CN102747062A - Method for producing enzyme system of starch hydrolyzing-generated high fructose corn syrup - Google Patents
Method for producing enzyme system of starch hydrolyzing-generated high fructose corn syrup Download PDFInfo
- Publication number
- CN102747062A CN102747062A CN2012102518374A CN201210251837A CN102747062A CN 102747062 A CN102747062 A CN 102747062A CN 2012102518374 A CN2012102518374 A CN 2012102518374A CN 201210251837 A CN201210251837 A CN 201210251837A CN 102747062 A CN102747062 A CN 102747062A
- Authority
- CN
- China
- Prior art keywords
- gene
- isoamylase
- xylose isomerase
- framework
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for producing an enzyme system of starch hydrolyzing-generated high fructose corn syrup, belonging to the biological technical field, comprising the steps of cloning isoamylase gene of pseudomonas putida, glucamylase gene of aspergillus and xylose isomerase gene of thermal bacteria respectively; constructing Pichia expression vector, saccharomyces cerevisiae expression vector and bacillus subtilis expression vector containing three gene expression frameworks; transforming the vectors to be corresponding host strains so as to obtain engineering bacteria. The Pichia engineering bacterium, saccharomyces cerevisiae engineering bacterium and bacillus subtilis engineering bacterium are used for producing combined and mixed isoamylase, glucamylase and xylose isomerase (enzyme system of high fructose corn syrup obtained by hydrolyzing starch). The method uses one process to produce enzyme system of starch hydrolyzing-generated high fructose corn syrup at the same time, solves the problem that the cost for respectively producing three enzymes is high so as to limit industrial development for producing the high fructose corn syrup by enzyme method, provides the new enzyme system product for market and is beneficial to accelerating development for producing the high fructose corn syrup by enzyme method.
Description
Technical field
The invention belongs to biological technical field, relate to the structure microbial engineering bacteria and produce recombinase.Specifically be that the using microbe engineering bacteria is produced the enzyme system that hydrolyzed starch is a high fructose syrup.
Background technology
High fructose syrup is a kind of novel sweetener.The sugariness of high fructose syrup is the highest, is equivalent to 1.8 times of sucrose, and high fructose syrup has the local flavor and the performance that is difficult for causing blood sugar increasing of similar honey.Current, demand is big both at home and abroad, is mainly used in beverage, bread, milk preparation, can, fructose and other food of field of food.Starch be the preparation high fructose syrup mainly be raw material.
Use sweetless starch to be transformed into glucose, generate fructose through the isomerization reaction convert glucose again, produce high fructose syrup (mixture of fructose and glucose) with sweet taste as raw material.
Starch is made up of straight chain and side chain.Side chain is connected by α-1,6 glycosidic link, and is connected by α-1,4 glycosidic link between the glycan molecule of straight chain.In natural starchy material, the content of pulullan accounts for 70%～95%, and the content of amylose starch≤30%.(Isoamylase, E.C.3.2.1.68) ability specificity ground decomposes α-1,6 glycosidic link of tapping point in the pulullan to isoamylase, and pulullan is converted into amylose starch, therefore is called debranching factor again.(Glucoamylase E.C.3.2.1.3), is called for short saccharifying enzyme to glucoamylase.Glucoamylase can be hydrolyzed to glucose for the catalysis amylose starch.Under the combined action of isoamylase and glucoamylase, the starch hydrolysis generates glucose.Xylose isomerase has the function that isomery glucose is fructose.The Production by Enzymes high fructose syrup is the main path that high fructose syrup is produced.Current, the method for Production by Enzymes high fructose syrup is to produce isoamylase and glucoamylase earlier, through the effect of isoamylase and glucoamylase, the starch hydrolysis is generated glucose; Then, use xylose isomerase isomery glucose to be fructose again, produce fructose and glucose blended high fructose syrup.The production respectively of these enzymes needs great amount of manpower and energy consumption.
