WO2015158094A1

WO2015158094A1 - Clostridium beijerinckii with high stress resistance and uses thereof

Info

Publication number: WO2015158094A1
Application number: PCT/CN2014/085468
Authority: WO
Inventors: 郭亭; 蚁细苗; 谭文兴; 张九花; 黄玉南; 李雨虹; 钟映萍; 梁达奉
Original assignee: 广州甘蔗糖业研究所
Priority date: 2014-04-16
Filing date: 2014-08-29
Publication date: 2015-10-22
Also published as: CN103911334B; CN103911334A

Abstract

Provided are clostridium beijerinckii with high stress resistance and uses thereof. The clostridium beijerinckii with high stress resistance does not have a Cbei_3304 protein function, so that the clostridium beijerinckii has high stress resistance to toxic substances such as ferulic acid and vanillic acid, also has high stress resistance to toxic substances in an undetoxified saccharide solution obtained through wood fiber acidolysis, and can be well fermented to produce butyl alcohol.

Description

Description: A highly resistant strain of Clostridium beijerii and its application

The invention relates to a high-resistance Clostridium beijerinckii and application thereof, and belongs to the technical field of genetic engineering and fermentation engineering.

Background technique

With the depletion of fossil energy sources, the production of bioenergy and bio-based chemicals by microbial fermentation using renewable lignocellulosic materials (such as corn cobs, bagasse, etc.) has become one of the research priorities. The lignocellulosic material must be pretreated to obtain microbial fermentable sugars that can be used well by microorganisms. However, after the pretreatment of the lignocellulosic material, organic acid, furfural, phenolic and the like are produced, and the removal cost of these inhibitors is high, and the microbial growth is inhibited. Therefore, it is especially important to increase the resistance of microorganisms.

Butanol has the advantages of high energy density, can be mixed with gasoline at any ratio, and can be directly used in internal combustion engines. Butanol has received extensive attention as a new renewable liquid energy source. The production of fuel butanol by fermentation of lignocellulosic feedstock has become one of the hot spots of research. Thaddeus Ezeji et al. (Bioresource Technol. 2008, 99: 5915-5922) using the C. beijerincense mutant BA101, XAD-4 resin detoxified corn cob acid hydrolysis and enzymatic hydrolysis of sugar as substrate fermentation, total solvent yield is 9.30 g/L; however, the mutant strain BA101 could not ferment butanol using a non-detoxified acid hydrolysis solution. Chinese patent ZL 201110020102.6 reports: Clostridium beijerinckiO IB4 obtained by particle beam mutagenesis has high resistance to phenolic compounds, and can be used as a carbon source without undetoxified corncob acid solubilized sugar solution. The total solvent yield and butanol production in the 2L fermentor reached 10.3 g/L and 7.1 g L, respectively. However, Guo Ting et al. (J and Microbiol Biotechnol., 2012, 39(3), 401-407) found that when the concentration of phenolic compounds in the corncob and bagasse solubilized sugar solution increased to 1.5 g/L or more At the time, Clostridium bei rinckii IB4 does not grow at all. Tomas et al. (Appl Environ Microbiol, 2003, 69(8): 4951-4965) overexpressed the heat shock protein-containing raESL gene in Clostridium acetobutylicum, reducing the inhibitory effect of butanol on bacterial cells by 85%. Finally, the product concentration was increased by 33%. Thaddeus Ezeji et al. (Biotechnol Bioeng 2007, 97(6): 1460-1469) found that organic acids, citric acid and the like do not affect the fermentation of butanol, while phenolic inhibitors have a significant inhibitory effect on butanol fermentation. However, the inhibition mechanism of phenolic compounds on microbial growth and fermentation is complicated, and the inhibition mechanism is still unclear.

Based on this, the toxin inhibitors (such as ferulic acid, vanillin, etc.) after pretreatment of lignocellulose severely inhibit the growth and fermentation performance of Clostridium beijerincii; improve the resistance of Clostridium beijerinckii to toxins such as phenolic compounds. It is one of the key issues that must be solved in the industrialization of lignosan for the preparation of fuel for lignocellulosic feedstock.

Summary of the invention In order to solve the above problems, the present invention provides a highly resistant, high-resistance Clostridium beijerincii which has high resistance to toxins such as phenolic compounds.

It is an object of the present invention to provide a highly resistant Clostridium beijerii.

Another object of the present invention is to provide a method for constructing a highly resistant strain of Clostridium beijerinckii.

A further object of the present invention is to provide an application of a highly resistant strain of Clostridium beijerinckii.

The technical solution adopted by the present invention is:

A highly resistant strain of Clostridium beijerii, which lacks the normal Cbei_3304 protein function.

Further, the above high-resistance Clostridium beijerinckii, the gene Cbei_3304 is not normally expressed.

Further, the above high-resistance Clostridium beijerinckii, the gene Cbei_3304 was inserted and inactivated.

The use of the above-mentioned high-resistance Clostridium beijerinckii in the fermentation of butanol.

Further, the above application is specifically as follows: The high-resistance Clostridium beijerincii is directly fermented to prepare butanol by using the non-detoxified lignocellulosic acid solution.

The beneficial effects of the invention are:

In the present invention, the Cbei-3304 gene encoding the membrane protein in Clostridium beijerincii is inactivated, and the gene is not normally expressed, and the recombinant strain in which the Cb _ei _3304 gene is inserted and inactivated is obtained. The invention provides a simple and efficient method for improving the resistance of Clostridium beijerincii, and the recombinant strain obtained by the method has high resistance to toxin substances (ferulic acid, vanillic acid, etc.), when When the detoxified bagasse solubilized sugar solution was used as the carbon source, the total solvent yield and butanol yield in the 2L fermenter reached 7.0 g/L and 5.1 g/L, respectively, while the starting strains cultured under the same conditions did not grow at all. The recombinant strain constructed by the method of the invention has strong stress resistance and high yield of butanol, and is an excellent strain suitable for fermenting butanol of lignocellulosic materials such as bagasse.

DRAWINGS

Figure 1 is a plasmid map of the inserted inactivation vector pWJ of the present invention;

Figure 2 is a diagram showing the mechanism of inactivation of insertion of a type II intron according to the present invention;

Figure 3 is a PCR electrophoresis map of transformant colonies.

Specific male

The invention can be better understood in light of the following examples. However, those skilled in the art will readily appreciate that the specific material ratios, process conditions, and results described in the examples are merely illustrative of the invention and are not intended to limit the invention as described in the claims. .

Cat case 1

I. Construction of the inactivated mutant strain of Clostridium beijerii Cbei_3304 gene insertion The principle of constructing the inactivated mutant strain of Clostridium beijerii Cbei_3304 gene insertion is shown in Figure 2. The specific construction process includes the following steps:

(1) Construction of Cbei-3304 insertion inactivation carrier

1) Design introns

According to the Cbei-3304 gene sequence of Clostridium beijerincii (shown as SEQ ID No: 1) included in the NCBI database, the appropriate insertion locus (http://www.clostron.com) was designed by software, and the insertion was selected. Between the 101st and 102th bases, an intron sequence was generated, the intron sequence S-101 (the sequence of which is shown in SEQ ID NO: 2) was synthesized, and the following primers were designed.

Clone primers:

pWJ-OSC-101-S: 5 '- ggagtgtcgaggatcctcgagataattatccttacacttcgcc -3 ', the sequence of which is SEQ ID NO:

3;

pWJ-OSC-101-A: 5 '-ggttctcctacagattgtacaaatgtggtgataacagataag-3', the sequence of which is SEQ ID NO:

4 is shown.

Verify primers:

Cbei-3304-T-S : 5 '-taaattacctacagcaaaactgtg-3 ' , the sequence is as shown in SEQ ID NO: 5;

Cbei-3304-T-A: 5 ' -ggaattaagaaccttgaatctatc-3 ' , the sequence is shown as SEQ ID NO: 6.

Primer pWJ-OSC-101-S introduced Xho I restriction site (underlined part), primer pWJ-OSC-101-A introduced BsrG

I cleavage site (underlined part).

2) Construction of Cbei_3304-pWJ-101 recombinant vector

The plasmid pWL pWJ was digested with Xho I and BsrG I as shown in Figure 1, and the sequence is shown in SEQ ID NO: 7. The digested product was purified by a purification kit (Takara) and ligated with the intron sequence S-101 by one-step cloning (ClonExpress). The one-step cloning-ligated recombinant plasmid was transformed into Escherichia coli E.co/DH5a, coated on a LB plate containing 50 μg/ml ampicillin-resistant LB, cultured at 37 ° C for 12 to 16 hours, and the transformant was picked and connected to a liquid. The recombinant plasmid containing 50 μg/ml ampicillin was cultured at 37° (:, 200 rpm for 12 h, and the recombinant plasmid (AXYGEN) was extracted and verified by sequencing to obtain Cbei_3304-pWJ-101 recombinant vector.

3) Methylation of Cbei_3304-pWJ-101 recombinant vector

The chemically competent state of E.co/Top 10/pAN2 was prepared, and the successfully sequenced Cbei_3304-pWJ-101 recombinant vector was transformed into E. coli Top 10. Since the pAN2 plasmid has tetracycline resistance, it was coated to contain 50 ug. /ml ampicillin and 10 μg/ml tetracycline double-resistant LB plate, cultured at 37 °C for 12~16h, picked up transformants, and received liquid containing 50 μg/ml ampicillin and 10 g/ml tetracycline LB In the medium, cultured at 37 ° C, 200 rpm for 12 h, extraction of methylated Description

Cbei_3304-pWJ-101 recombinant vector (pAN2 plasmid contains a Bacillus subtilis phage gene encoding methyltransferase, which enables methylation of the foreign plasmid in E. coli), that is, Cbei_3304 inserted into the inactivated vector.

(2) Cbei_3304 insertion of inactivated vector for transformation of Clostridium beijerinckii (ZosinVftVi/M beijerinckii NCIMB 8052)

1) Inoculate Clostridium beijerinckii NCIMB 8052 to CGM medium (yeast powder 3 g/L, peptone 5 g L, soluble starch 10 g/L, ammonium acetate 2 g/L, NaCl 2 g/L, MgS0 ₄ -7H ₂ 0 3 g/L, KH ₂ P0 ₄ 1 g/L, K ₂ HP0 ₄ 1 g/L, FeS0 ₄ 7H ₂ 0 0.1 g L) overnight culture at 37 ° C, inoculated to CGM medium at a 5% ratio the next day , cultured at 37 ° C for 6-8 h, inoculated with YTG medium (yeast powder 16 g L, peptone 10 g / L, glucose 5 g / L, sodium chloride 5 g / L) at 37 ° C for 3 h. OD ₆₀₀ nm = l;

2) Take 50 ml of Clostridium beijerinc's solution, centrifuge at 5000 rpm for 10 min at 4 ° C, and discard the supernatant. Resuspend in ETM buffer (270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM Na ₂ HP 0 ₄ , 10 mM MgCl ₂ ); centrifuge as above, remove the supernatant, resuspend in ETM buffer again, centrifuge as above, and take it thoroughly. Clearing

3) Resuspend in 1 ml of ET buffer (270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM Na3⁄4P0 ₄ , take 200 μl, insert 1 μg Cbei_3304 into the inactivated carrier, add 0.2cm pre-cooled electric rotor, light Lightly mix;

4) Use MicroPulserTM electro-rotary instrument to rotate, the condition is voltage 1.8kV, resistance 200Ω, capacitance 2.5 F, immediately after electric shock, add lmL 2xYTG medium, transfer to sterile centrifuge tube for recovery for 2~3h;

5) Take 200 μl of the above bacterial solution, apply it to CGM solid medium containing 10 μ _§ / ηι1 erythromycin, and incubate for 2 to 3 days.

(3) Screening of Cbei_3304 insertion inactivated mutants

The transformants which were cultured for 2 to 3 days in the above step 5) were picked, and the transformants were subjected to colony PCR verification using the primers Cbei-3304-TS and Cbei-3304-TA, and the mutants in which the intron was inserted into the genome were selected (after insertion). PCR amplification of the gene band electrophoresis map is about 1Kbp larger than the wild type, as shown in Figure 3, the correctly inserted mutant strain was passaged three times, while being coated with erythromycin-resistant and no erythromycin resistance. On the CGM solid medium, a knockout plasmid-missing mutant (a mutant that could not grow on an erythromycin-resistant plate) was selected.

2. Passage stability of Cbei-3304 inserted inactivated mutants

The Cbei-3304 gene constructed above was inserted into the inactivated C. beijerinckii mutant strain for 7 times on a solid medium, and the obtained strain was found to have the same morphological characteristics and culture characteristics as the starting strain, and the growth state was good. The passage stability of the recombinant strain was examined in a fermentation medium using glucose as a carbon source, and the results of the subculture fermentation test of the inserted inactivated mutant were as shown in Table 1.

Table 1 Fermentation of Cbei-3304 Inserted Inactivating Mutant by Different Passage Times

Cbei-3304 insertion of inactivating mutant

Passage times butanol production total solvent yield

(g L) (g L) Instruction manual

1 7.7 11.4

2 7.5 11.2

3 7.8 11.6

4 7.7 11.5

5 7.6 11.3

6 7.9 11.7

7 7.8 11.4

From the experimental results, it was found that after 7 consecutive passages, the total solvent yield and butanol yield of the two mutant strains were stable, and had good passage stability, which could be used as a production strain for further research and development.

3. Cbei-3304 insertion of inactivated strain of Clostridium beijerii to the phenolic resistance of the model phenolic compound ferulic acid

Medium formula (% by mass):

Plate medium: yeast powder 0.3%, peptone 0.5%, soluble starch 1%, ammonium acetate 0.2%, sodium chloride 0.2%, magnesium sulfate heptahydrate 0.3%, potassium dihydrogen phosphate 0.1%, dipotassium hydrogen phosphate 0.1%, The ferrous sulfate heptahydrate is 0.01%, the agar is 1.5%, and the rest is water, pH 6.

Seed medium: yeast powder 0.3%, peptone 0.5%, soluble starch 1%, ammonium acetate 0.2%, sodium chloride 0.2%, magnesium sulfate heptahydrate 0.3%, potassium dihydrogen phosphate 0. 1%, dipotassium hydrogen phosphate 0 1%, ferrous sulfate heptahydrate 0.01%, the rest is water, pH 6.

Fermentation medium: glucose 3%, ammonium acetate 0.22%, potassium dihydrogen phosphate 0.05%, dipotassium hydrogen phosphate 0.05%, sodium chloride 0.001%, magnesium sulfate heptahydrate 0.02%, ferrous sulfate heptahydrate 0.001%, monohydrate Manganese sulphate 0.001%, corn syrup 0.1%, ferulic acid 0.06%, the rest is water, pH 6.6 „

The Cb _ei _3304 inserted into the inactivated C. beijerinckii mutant was inoculated into a plate medium for anaerobic culture at a culture temperature of 35 V and a culture time of 12 h. The plated mutant was inoculated into the seed culture medium at a culture temperature of 35 Ό, 50 mL of Schott's anaerobic bottle volume of 30 mL, nitrogen gas for 3 min, culture temperature of 35 ° C, and culture time of 12 h; seed inoculation into the fermentation In the medium, the inoculum volume was 10% (y/ _V ), the fermentation temperature was 35 °C, the 100 mL Schott anaerobic bottle volume was 50 mL, and the nitrogen was filled for 3 min. After fermentation for 72 h, the butanol yield was 6.1 g. /L, and the starting strain NCIMB 8052 cultured under the same conditions did not grow at all.

4. Cbei-3304 insertion of inactivated strain of Clostridium beijerii on the phenolic resistance of the model phenolic compound vanillic acid

Medium formula (% by mass):

Plate medium: Same as the above "three".

Seed medium: Same as the above "three". Instructions Fermentation medium: glucose 3%, ammonium acetate 0.22%, potassium dihydrogen phosphate 0.05%, dipotassium hydrogen phosphate 0.05%, sodium chloride 0.001%, magnesium sulfate heptahydrate 0.02%, ferrous sulfate heptahydrate 0.001%, one Manganese sulfate hydrate 0.001%, corn syrup 0.1%, vanillic acid 0.05%, the rest is water, pH 6.6.

The above-mentioned Cbei_3304 inserted into the inactivated C. beijerinckii mutant was inoculated into the plate medium for anaerobic culture at a culture temperature of 35 ° C and a culture time of 12 h. The plated mutant was inoculated into the seed culture medium at a culture temperature of 35 ° C, 50 mL of Schott's anaerobic bottle volume of 30 mL, nitrogen gas for 3 min, culture temperature of 35 ° C, and culture time of 12 h; seed inoculation In the fermentation medium, the inoculum volume was 10% (ν/ν), the fermentation temperature was 35 °C, the 100 mL Schott anaerobic bottle volume was 50 mL, and the nitrogen was filled for 3 min. After fermentation for 72 h, the butanol production was detected to be 4.6. g/L, and the starting strain NCIMB 8052 cultured under the same conditions can only grow weakly, but does not produce butanol.

