improving ratio of butanol produced from clostridium |
| CN102796692A (en) * | 2011-05-25 | 2012-11-28 | 中国科学院上海生命科学研究院 | Method for improving sugar utilization rate of clostridium acetobutylicum in fermentation of mixed sugar |
| CN107177609A (en) * | 2017-05-15 | 2017-09-19 | 大连理工大学 | A kind of recombinant clostridium of fruB gene overexpressions, its construction method and application |
-
2018
- 2018-02-02 CN CN201810106983.5A patent/CN108220218B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101328486A (en) * | 2007-06-18 | 2008-12-24 | 中国科学院上海生命科学研究院 | Recombinant plasmid for acetone-butanol clostridium gene disruption |
| CN101519673A (en) * | 2008-02-27 | 2009-09-02 | 中国科学院上海生命科学研究院 | Method for improving ratio of butanol produced from clostridium |
| CN102796692A (en) * | 2011-05-25 | 2012-11-28 | 中国科学院上海生命科学研究院 | Method for improving sugar utilization rate of clostridium acetobutylicum in fermentation of mixed sugar |
| CN107177609A (en) * | 2017-05-15 | 2017-09-19 | 大连理工大学 | A kind of recombinant clostridium of fruB gene overexpressions, its construction method and application |
Non-Patent Citations (3)
| Title |
|---|
| XU ET AL.: "Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production", 《APPL MICROBIOL BIOTECHNOL》 * |
| 张超等: "产丁醇梭菌基因改造的研究进展", 《生物技术通报》 * |
| 薛闯等: "激酶组学在原核生物中的研究进展", 《微生物学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111088267A (en) * | 2019-12-18 | 2020-05-01 | 南京工业大学 | Method for improving cell density of liquid fermentation of clostridium solvolyticum |
| CN111088267B (en) * | 2019-12-18 | 2022-05-03 | 南京工业大学 | Method for improving cell density of liquid fermentation of clostridium solvolyticum |
| CN113122564A (en) * | 2021-04-09 | 2021-07-16 | 大连理工大学 | Multi-gene combined editing and screening method for microorganisms |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108220218B (en) | 2021-09-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101415830B (en) | Anaerobic fermentation of glycerol | |
| CN103602627B (en) | Novel N-acetylneuraminic acid-producing escherichia coli engineering bacteria as well as construction method and application thereof | |
| Eiteman et al. | A substrate‐selective co‐fermentation strategy with Escherichia coli produces lactate by simultaneously consuming xylose and glucose | |
| CN101974476A (en) | XZ-A26 bacterial strain for producing L-alanine with high yield as well as construction method and application thereof | |
| CN104059872A (en) | High-yield N-acetylglucosamine metabolic engineering bacterium, as well construction method and applications thereof | |
| Ma et al. | Coupled ARTP and ALE strategy to improve anaerobic cell growth and succinic acid production by Escherichia coli | |
| CN102099483A (en) | Methods and processes for producing organic acids | |
| CN101448948A (en) | Enhancement of microbial ethanol production | |
| CN102174433A (en) | Clostridium beijerinckii with high stress resistance and application thereof | |
| US8530211B2 (en) | Co-fermentation of glucose, xylose and/or cellobiose by yeast | |
| CN103571772A (en) | Novel butanol producing strain and method for producing butanol by using same | |
| CN108220218A (en) | A kind of clostridium and its application through there is phosphorylation function kinase gene to be transformed | |
| CN102333859B (en) | Method for producing lactic acid from plant-derived raw material, and lactic-acid-producing bacterium | |
| Zhang et al. | Consolidated bioprocessing for bioethanol production by metabolically engineered cellulolytic fungus Myceliophthora thermophila | |
| WO2021129396A1 (en) | Recombinant filamentous fungus for producing ethanol, and construction and application thereof | |
| CN105062938A (en) | Engineering bacterium capable of producing D-lactate by aid of pentose and hexose synchronously by means of fermentation, and fabrication and application of engineering bacterium | |
| CN102643774A (en) | Gene engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of gene engineering bacterium | |
| WO2015158094A1 (en) | Clostridium beijerinckii with high stress resistance and uses thereof | |
| CN103820367A (en) | Genetic engineering strain for high yield of butanol and application thereof | |
| CN104974946A (en) | Recombinant escherichia coli with high osmotic pressure resistance and application thereof | |
| WO2014201439A1 (en) | Methods to enhance microbial conversion of cellulosic biomass with mechanical augmentation | |
| Schneider et al. | Oxygen transfer on β-D-galactosidase production by Kluyveromyces marxianus using sugar cane molasses as carbon source | |
| CN101864389A (en) | Clostridium acetobutylicum strain and screening method and application thereof | |
| WO2022088263A1 (en) | Recombinant escherichia coli for efficient production of succinic acid and construction method for recombinant escherichia coli | |
| CN104109651A (en) | Recombinant Escherichia coli for synthesizing S-1,2-propanediol from L-lactic acid and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |