CN102747063A - Xylose isomerase producing method - Google Patents
Xylose isomerase producing method Download PDFInfo
- Publication number
- CN102747063A CN102747063A CN2012102518393A CN201210251839A CN102747063A CN 102747063 A CN102747063 A CN 102747063A CN 2012102518393 A CN2012102518393 A CN 2012102518393A CN 201210251839 A CN201210251839 A CN 201210251839A CN 102747063 A CN102747063 A CN 102747063A
- Authority
- CN
- China
- Prior art keywords
- xylose isomerase
- framework
- gene
- isomerase gene
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a xylose isomerase producing method and belongs to the technical field of biology. The xylose isomerase producing method includes: firstly, cloning xylose isomerase genes of thermus, streptomyces and escherichia coli; secondly, constructing a pichia pastoris expression vector, a saccharomyces cerevisiae expression vector and a bacillus subtilis expression vector which include three xylose isomerase gene expression cassettes, and transforming the vectors to corresponding host bacteria respectively; thirdly, respectively screening recombinants of over-expression xylose isomerases as engineering bacteria; and finally, fermenting the pichia pastoris engineering bacteria, the saccharomyces cerevisiae engineering bacteria and the bacillus subtilis engineering bacteria to produce a recombinant mixed xylose isomerase. Different from a traditional single-gene-coded xylose isomerase, the recombinant mixed xylose isomerase is wide in suitable reaction temperature and pH (potential of hydrogen) range and suitable for various purposes, and yield of the xylose isomerase expressed by the engineering bacteria including the polygene expression cassettes is obviously higher than that of the xylose isomerase expressed by engineering bacteria including single genes, so that production cost is reduced.
Description
Technical field
The invention belongs to biological technical field, relate to the structure microbial engineering bacteria and produce recombinase.It specifically is using microbe engineering bacteria production reorganization xylose isomerase.
Background technology
Xylose isomerase (Xylose Isomerase EC5.3.1.5) is the enzyme with destructurization.The main effect of xylose isomerase is catalysis D-wood sugar (aldehyde pentose) and the mutual enzyme of changing of D-xylulose (ketone pentose), also acts on the D-glucose and obtains D-fructose.Xylose isomerase is mainly used in high fructose syrup industry, produces the semicellulose ethanol industry, as foodstuff additive and fodder additives etc.Different purposes has different requirement for the suitable temperature and the pH of xylose isomerase effect.Currently marketed isoamylase product is to derive from the xylose isomerase that natural bacterial strain is produced, owing to the xylose isomerase gene in the natural bacterial strain is by single xylose isomerase gene coding of planting, and its suitable range of reaction temperature and suitable reaction pH narrow range.So current xylose isomerase enzyme product can not satisfy and be suitable for the demand in current market.
Pichia spp (Pichia pastoris), yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) and subtilis (Bacillus subtilis) all are the host bacterium that is usually used in producing recombinant protein, but respectively have characteristic.The principal character of pichia spp is the characteristics that the few oneself protein of secretion helps the purifying of expression product, and subtilis and yeast saccharomyces cerevisiae have facultative aerobic characteristic, is suitable for solid anaerobic digestion and produces recombinase.
Summary of the invention
The current single enzyme of planting that has only these enzymes does not on the market still mix the bacterial classification and the mixed enzyme product of expressing these enzymes.Derive from the xylose isomerase ph optimum 7 of the hot bacterium (Thermus) that dwells, 90 ℃ of the most suitable temperature, under 80 to 95 ℃ of conditions with pH6.2 to 7, have 80% it in the enzymic activity of optimum temperuture and ph optimum condition; Derive from the xylose isomerase ph optimum 8 of streptomycete (Streptomyces), 80 ℃ of the most suitable temperature, under 68 to 86 ℃ of conditions with pH6.8 to 8.5, have 80% it in the enzymic activity of optimum temperuture and ph optimum condition; Derive from the xylose isomerase ph optimum 6 of intestinal bacteria (Escherichia coli), 50 ℃ of the most suitable temperature, under 37 to 60 ℃ of conditions with pH4.8 to 7.2, have 80% it in the enzymic activity of optimum temperuture and ph optimum condition.From above-mentioned visible, if xylose isomerase that will above-mentioned these three kinds of different sourcess is prepared into the mixed enzyme product, so this mixed enzyme suitable temperature of reaction and pH scope will be obviously wherein list kind enzyme wide.
The xylose isomerase gene that the xylose isomerase gene that applied molecular biology technique construction of the present invention contains the hot bacterium that dwells is expressed framework, streptomycete express framework and colibacillary xylose isomerase gene express framework (explanation. expression framework: Pichia yeast engineering promotor-signal peptide-gene-transcription terminator), saccharomyces cerevisiae engineered yeast and subtilis engineering bacteria.Express the Pichia yeast engineering of framework, saccharomyces cerevisiae engineered yeast and subtilis engineering bacteria production reorganization mixing xylose isomerase with containing three kinds of xylose isomerase genes.
The technical scheme that the present invention adopted is:
1. clone the enzyme gene: the applied molecular biology technology; Xylose isomerase gene increases from hot bacterium (Thermus) genome of dwelling; The xylose isomerase gene that from streptomycete (Streptomyces) genome, increases is cloned xylose isomerase gene from intestinal bacteria (Escherichia coli) genome.
2. obtain the required promotor of construction of expression vector, recombination sequence, signal peptide, Transcription Termination subsequence and resistant gene.
3. make up like the yeast expression vector of accompanying drawing 1, the yeast saccharomyces cerevisiae expression vector of accompanying drawing 2 and the subtilis expression vector of accompanying drawing 3.
4. answer the electricity consumption method for transformation will contain the yeast expression vector conversion pichia spp genome that three kinds of xylose isomerase genes are expressed framework; Answer the electricity consumption method for transformation will contain the yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae genome that three kinds of xylose isomerase genes are expressed framework; Answer the electricity consumption method for transformation will contain the subtilis expression vector conversion subtilis genome that three kinds of xylose isomerase genes are expressed framework.With PCR and determined dna sequence method validation recon.Screen pichia spp recon, yeast saccharomyces cerevisiae recon and the subtilis recon of high expression level xylose isomerase respectively and express Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and the subtilis engineering bacteria of framework as containing three kinds of xylose isomerase genes.
5. fermentation contains Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and the subtilis engineering bacteria production reorganization mixing xylose isomerase of three kinds of xylose isomerase genes expression frameworks.
The present invention make up contain three kinds of xylose isomerase genes express advantage applies that the Pichia yeast engineering of frameworks, wine brewing ferment engineering bacteria and subtilis engineering bacteria production reorganization mix xylose isomerase in:
(1) for providing, market is fit to the wide xylose isomerase enzyme product of the wide and suitable reaction pH scope of range of reaction temperature.
(2) replace the bacterial strain production xylose isomerase that fermentation respectively contains the xylose isomerase gene expression framework of the hot bacterium that dwells; Fermentation contains the xylose isomerase gene of streptomycete and expresses framework bacterial strain production xylose isomerase, and fermentation contains the bacterial strain of colibacillary xylose isomerase gene expression framework and produces xylose isomerase.Promptly not only improved performance of products and realization and produced three kinds of xylose isomerases respectively with a plurality of operations, reached the effect of having saved starting material, energy consumption and manpower with three kinds of xylose isomerases replacements of a fermentation procedure production.
(3) pichia spp, yeast saccharomyces cerevisiae and subtilis each tool characteristic aspect the production recombinant protein; The present invention make up respectively the xylose isomerase gene that contains three kinds of different sourcess express framework Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and subtilis engineering bacteria, for production of its reorganization mixed enzyme provides multiple bacterial strain to select.
Description of drawings
Accompanying drawing 1. contains the yeast expression vector that three kinds of xylose isomerase genes are expressed framework
P. the glyceraldehyde 3-phosphate dehydrogenase promotor of pichia spp; S. alpha factor signal peptide; T-xi. the dwell xylose isomerase gene of hot bacterium; S-xi. the xylose isomerase gene of streptomycete; E-xi. colibacillary xylose isomerase gene; T. Transcription Termination subsequence; G418. resistant gene (being applied to screen the pichia spp recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of P.pastoris rDNA. pichia spp.
Accompanying drawing 2. contains the yeast saccharomyces cerevisiae expression vector that three kinds of xylose isomerase genes are expressed framework
P. the glyceraldehyde 3-phosphate dehydrogenase promotor of yeast saccharomyces cerevisiae; S. alpha factor signal peptide; T-xi. the dwell xylose isomerase gene of hot bacterium; S-xi. the xylose isomerase gene of streptomycete; E-xi. colibacillary xylose isomerase gene; T. Transcription Termination subsequence; G418. resistant gene (being applied to screen the yeast saccharomyces cerevisiae recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of S.cerevisiae rDNA. yeast saccharomyces cerevisiae.
Accompanying drawing 3. contains the subtilis expression vector that three kinds of xylose isomerase genes are expressed framework
P. the glyceraldehyde 3-phosphate dehydrogenase promotor of bacillus megaterium; S. alpha factor signal peptide; T-xi. the dwell xylose isomerase gene of hot bacterium; S-xi. the xylose isomerase gene of streptomycete; E-xi. colibacillary xylose isomerase gene; T. Transcription Termination subsequence; G418. resistant gene (being applied to screen the subtilis recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of B.subtilis rDNA. subtilis.
Embodiment
With indefiniteness embodiment the present invention is described further below.
Embodiment 1:
1.1 structure yeast expression vector
1.1.1 structure cloning vector
By the synthetic two strands that contains two base complementrities of penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin of dna sequence dna Synesis Company of specialty, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pPM
1.1.2 obtain gene
1. the pcr amplification xylose isomerase gene of hot bacterium of dwelling
Primer 1:
5 ' GC
GAATTCATGTACGAGCCCAAACCGG3 ' [8 bases that .5 ' end is described are that enzyme is cut protection base (2 base minor) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCCCCGCACCCCCAGGAGGTACTCCACC3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Use the method for conventional bacterial genomes DNA extraction and extract the genomic dna of the hot bacterium that dwells; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of the hot bacterium that dwells through sequencing with the BLAST software analysis that NCBI provides.
2. the xylose isomerase gene of pcr amplification streptomycete
Primer 1:
5 ' GC
GAATTCATGAGCTACCAGCCCACCCCCG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to GCCCCGCGCGCCCAGCAGGTGGTCCATC, and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
[the hot mycetocyte of will dwelling is added on the Snailase solution (Snailase is with the sorbyl alcohol dissolving of 1mol/L) of 9mg/ml in 30 ℃ of joltings 30 minutes to the genomic dna of extraction streptomycete; Extract its genomic dna according to the bacterial genomes DNA extraction method of routine then]; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of streptomycete through sequencing with the BLAST software analysis that NCBI provides.
3. the colibacillary xylose isomerase gene of pcr amplification
Primer 1:5 ' GG
GAATTCATGCAAGCCTATTTTGACCAGCTCGAT3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2: CA
GCGGCCGCTCA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to GACACCGGTGGTGAAACCGCCTGCTTTG, and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Extracting colibacillary genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves colibacillary xylose isomerase gene sequence through sequencing with the BLAST software analysis that NCBI provides.
Express framework 1.1.3 make up three kinds of xylose isomerase genes respectively.
1. use the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of pcr amplification pichia spp.
Primer 1:
5’CC
TACGTAGGATCCTTTTTTGTAGAAATGTCTTGG?3’
Primer 2:
5’GG
GCATGCTGTGTTTTGATAGTTGTTC?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is wherein arranged)]
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides.[explain: the pichia spp genome DNA extracting method: the Snailase solution (Snailase with 1mol/L sorbyl alcohol dissolving) that the pichia spp cell is added on 9mg/ml extracts its genomic dna according to the bacterial genomes DNA extraction method of routine then in 30 ℃ of joltings 30 minutes.]
2. by the synthetic alpha factor signal peptide of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
3. by the synthetic Transcription Termination subsequence of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
4.: with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
5. pcr amplification rDNA sequence from the pichia spp genome
Primer 1:
5’CC
GGTACCggcttccaggacgtatcgcggatcgctgcgttcttcatc3’
Primer 2:
Primer 2: 5 ' CC
TTCGAAAgccccgtggcacacgaccaatcttcccagccgaca 3 '
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product of acquisition proves the rDNA sequence in the pichia spp genome through sequential analysis and the BLAST software analysis that provides with NCBI.
6. the expression cassette framework is built process:
A. the structure of expression framework that contains the xylose isomerase gene of the hot bacterium that dwells
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPM carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of the hot bacterium that dwells is reconstituted in the MCS of pPM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pPM carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains the hot bacterium that dwells is expressed framework is called pPM1.
B. the structure of expression framework that contains the xylose isomerase gene of streptomycete
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPM carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of streptomycete is reconstituted in the MCS of pPM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pPM carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains streptomycete is expressed framework is called pPM2.
C. the structure that contains the expression framework of colibacillary xylose isomerase gene
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPM carrier, and is located at the downstream of promoter sequence; Colibacillary xylose isomerase gene sequence is reconstituted in the MCS of pPM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pPM carrier, and is located at the downstream of signal peptide sequence.This carrier that contains colibacillary xylose isomerase gene expression framework is called pPM3.
7. accomplish the structure of expression vector
A. will express framework and be assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4 dna ligase, cut the expression framework of pPM2 and pPM3 carrier respectively, and this above two cover is expressed the MCS that framework is inserted in pPM1 successively.This carrier is called pPM123.
B. the effect through DNA restriction enzyme and T4 dna ligase successively with the rDNA sequence (DNA recombination sequence) of pichia spp and G418 recombination in the MCS of pPM123 carrier.Constitute and contain the yeast expression vector (accompanying drawing 1) that three kinds of xylose isomerase genes are expressed framework.
Contain the Pichia yeast engineering that three kinds of xylose isomerase genes are expressed framework 1.2 make up
The electricity consumption method for transformation will contain the yeast expression vector conversion pichia spp that three kinds of xylose isomerase genes are expressed framework; To pass through the pichia spp of electric transformation and coat G418-YPD (2% peptone; 1% yeast extract, 2% glucose, 1.5% agar powder; Final concentration is the G418 of 700 μ g/ml) flat board, grow bacterium colony (recon) 30 ℃ of cultivations after 3 days.Verify recon with PCR method amplification target gene: using the special primer of above-described three kinds of xylose isomerase genes respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that its three kinds of xylose isomerase genes of sequencing proof have been reconstituted in recon.The also process that grows in the G418 resistant panel was carried out shake flask fermentation 2 days at 30 ℃ respectively with the recon that gene specific primer carries out the PCR checking, with fermented liquid centrifuging and taking supernatant.With Hi s6 fusion rotein purification kit purification of target albumen; With the His tag monoclonal antibody three kinds of target proteins of purifying are carried out protein blot experiment; The result shows that these three kinds of target proteins can both combine with the His tag monoclonal antibody, proves that these three kinds of xylose isomerase genes can both express justacrine outside born of the same parents in pichia spp.With the xylose isomerase enzymic activity of ordinary method mensuration fermented liquid, according to enzyme assay, the recon of screening high expression level xylose isomerase is expressed the Pichia yeast engineering of frameworks as containing three kinds of xylose isomerase genes.
Mix xylose isomerase 1.3 produce reorganization
The xylose isomerase gene that will contain the hot bacterium that dwells is respectively expressed xylose isomerase gene expression framework of framework, streptomycete and the Pichia yeast engineering that colibacillary xylose isomerase gene is expressed framework; The xylose isomerase gene that the xylose isomerase gene that only contains the hot bacterium that dwells expresses the Pichia yeast engineering of framework, only contain streptomycete expresses the Pichia yeast engineering of framework, only contain colibacillary L xylose isomerase gene expresses the Pichia yeast engineering of framework and does not contain xylose isomerase gene and express the pichia spp of framework and be inoculated in respectively in the YPD substratum, and 30 ℃ of shaking tables were cultivated two days.Through centrifugal; Collect above-mentioned fermented liquid supernatant respectively; The method of using conventional wood sugar determination of activity (is that the enzymolysis wood sugar generates xylulose; Content through the xylulose that measure to generate obtains enzymic activity then) respectively at pH7 and 90 ℃; PH8 and 80 ℃; And pH 6 and 50 ℃ of xylose isomerase enzymic activitys of measuring above-mentioned fermented liquid; And outcome record shown that in table 1. table 1 result the xylose isomerase gene that contains the hot bacterium that dwells expresses the xylose isomerase gene of framework, streptomycete and express framework and colibacillary xylose isomerase gene and express xylose isomerase enzymic activity in the fermented liquid of Pichia yeast engineering of framework and express the xylose isomerase enzymic activity in the Pichia yeast engineering fermented liquid of framework apparently higher than the xylose isomerase gene that contains the hot bacterium that dwells; Also be higher than the xylose isomerase gene that contains streptomycete express in the fermented liquid of Pichia yeast engineering of framework the xylose isomerase enzymic activity with contain colibacillary xylose isomerase gene and express the xylose isomerase enzymic activity in the fermented liquid of Pichia yeast engineering of framework, and the former xylose isomerase enzymic activity is back three's xylose isomerase enzymic activity sum approximately.In view of the above, contain the xylose isomerase gene expression framework of the hot bacterium that dwells, the xylose isomerase gene expression framework of streptomycete and the Pichia yeast engineering that colibacillary xylose isomerase gene is expressed framework and be fit to be applied to produce reorganization mixing xylose isomerase.
The xylose isomerase enzymic activity of table 1 fermented liquid
Explain: contain single xylose isomerase gene of planting and express the structure that method and the difference of the method for the structure of the Pichia yeast engineering that contains three kinds of gene expression constructs of structure of the Pichia yeast engineering of framework is expression vector; The construction process that contains single yeast expression vector of planting the wood sugar gene expression construct is expressed the difference of the method that the yeast expression vector of frameworks makes up and is that the former only contains a kind of xylose isomerase gene and expresses framework with containing three kinds of xylose isomerase genes, and the latter contains three kinds of xylose isomerase genes and expresses frameworks.
Embodiment 2:
2.1 make up the yeast saccharomyces cerevisiae expression vector
2.1.1 structure cloning vector
Contain penbritin (AMP) gene order by dna sequence dna Synesis Company of specialty is synthetic, the two strands of two base complementrities of polyclone joint and intestinal bacteria replication orgin, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pSM.
2.1.2 obtain gene
1. the pcr amplification xylose isomerase gene of hot bacterium of dwelling
Primer 1:
5 ' GC
GAATTCATGTACGAGCCCAAACCGG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCCCCGCACCCCCAGGAGGTACTCCACC3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Use the method for conventional bacterial genomes DNA extraction and extract the genomic dna of the hot bacterium that dwells; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of the hot bacterium that dwells through sequencing with the BLAST software analysis that NCBI provides.
2. the xylose isomerase gene of pcr amplification streptomycete
Primer 1:
5 ' GC
GAATTCATGAGCTACCAGCCCACCCCCG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to GCCCCGCGCGCCCAGCAGGTGGTCCATC, and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
[the hot mycetocyte of will dwelling is added on the Snailase solution (Snailase is with the sorbyl alcohol dissolving of 1mol/L) of 9mg/ml in 30 ℃ of joltings 30 minutes to the genomic dna of extraction streptomycete; Extract its genomic dna according to the bacterial genomes DNA extraction method of routine then]; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of streptomycete through sequencing with the BLAST software analysis that NCBI provides.
3. the colibacillary xylose isomerase gene of pcr amplification
Primer 1:5 ' GG
GAATTCATGCAAGCCTATTTTGACCAGCTCGAT3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2: CA
GCGGCCGCTCA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to GACACCGGTGGTGAAACCGCCTGCTTTG, and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Extracting colibacillary genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves colibacillary xylose isomerase gene sequence through sequencing with the BLAST software analysis that NCBI provides.
Express framework 2.1.3 make up three kinds of xylose isomerase genes respectively.
1. use the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of pcr amplification yeast saccharomyces cerevisiae.
Primer 1:
5’CC
TACGTATCGAGTTTATCATTATCAAT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2:
5’GG
GCATGCTCGAAACTAAGTTCTTGGTG?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting genes of brewing yeast group DNA, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides.
[explain: genes of brewing yeast group DNA extraction method: the Snailase solution (Snailase with 1mol/L sorbyl alcohol dissolving) that brewing yeast cell is added on 9mg/ml extracts its genomic dna according to the bacterial genomes DNA extraction method of routine then in 30 ℃ of joltings 30 minutes.]
2. by the synthetic alpha factor signal peptide of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
3. by the synthetic Transcription Termination subsequence of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
4.: with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
5. pcr amplification rDNA sequence from the genes of brewing yeast group
Primer 1:
5’CC
GGTACCTGAACTAACACCTTTTGTGG3’
Primer 2:
5’CC
TTCGAAGCTAATACATGCTTAAAATC3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting genes of brewing yeast group DNA, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product of acquisition proves the rDNA sequence in the genes of brewing yeast group through sequential analysis and the BLAST software analysis that provides with NCBI.
6. the expression cassette framework is built process:
A. the structure of expression framework that contains the xylose isomerase gene of the hot bacterium that dwells
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of yeast saccharomyces cerevisiae is reconstituted in the MCS of pSM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pSM carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of the hot bacterium that dwells is reconstituted in the MCS of pSM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pSM carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains the hot bacterium that dwells is expressed framework is called pSM1.
B. the structure of expression framework that contains the xylose isomerase gene of streptomycete
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of yeast saccharomyces cerevisiae is reconstituted in the MCS of pSM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pSM carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of streptomycete is reconstituted in the MCS of pSM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pSM carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains streptomycete is expressed framework is called pSM2.
C. the structure that contains the expression framework of colibacillary xylose isomerase gene
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of yeast saccharomyces cerevisiae is reconstituted in the MCS of pSM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pSM carrier, and is located at the downstream of promoter sequence; Colibacillary xylose isomerase gene sequence is reconstituted in the MCS of pSM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pSM carrier, and is located at the downstream of signal peptide sequence.This carrier that contains colibacillary xylose isomerase gene expression framework is called pSM3.
7. accomplish the structure of expression vector
A. will express framework and be assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, cut the expression framework of pSM2 and pSM3 carrier respectively, and this above two cover is expressed the MCS that framework is inserted in pSM1 successively.This carrier is called pSM123.
B. the effect through DNA restriction enzyme and T4 dna ligase successively with the rDNA sequence (DNA recombination sequence) of yeast saccharomyces cerevisiae and G418 recombination in the MCS of pSM123 carrier.Constitute and contain the yeast saccharomyces cerevisiae expression vector (accompanying drawing 2) that three kinds of xylose isomerase genes are expressed framework.
Contain the saccharomyces cerevisiae engineered yeast that three kinds of xylose isomerase genes are expressed framework 2.2 make up
The electricity consumption method for transformation will contain the yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae that three kinds of xylose isomerase genes are expressed framework; To pass through the yeast saccharomyces cerevisiae of electric transformation and coat G418-YPD (2% peptone; 1% yeast extract, 2% glucose, 1.5% agar powder; Final concentration is the G418 of 700 μ g/ml) flat board, grow bacterium colony (recon) 30 ℃ of cultivations after 3 days.Verify recon with PCR method amplification target gene: using the special primer of above-described three kinds of xylose isomerase genes respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that its three kinds of xylose isomerase genes of sequencing proof have been reconstituted in recon.The also process that grows in the G418 resistant panel was carried out shake flask fermentation 2 days at 30C respectively with the recon that gene specific primer carries out the PCR checking, with fermented liquid centrifuging and taking supernatant.With His6 fusion rotein purification kit purification of target albumen; With the His tag monoclonal antibody three kinds of target proteins of purifying are carried out protein blot experiment; The result shows that these three kinds of target proteins can both combine with the His tag monoclonal antibody, proves that these three kinds of xylose isomerase genes can both express justacrine outside born of the same parents in yeast saccharomyces cerevisiae.With the xylose isomerase enzymic activity of ordinary method mensuration fermented liquid, according to enzyme assay, the recon of screening high expression level xylose isomerase is expressed the saccharomyces cerevisiae engineered yeast of frameworks as containing three kinds of xylose isomerase genes.
Mix xylose isomerase 2.3 produce reorganization
The xylose isomerase gene that will contain the hot bacterium that dwells is respectively expressed xylose isomerase gene expression framework of framework, streptomycete and the saccharomyces cerevisiae engineered yeast that colibacillary xylose isomerase gene is expressed framework; The xylose isomerase gene that the xylose isomerase gene that only contains the hot bacterium that dwells expresses the saccharomyces cerevisiae engineered yeast of framework, only contain streptomycete expresses the saccharomyces cerevisiae engineered yeast of framework, only contain colibacillary L xylose isomerase gene expresses the saccharomyces cerevisiae engineered yeast of framework and does not contain xylose isomerase gene and express the yeast saccharomyces cerevisiae of framework and be inoculated in solid-state fermentation culture medium respectively and (in per 1000 grams, contain Semen Maydis powder 44 grams respectively; Dregs of beans 2.5 grams; Husk 2.5 grams; Water 51 grams) in, cultivated 3 days for 30 ℃.Through centrifugal; Collect above-mentioned fermented liquid supernatant respectively; The method of using conventional wood sugar determination of activity (is that the enzymolysis wood sugar generates xylulose; Content through the xylulose that measure to generate obtains enzymic activity then) respectively at pH7 and 90 ℃; PH 8 and 80 ℃; And pH 6 and 50 ℃ of xylose isomerase enzymic activitys of measuring above-mentioned fermented liquid; And outcome record shown that in table 2. table 2 result the xylose isomerase gene that contains the hot bacterium that dwells expresses the xylose isomerase gene of framework, streptomycete and express framework and colibacillary xylose isomerase gene and express xylose isomerase enzymic activity in the fermented liquid of saccharomyces cerevisiae engineered yeast of framework and express the xylose isomerase enzymic activity in the saccharomyces cerevisiae engineered yeast fermented liquid of framework apparently higher than the xylose isomerase gene that contains the hot bacterium that dwells; Also be higher than the xylose isomerase gene that contains streptomycete express in the fermented liquid of saccharomyces cerevisiae engineered yeast of framework the xylose isomerase enzymic activity with contain colibacillary xylose isomerase gene and express the xylose isomerase enzymic activity in the fermented liquid of saccharomyces cerevisiae engineered yeast of framework, and the former xylose isomerase enzymic activity is back three's xylose isomerase enzymic activity sum approximately.In view of the above, contain the xylose isomerase gene expression framework of the hot bacterium that dwells, the xylose isomerase gene expression framework of streptomycete and the saccharomyces cerevisiae engineered yeast that colibacillary xylose isomerase gene is expressed framework and be fit to be applied to produce reorganization mixing xylose isomerase.
The xylose isomerase enzymic activity of table 2. fermented liquid
Explain: contain single xylose isomerase gene of planting and express the structure that method and the difference of the method for the structure of the saccharomyces cerevisiae engineered yeast that contains three kinds of gene expression constructs of structure of the female engineering bacteria of wine brewing alcohol of framework is expression vector; The construction process that contains single yeast saccharomyces cerevisiae expression vector of planting the wood sugar gene expression construct is expressed the difference of method of the yeast saccharomyces cerevisiae expression vector establishment of frameworks and is that the former only contains a kind of xylose isomerase gene and expresses framework with containing three kinds of xylose isomerase genes, and the latter contains three kinds of xylose isomerase genes and expresses frameworks.
Embodiment 3:
3.1 make up the subtilis expression vector
3.1.1 structure cloning vector
By the synthetic two strands that contains two base complementrities of penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin of dna sequence dna Synesis Company of specialty, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pBM
3.1.2 obtain gene
1. the pcr amplification xylose isomerase gene of hot bacterium of dwelling
Primer 1:
5 ' GC
GAATTCATGTACGAGCCCAAACCGG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCCCCGCACCCCCAGGAGGTACTCCACC3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Use the method for conventional bacterial genomes DNA extraction and extract the genomic dna of the hot bacterium that dwells; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of the hot bacterium that dwells through sequencing with the BLAST software analysis that NCBI provides.
2. the xylose isomerase gene of pcr amplification streptomycete
Primer 1:
5 ' GC
GAATTCATGAGCTACCAGCCCACCCCCG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to GCCCCGCGCGCCCAGCAGGTGGTCCATC, and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
[the hot mycetocyte of will dwelling is added on the Snailase solution (Snailase is with the sorbyl alcohol dissolving of 1mol/L) of 9mg/ml in 30 ℃ of joltings 30 minutes to the genomic dna of extraction streptomycete; Extract its genomic dna according to the bacterial genomes DNA extraction method of routine then]; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of streptomycete through sequencing with the BLAST software analysis that NCBI provides.
3. the colibacillary xylose isomerase gene of pcr amplification
Primer 1:5 ' GG
GAATTCATGCAAGCCTATTTTGACCAGCTCGAT3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Thing 2:CA
GCGGCCGCTCA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to GACACCGGTGGTGAAACCGCCTGCTTTG, and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Extracting colibacillary genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves colibacillary xylose isomerase gene sequence through sequencing with the BLAST software analysis that NCBI provides.
Express framework 3.1.3 make up three kinds of xylose isomerase genes respectively.
1. use the glyceraldehyde 3-phosphate dehydrogenase promoter sequence primer 1 of pcr amplification bacillus megaterium (Bacillus megaterium):
5’CCTACGTAGATCCATTATCGGTGAACCA?3’
Primer 2:
5’GG
GCATGCGGGTATTTCCTCCTTGAATGT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
[huge subtilis genome DNA extracting method: the Snailase solution (Snailase is with the sorbyl alcohol dissolving of 1mol/L) that the bacillus subtilis mycetocyte is added on 9mg/ml in 30 ℃ of joltings 30 minutes, extracts its genomic dna according to the bacterial genomes DNA extraction method of routine to the genomic dna of extraction bacillus megaterium then.]; Genomic dna with bacillus megaterium is a template; Use primer 1 and carry out pcr amplification with primer 2; The PCR product proves the promoter sequence [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of bacillus megaterium] of bacillus megaterium glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides:
CCTACGTAGATCCATTATCGGTGAACCATCTATTAAAGACATGCTTCATTTAATTAAGTCCGCTGGTATGGTTGTTCACGGAATAGGAGACGCTATGACAATGGCAGAACGCCGTAAAACACCACAAGCAGACTTAGAAAAAGTGAAAAATGGACATGCTGTAGGTGAGGCATTTGGATACTATTTTAATCATCAAGGCGAAGTTGTTCATAAAGTTAAAACAGTTGGCATACAACTCGATGATTTAAAGAACAATAAATGTGTTATTGCTGTTGCAGGAGGTTCATCAAAAGCAAAGGCAATTAAAGCGTTTATGCAACAAGCGCATGATTCGATTCTCATTACAGATGAAGGCGCCGCAAAAGAGTTAGTAAGGGATTTTAATTAATCCCTCATATAAAAAATACTTTTTACATTCAAGGAGGAAATACCC
GCATGCCC
2. by the synthetic alpha factor signal peptide of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
3. by the synthetic Transcription Termination subsequence of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
4.: with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
5. with the PCR rDNA sequence that from the subtilis genome, increases
Primer 1.
5’CC
GGTACCgacgaacgctggcggcgtgc3’
Primer 2.
5’CC
TTCGAAgcaccttccgatacggctacct3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)].
Extract subtilis genomic dna (genome DNA extracting method is with the genome DNA extracting method of above-described huge subtilis); Is that template applications primer 1 carries out pcr amplification with primer 2 with the genomic dna, the PCR product of acquisition proves the rDNA sequence in the subtilis genome through sequential analysis and the BLAST software analysis that provides with NCBI.
6. the expression cassette framework is built process:
A. the structure of expression framework that contains the xylose isomerase gene of the hot bacterium that dwells
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of bacillus megaterium is reconstituted in the MCS of pBM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBM carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of the hot bacterium that dwells is reconstituted in the MCS of pBM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pBM carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains the hot bacterium that dwells is expressed framework is called pBM1.
B. the structure of expression framework that contains the xylose isomerase gene of streptomycete
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of bacillus megaterium is reconstituted in the MCS of pBM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBM carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of streptomycete is reconstituted in the MCS of pBM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pBM carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains streptomycete is expressed framework is called pBM2.
C. the structure that contains the expression framework of colibacillary xylose isomerase gene
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of bacillus megaterium is reconstituted in the MCS of pBM carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBM carrier, and is located at the downstream of promoter sequence; Colibacillary xylose isomerase gene sequence is reconstituted in the MCS of pBM carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pBM carrier, and is located at the downstream of signal peptide sequence.This carrier that contains colibacillary xylose isomerase gene expression framework is called pBM3.
7. accomplish the structure of expression vector
A. will express framework and be assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, cut the expression framework of pBM2 and pBM3 carrier respectively, and this above two cover is expressed the MCS that framework is inserted in pBM1 successively.This carrier is called pBM123.
B. the effect through DNA restriction enzyme and T4DNA ligase enzyme successively with the rDNA sequence (DNA recombination sequence) of subtilis and G418 recombination in the MCS of pBM123 carrier.Constitute and contain the subtilis expression vector (accompanying drawing 3) that three kinds of xylose isomerase genes are expressed framework.
Contain the subtilis engineering bacteria that three kinds of xylose isomerase genes are expressed framework 3.2 make up
The electricity consumption method for transformation will contain the subtilis expression vector conversion subtilis that three kinds of xylose isomerase genes are expressed framework; To pass through the subtilis of electric transformation and coat the G418-LB [(configuration of per 100 milliliters of LB solid mediums: 1% Tryptones; 0.5% yeast extract, 1% sodium-chlor, 1.5% agar powder; Add water to 100 milliliters, autoclaving); In dissolved LB solid medium (temperature 45-50 ℃), adding final concentration is the G418 of 700 μ g/ml, pours in the flat board behind the mixing] flat board, grow bacterium colony (recon) 37 ℃ of cultivations after 2 days.Verify recon with PCR method amplification target gene: using the special primer of above-described three kinds of xylose isomerase genes respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that its three kinds of xylose isomerase genes of sequencing proof have been reconstituted in recon.The also process that grows in the G418 resistant panel was carried out shake flask fermentation 2 days at 37 ℃ respectively with the recon that gene specific primer carries out the PCR checking, with fermented liquid centrifuging and taking supernatant.With His6 fusion rotein purification kit purification of target albumen; With the His tag monoclonal antibody three kinds of target proteins of purifying are carried out protein blot experiment; The result shows that these three kinds of target proteins can both combine with the His tag monoclonal antibody, proves that these three kinds of xylose isomerase genes can both express justacrine outside born of the same parents in subtilis.With the xylose isomerase enzymic activity of ordinary method mensuration fermented liquid, according to enzyme assay, the recon of screening high expression level xylose isomerase is expressed the subtilis engineering bacteria of frameworks as containing three kinds of xylose isomerase genes.
Mix xylose isomerase 3.3 produce reorganization
The xylose isomerase gene that will contain the hot bacterium that dwells is respectively expressed xylose isomerase gene expression framework of framework, streptomycete and the subtilis engineering bacteria that colibacillary xylose isomerase gene is expressed framework; The xylose isomerase gene that the xylose isomerase gene that only contains the hot bacterium that dwells expresses the subtilis engineering bacteria of framework, only contain streptomycete expresses the subtilis engineering bacteria of framework, only contain colibacillary L xylose isomerase gene expresses the subtilis engineering bacteria of framework and does not contain xylose isomerase gene and express the subtilis of framework and be inoculated in solid-state fermentation culture medium (straw powder 150 grams, Semen Maydis powder 250 grams, glucose 50 grams, Tryptones 20 grams, NH respectively
4NO
315 grams, KH
2PO
410 grams, H
2O 500 grams) cultivated 2 days for 37 ℃.Through centrifugal; Collect above-mentioned fermented liquid supernatant respectively; The method of using conventional wood sugar determination of activity (is that the enzymolysis wood sugar generates xylulose; Content through the xylulose that measure to generate obtains enzymic activity then) respectively at pH7 and 90 ℃; PH 8 and 80 ℃; And pH 6 and 50 ℃ of xylose isomerase enzymic activitys of measuring above-mentioned fermented liquid; And outcome record shown that in table 3. table 3 result the xylose isomerase gene that contains the hot bacterium that dwells expresses the xylose isomerase gene of framework, streptomycete and express framework and colibacillary xylose isomerase gene and express xylose isomerase enzymic activity in the fermented liquid of subtilis engineering bacteria of framework and express the xylose isomerase enzymic activity in the subtilis engineering bacterium fermentation liquid of framework apparently higher than the xylose isomerase gene that contains the hot bacterium that dwells; Also be higher than the xylose isomerase gene that contains streptomycete express in the fermented liquid of subtilis engineering bacteria of framework the xylose isomerase enzymic activity with contain colibacillary xylose isomerase gene and express the xylose isomerase enzymic activity in the fermented liquid of subtilis engineering bacteria of framework, and the former xylose isomerase enzymic activity is back three's xylose isomerase enzymic activity sum approximately.In view of the above, contain the xylose isomerase gene expression framework of the hot bacterium that dwells, the xylose isomerase gene expression framework of streptomycete and the subtilis engineering bacteria that colibacillary xylose isomerase gene is expressed framework and be fit to be applied to produce reorganization mixing xylose isomerase.
The xylose isomerase enzymic activity of table 1. fermented liquid
Explain: contain single xylose isomerase gene of planting and express the structure that method and the difference of the method for the structure of the subtilis engineering bacteria that contains three kinds of gene expression constructs of structure of the subtilis engineering bacteria of framework is expression vector; The construction process that contains single subtilis expression vector of planting the wood sugar gene expression construct is expressed the difference of method of the subtilis expression vector establishment of frameworks and is that the former only contains a kind of xylose isomerase gene and expresses framework with containing three kinds of xylose isomerase genes, and the latter contains three kinds of xylose isomerase genes and expresses frameworks.
Claims (2)
1. produce the xylose isomerase enzyme method for one kind, it is characterized in that its concrete steps are following:
1), the applied molecular biology technology is cloned the dwell xylose isomerase gene of hot bacterium, xylose isomerase gene and the colibacillary xylose isomerase gene of streptomycete;
2), make up yeast expression vector, yeast saccharomyces cerevisiae expression vector and the subtilis expression vector of the expression framework that contains said gene respectively;
3), the yeast expression vector with above-mentioned structure transforms pichia spp acquisition pichia spp recon; The yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae of above-mentioned structure is obtained the yeast saccharomyces cerevisiae recon, with the subtilis expression vector conversion subtilis acquisition subtilis recon of above-mentioned structure;
4), the pichia spp recon of the above-described three kinds of xylose isomerases of screening high expression level is expressed the Pichia yeast engineering of framework and colibacillary xylose isomerase gene expression framework as the xylose isomerase gene of the xylose isomerase gene that contains the hot bacterium that dwells, streptomycete; The saccharomyces cerevisiae engineered yeast that the yeast saccharomyces cerevisiae recon of the above-described three kinds of xylose isomerases of screening high expression level is expressed framework as xylose isomerase gene expression framework and the colibacillary xylose isomerase gene of the xylose isomerase gene that contains the hot bacterium that dwells, streptomycete, the subtilis recon of the above-described three kinds of xylose isomerases of screening high expression level are expressed the subtilis engineering bacteria of framework and colibacillary xylose isomerase gene expression framework as the xylose isomerase gene of the xylose isomerase gene that contains the hot bacterium that dwells, streptomycete;
5), ferment respectively above-described Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and subtilis engineering bacteria produced xylose isomerase.
2. according to the said a kind of method of producing xylose isomerase of claim 1, it is characterized in that: utilize the method for the described production xylose isomerase of claim 1 to prepare the xylose isomerase enzyme product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102518393A CN102747063A (en) | 2012-07-09 | 2012-07-09 | Xylose isomerase producing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102518393A CN102747063A (en) | 2012-07-09 | 2012-07-09 | Xylose isomerase producing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102747063A true CN102747063A (en) | 2012-10-24 |
Family
ID=47027555
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102518393A Pending CN102747063A (en) | 2012-07-09 | 2012-07-09 | Xylose isomerase producing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102747063A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434503A (en) * | 2016-09-14 | 2017-02-22 | 南京百斯杰生物工程有限公司 | Recombinant streptomyces of high-expression glucose isomerase |
| US9951326B2 (en) | 2015-07-13 | 2018-04-24 | MARA Renewables Corporation | Enhancing microbial metabolism of C5 organic carbon |
| CN113293121A (en) * | 2021-06-17 | 2021-08-24 | 福州大学 | Intelligent carbon metabolism flow rate regulation and control method for producing xylitol by using escherichia coli |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698840A (en) * | 2009-10-25 | 2010-04-28 | 中国热带农业科学院热带生物技术研究所 | Method for expressing xylose isomerase by applying pGAP regulation of Pichia pastoris |
| CN102286443A (en) * | 2011-07-16 | 2011-12-21 | 中国热带农业科学院热带生物技术研究所 | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase |
-
2012
- 2012-07-09 CN CN2012102518393A patent/CN102747063A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698840A (en) * | 2009-10-25 | 2010-04-28 | 中国热带农业科学院热带生物技术研究所 | Method for expressing xylose isomerase by applying pGAP regulation of Pichia pastoris |
| CN102286443A (en) * | 2011-07-16 | 2011-12-21 | 中国热带农业科学院热带生物技术研究所 | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase |
Non-Patent Citations (1)
| Title |
|---|
| 尹慧祥: "木糖异构酶和木酮糖激酶基因克隆、表达及活性分析", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9951326B2 (en) | 2015-07-13 | 2018-04-24 | MARA Renewables Corporation | Enhancing microbial metabolism of C5 organic carbon |
| US10662418B2 (en) | 2015-07-13 | 2020-05-26 | MARA Renewables Corporation | Enhancing microbial metabolism of C5 organic carbon |
| CN106434503A (en) * | 2016-09-14 | 2017-02-22 | 南京百斯杰生物工程有限公司 | Recombinant streptomyces of high-expression glucose isomerase |
| CN106434503B (en) * | 2016-09-14 | 2020-04-24 | 南京百斯杰生物工程有限公司 | Recombinant streptomycete for high expression of glucose isomerase |
| CN113293121A (en) * | 2021-06-17 | 2021-08-24 | 福州大学 | Intelligent carbon metabolism flow rate regulation and control method for producing xylitol by using escherichia coli |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105602879A (en) | Genetic engineering strain capable of effectively secreting D-psicose 3-epimerase and construction method and application thereof | |
| CN108603186B (en) | Yeast strain co-expressing exogenous saccharifying enzyme, method for obtaining yeast strain and application of yeast strain in production of bioethanol | |
| CN101631864A (en) | Method for preparing butanol through butyryl-coa as an intermediate using yeast | |
| CN105505969A (en) | Method for improving conversion rate of L-threonine and application of method | |
| CN103321074A (en) | Method for degrading plant lignin by using Bacillus subtilis engineering bacterial | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN103952326B (en) | The recombinant pichia yeast strain of a kind of coexpression alantin excision enzyme and restriction endonuclease and construction method and application | |
| CN102747063A (en) | Xylose isomerase producing method | |
| CN104789586B (en) | Genome of E.coli integration vector, genetic engineering bacterium and the application in xylitol is produced | |
| CN103261397B (en) | It is ethanol that xylose isomerase and xylitol dehydrogenase, which are combined for wood-sugar fermentation, and bacteroides fragilis xylose dehydrogenase | |
| CN101323838B (en) | Recombinant distiller's yeast and use thereof in eutrit production | |
| CN101613707B (en) | Method for producing glutathione by use of metabolic engineering bacteria | |
| CN103131720A (en) | Fungi xylose isomerase gene and application thereof | |
| CN105602881B (en) | A kind of temperature sensitive type recombination corynebacterium glutamicum and its application producing glutamic acid | |
| US10392624B2 (en) | Gene engineering yeast having saccharification function, method of preparing same, and application of same | |
| Naumova et al. | Molecular genetic characteristics of Saccharomyces cerevisiae distillers’ yeasts | |
| WO2003016525A9 (en) | Process for producing alcohol from starch | |
| CN104073449B (en) | One strain is suitable for bakery yeast and the selection thereof of plain doughs fermentation | |
| CN103667274A (en) | Hansenula polymorpha genetic operation strategy and application thereof | |
| CN103233382A (en) | Method for degrading plant lignin by using pichia pastoris engineered bacteria | |
| CN102719459B (en) | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase | |
| CN108865914B (en) | Recombinant saccharomyces cerevisiae strain capable of degrading lignocellulose and application thereof | |
| CN102747062A (en) | Method for producing enzyme system of starch hydrolyzing-generated high fructose corn syrup | |
| CN107815461A (en) | Rumen Fungi xylose isomerase gene and its application | |
| CN103757035B (en) | The Kluyveromyces lactis eukaryon expression of Mus ash streptomycete AMP deaminase gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121024 |