The current single enzyme of planting that has only these enzymes does not on the market still mix the bacterial classification and the mixed enzyme product of expressing these enzymes.Pichia spp (Pichia pastoris), yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) and subtilis (Bacillus subtilis) all are the host bacterium that is usually used in producing recombinant protein, but respectively have characteristic.The principal character of pichia spp is the characteristics that the few oneself protein of secretion helps the purifying of expression product, and subtilis and yeast saccharomyces cerevisiae have facultative aerobic characteristic, is suitable for solid anaerobic digestion and produces recombinase.
Summary of the invention
The present invention has the effect (being that isoamylase and glucoamylase and xylose isomerase are that the enzyme that hydrolyzed starch generates high fructose syrup is) that the associating hydrolyzed starch generates high fructose syrup according to isoamylase and glucoamylase and xylose isomerase, and also not having the enzyme of the hydrolyzed starch generation high fructose syrup of isoamylase, glucoamylase and xylose isomerase on the market is product; Pichia spp, yeast saccharomyces cerevisiae and subtilis are the host bacterium that is usually used in expressing foreign protein, and through Protocols in Molecular Biology make up contain the isoamylase gene expression construct (explanation. promotor-signal peptide-gene-transcription terminator), glucose amylase gene expresses Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and the subtilis engineering bacteria of framework and xylose isomerase gene expression framework express framework:.Use the Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and the subtilis engineering bacteria that contain isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene expression framework to produce the enzyme system (isoamylase, glucoamylase and xylose isomerase) of hydrolyzed starch as high fructose syrup.
The technical scheme that the present invention adopted is:
1. clone the enzyme gene: the applied molecular biology technology; Amplification isoamylase gene from false pseudomonas bacillus (pseudomonas) genome; The glucose amylase gene that from aspergillus (Aspergillus) genome, increases, xylose isomerase gene increases from hot bacterium (Thermus) genome of dwelling.
2. obtain the required promotor of construction of expression vector, recombination sequence, signal peptide, Transcription Termination subsequence and resistant gene.
3. make up like the yeast expression vector of accompanying drawing 1, the yeast saccharomyces cerevisiae expression vector of accompanying drawing 2 and the subtilis expression vector of accompanying drawing 3.
4. the yeast expression vector of answering the electricity consumption method for transformation will contain isoamylase gene expression construct, glucose amylase gene expression framework, xylose isomerase gene expression framework transforms pichia spp; Answer the electricity consumption method for transformation will contain the yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae of isoamylase gene expression construct, glucose amylase gene expression framework, xylose isomerase gene expression framework; The subtilis expression vector of answering the electricity consumption method for transformation will contain isoamylase gene expression construct, glucose amylase gene expression framework, xylose isomerase gene expression framework transforms subtilis.Screen pichia spp recon, yeast saccharomyces cerevisiae recon and the subtilis recon of high expression level isoamylase, glucoamylase and xylose isomerase respectively and express Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and the subtilis engineering bacteria of framework as containing isoamylase, glucoamylase and xylose isomerase gene.
5. fermentation contains the enzyme system (isoamylase, glucoamylase and xylose isomerase) that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed the Pichia yeast engineering of framework, saccharomyces cerevisiae engineered yeast and subtilis engineering bacteria production hydrolyzed starch generation high fructose syrup respectively.
The present invention make up contain isoamylase gene expression construct, glucose amylase gene express framework and xylose isomerase gene express advantage applies that Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and the subtilis engineering bacteria of framework produce isoamylase, glucoamylase and xylose isomerase in:
(1) has the characteristic that synergetic hydrolysis starch generates high fructose syrup to isoamylase, glucoamylase and xylose isomerase; Be that isoamylase, glucoamylase and xylose isomerase are the glucogenic enzyme of hydrolyzed starch systems, and the demand this kind of enzyme is a product on the market.The present invention is through making up engineering bacteria; The application project bacterium produces reorganization and mixes isoamylase, glucoamylase and xylose isomerase; The product innovation that mixes isoamylase, αDian Fenmei and glucoamylase is provided on the one hand; Replace the bacterial strain production isoamylase that fermentation respectively contains the isoamylase gene on the other hand, fermentation contains the bacterial strain of glucose amylase gene and produces glucoamylase, and fermentation contains the bacterial strain of xylose isomerase gene and produces xylose isomerase.Promptly produce the enzyme system that whole hydrolyzed starch generates high fructose syrup and replace three kinds of enzymes producing hydrolyzed starch generation high fructose syrup with a plurality of operations respectively with a fermentation procedure.Reach the effect of having saved starting material, energy consumption and manpower.
(2) pichia spp, yeast saccharomyces cerevisiae and subtilis each tool characteristic aspect the production recombinant protein; The present invention makes up respectively and contains Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and the subtilis engineering bacteria that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework, selects for its recombinase production provides multiple host.
Description of drawings
P. the glyceraldehyde 3-phosphate dehydrogenase promotor of pichia spp; S. alpha factor signal peptide; Iso. the isoamylase gene of false pseudomonas bacillus; Gai. aspergillar glucose amylase gene; Xi. the dwell xylose isomerase gene of hot bacterium; T. Transcription Termination subsequence; G418. resistant gene (being applied to screen the pichia spp recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of P.pastoris rDNA. pichia spp.
Accompanying drawing 2. contains the yeast saccharomyces cerevisiae expression vector that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework
P. the glyceraldehyde 3-phosphate dehydrogenase promotor of yeast saccharomyces cerevisiae; S. alpha factor signal peptide; Iso. the isoamylase gene of false pseudomonas bacillus; Gai. aspergillar glucose amylase gene; Xi. the dwell xylose isomerase gene of hot bacterium; T. Transcription Termination subsequence; G418. resistant gene (being applied to screen the yeast saccharomyces cerevisiae recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of S.cerevisiae rDNA. yeast saccharomyces cerevisiae.
Accompanying drawing 3. contains the subtilis expression vector that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework
P. the glyceraldehyde 3-phosphate dehydrogenase promotor of bacillus megaterium; S. alpha factor signal peptide; Iso. the isoamylase gene of false pseudomonas bacillus; Gai. aspergillar glucose amylase gene; Xi. the dwell xylose isomerase gene of hot bacterium; T. Transcription Termination subsequence; G418. resistant gene (being applied to screen the subtilis recon); ColE1. intestinal bacteria replication orgin; AMP. ampicillin resistance gene (being applied to screen the intestinal bacteria transformant); The rDNA sequence of B.subtilis rDNA. subtilis.
Embodiment
With indefiniteness embodiment the present invention is described further below.
Embodiment 1:
1.1 structure yeast expression vector
1.1.1 structure cloning vector
By the synthetic two strands that contains two base complementrities of penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin of dna sequence dna Synesis Company of specialty, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pPG
1.1.2 obtain gene
1. the isoamylase gene of the false pseudomonas bacillus of pcr amplification (Pseudomonas)
Primer 1:5 ' CG
GATATCGCCATCAACAGCATGAGC3 '
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2: 5 ' CA
GCGGCCGCCTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CTTGGAGATCAACAGCAGCAGCGATTG3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
The method of using conventional bacterial genomes DNA extraction is extracted the genomic dna of false pseudomonas bacillus; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the isoamylase gene order of false pseudomonas bacillus through sequencing with the BLAST software analysis that NCBI provides.
2. the glucose amylase gene (comprising signal peptide) of reverse transcription PCR amplification aspergillus (Aspergillus)
Primer 1:
5’CC
GGATCCATGTCGTTCCGATCTCTTCT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCCTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCGCCAGGTGTCAGTCACCGTCGCGGT 3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Using fungus RNA extracts test kit and extracts the total RNA of aspergillar; Use synthetic its cDNA of cDNA synthetic agent box; Use primer 1 and carry out pcr amplification with primer 2, the PCR product of acquisition proves the glucose amylase gene sequence that aspergillar contains signal peptide through sequential analysis with the BLAST software analysis that NCBI provides.
3. the pcr amplification xylose isomerase gene of hot bacterium of dwelling
Primer 1:
5 ' GC
GAATTCATGTACGAGCCCAAACCGG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCCCCGCACCCCCAGGAGGTACTCCACC3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Use the method for conventional bacterial genomes DNA extraction and extract the genomic dna of the hot bacterium that dwells; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of the hot bacterium that dwells through sequencing with the BLAST software analysis that NCBI provides.
Express framework 1.1.3 make up isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene respectively.
1. use the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of pcr amplification pichia spp.
Primer 1:
5’CC
TACGTAGGATCCTTTTTTGTAGAAATGTCTTGG?3’
Primer 2:
5’GG
GCATGCTGTGTTTTGATAGTTGTTC?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is wherein arranged)]
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides.[explain: the pichia spp genome DNA extracting method: the Snailase solution (Snailase with 1mol/L sorbyl alcohol dissolving) that the pichia spp cell is added on 9mg/ml extracts its genomic dna according to the bacterial genomes DNA extraction method of routine then in 30 ℃ of joltings 30 minutes.]
2. by the synthetic alpha factor signal peptide of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGA?AAAGAGAGGCTGAAGCTTAC
ACTAGTCC
3. by the synthetic Transcription Termination subsequence of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
4.: with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
5. pcr amplification rDNA sequence from the pichia spp genome
Primer 1:
5’CC
GGTACCggcttccaggacgtatcgcggatcgctgcgttcttcatc3’
Primer 2:
Primer 2: 5 ' CC
TTCGAAAgccccgtggcacacgaccaatcttcccagccgaca 3 '
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting the pichia spp genomic dna, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product of acquisition proves the rDNA sequence in the pichia spp genome through sequential analysis and the BLAST software analysis that provides with NCBI.
6. the expression cassette framework is built process:
A. the structure that contains isoamylase expression of gene framework:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPG carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPG carrier, and is located at the downstream of promoter sequence; The isoamylase gene order of false pseudomonas bacillus is reconstituted in the MCS of pPG carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pPG carrier, and is located at the gene order downstream.This carrier that contains the isoamylase gene expression construct is called pPG1.
B. contain glucose amylase gene and express the structure of framework
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPG carrier; The aspergillar glucose amylase gene sequence that will comprise signal peptide is reconstituted in the MCS of pPG carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pPG carrier, and is located at the gene order downstream.This carrier that contains glucose amylase gene expression framework is called pPG2.C. the structure of expression framework that contains the xylose isomerase gene of the hot bacterium that dwells
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of pichia spp is reconstituted in the MCS of pPG carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pPG carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of the hot bacterium that dwells is reconstituted in the MCS of pPG carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pPG carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains the hot bacterium that dwells is expressed framework is called pPG3.
7. accomplish the structure of expression vector
A. will express framework and be assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4DNA ligase enzyme, cut the expression framework of pPG2 and pPG3 carrier respectively, and this above two cover is expressed the MCS that framework is inserted in pPG1 successively.This carrier is called pPG123.
B. the effect through DNA restriction enzyme and T4DNA ligase enzyme successively with the rDNA sequence (DNA recombination sequence) of pichia spp and G418 recombination in the MCS of pPG123 carrier.Constitute and contain the yeast expression vector (accompanying drawing 1) that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework.