5. Cbei-3304 insertion of inactivated strain of Clostridium beijerinckii against sugarcane residue solubilized sugar solution

This section describes the process by which Cbei-3304 inserts inactivated C. beijerincii using sugarcane bagasse solubilized sugar solution (soluble total phenolic content of 2.4 g L) to ferment butanol in a 1 L fermentor.

Medium formula (% by mass):

Plate medium: Same as the above "three".

Seed medium: Same as the above "three".

Fermentation medium: ammonium acetate 0.22%, potassium dihydrogen phosphate 0.05%, dihydrogen potassium dihydrogen peroxide 0.05%, sodium chloride 0.001%, magnesium sulfate heptahydrate 0.02%, ferrous sulfate heptahydrate 0.001%, manganese sulfate monohydrate 0.001 %, corn syrup 0.1%, with non-detoxified bagasse solubilized sugar solution (total reducing sugar is 4%), the rest is water, pH 6.6, the total soluble phenol content in the medium is 2.4 g / L.

The above-mentioned Cbei_3304 inserted into the inactivated C. beijerinckii mutant was inoculated into the plate medium for anaerobic culture at a culture temperature of 35 ° C and a culture time of 12 h. The plated mutant was inoculated into the seed culture medium, 250 mL of Schott's anaerobic bottle was filled with 150 mL, nitrogen was added for 3 min, culture temperature was 35 °C, and culture time was 12 h; seed was inoculated to 1 L fermentation culture. In the 2L fermenter, the inoculum was 10% (v/v), the fermentation temperature was 35 °C, and nitrogen gas was continuously introduced at a flow rate of 0.3 L/min. After 90 h of fermentation, the total solvent yield and butanol yield were measured. Up to 3.1 g/L and 2.2 g/L were achieved, while the starting strain NCIMB 8052 cultured under the same conditions did not grow at all.

6. Cbei-3304 insertion of inactivated strain of Clostridium beijerinckii against sugarcane residue solubilized sugar solution

This section describes the process by which Cbei-3304 inserts inactivated C. beijerincii using sugarcane bagasse solubilized sugar solution (soluble total phenol content 2.0 g L) to ferment butanol in a 2 L fermentor.

Medium formula (% by mass):

Plate medium: Same as the above "three". Instructions Seed Medium: Same as the above "three".

Fermentation medium: ammonium acetate 0.22%, potassium dihydrogen phosphate 0.05%, dipotassium hydrogen phosphate 0.05%, sodium chloride 0.001%, magnesium sulfate heptahydrate 0.02%, ferrous sulfate heptahydrate 0.001%, manganese sulfate monohydrate 0.001% , corn syrup 0.1%, with undetoxified bagasse acid glycol solution (total reducing sugar 3.6%) configuration, the rest is water, pH 6.6, the total soluble phenol content in the medium is 2.0 g L.

The Cb _ei _3304 inserted into the inactivated C. beijerinckii mutant was inoculated into a plate medium for anaerobic culture at a culture temperature of 35 Ό and a culture time of 12 h. The plated mutant was inoculated into the seed culture medium, 250 mL of Schott's anaerobic bottle was filled with 150 mL, nitrogen was added for 3 min, culture temperature was 35 °C, and culture time was 12 h; seed was inoculated to 1 L fermentation culture. In the 2L fermenter, the inoculum volume was 10% (v/v), the fermentation temperature was 35 °C, and nitrogen gas was continuously introduced at a flow rate of 0.3 L/min. After 90 h of fermentation, the total solvent yield and butanol yield were measured. The 7.0 g/L and 5.1 g/L were reached, and the starting strain NCIMB 8052 cultured under the same conditions did not grow at all.

Claims

Claim

A highly resistant C. beijerinckii which is characterized by the absence of a normal Cbei-3304 protein function.

2. A highly resistant C. beijerinckii according to claim 1, wherein the gene Cbei_3304 is not normally expressed.

3. A highly resistant C. beijerinckii according to claim 2, wherein the gene Cbei_3304 is inserted and inactivated.

The use of a high-resistance Clostridium beijerinckii according to any one of claims 1 to 3 for fermenting butanol.

The use according to claim 4, characterized in that the high-resistance C. beijerinckii according to claim 1 is directly fermented to produce butanol from a non-detoxified lignocellulosic acid solution.