Contain the Pichia yeast engineering that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework 1.2 make up
The electricity consumption method for transformation will contain the yeast expression vector conversion pichia spp that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework; To pass through the pichia spp of electric transformation and coat G418-YPD (2% peptone; 1% yeast extract, 2% glucose, 1.5% agar powder; Final concentration is the G418 of 700 μ g/ml) flat board, grow bacterium colony (recon) 30 ℃ of cultivations after 3 days.Verify recon with PCR method amplification target gene: using the special primer of above-described isoamylase gene, glucose amylase gene and xylose isomerase gene respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that its isoamylase gene of sequencing proof, glucose amylase gene and xylose isomerase gene have been reconstituted in recon.The also process that grows in the G418 resistant panel was carried out shake flask fermentation 2 days at 30 ℃ respectively with the recon that gene specific primer carries out the PCR checking; Measure isoamylase activity, glucose-amylase activity and the xylose isomerase enzymic activity of fermented liquid with ordinary method; According to enzyme assay, the recon of the above-described three kinds of enzymes of screening high expression level is expressed the Pichia yeast engineering of framework as containing isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene.
Mix isoamylase, glucoamylase and xylose isomerase 1.3 produce reorganization
The Pichia yeast engineering that will contain isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene expression framework is inoculated in YPD liquid nutrient medium (2% peptone; 1% yeast extract; 2% glucose) fermentation is 2 days in, the centrifuging and taking supernatant.With isoamylase, glucoamylase and the xylose isomerase in the conventional His label affinity purification method purified fermentation broth.Reorganization mixing isoamylase, glucoamylase and xylose isomerase that purifying is obtained are applied to the test of hydrolysis tapioca(flour) generation high fructose syrup, obtain high fructose syrup, prove that above mixed enzyme of producing has the function of hydrolyzed starch production high fructose syrup.
Explanation. prepare the basic skills of the method for high fructose syrup, but the enzyme of usefulness is to express reorganization mixing isoamylase, glucoamylase and the xylose isomerase that the Pichia yeast engineering of framework is produced with above-described isoamylase gene expression construct, glucose amylase gene expression framework and the xylose isomerase gene of containing according to the enzymatic hydrolysis starch production high fructose syrup of routine.
Embodiment 2:
2.1 make up the yeast saccharomyces cerevisiae expression vector
2.1.1 structure cloning vector
Contain penbritin (AMP) gene order by dna sequence dna Synesis Company of specialty is synthetic, the two strands of two base complementrities of polyclone joint and intestinal bacteria replication orgin, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pSG.
2.1.2 obtain gene
1. the isoamylase gene of the false pseudomonas bacillus of pcr amplification (Pseudomonas)
Primer 1:5 ' CG
GATATCGCCATCAACAGCATGAGC3 '
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2: 5 ' CA
GCGGCCGCCTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CTTGGAGATCAACAGCAGCAGCGATTG3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
The method of using conventional bacterial genomes DNA extraction is extracted the genomic dna of false pseudomonas bacillus; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the isoamylase gene order of false pseudomonas bacillus through sequencing with the BLAST software analysis that NCBI provides.
2. the glucose amylase gene (comprising signal peptide) of reverse transcription PCR amplification aspergillus (Aspergillus)
Primer 1:
5’CC
GGATCCATGTCGTTCCGATCTCTTCT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCCTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCGCCAGGTGTCAGTCACCGTCGCGGT 3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Using fungus RNA extracts test kit and extracts the total RNA of aspergillar; Use synthetic its cDNA of cDNA synthetic agent box; Use primer 1 and carry out pcr amplification with primer 2, the PCR product of acquisition proves the glucose amylase gene sequence that aspergillar contains signal peptide through sequential analysis with the BLAST software analysis that NCBI provides.
3. the pcr amplification xylose isomerase gene of hot bacterium of dwelling
Primer 1:
5 ' GC
GAATTCATGTACGAGCCCAAACCGG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCCCCGCACCCCCAGGAGGTACTCCACC3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Use the method for conventional bacterial genomes DNA extraction and extract the genomic dna of the hot bacterium that dwells; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of the hot bacterium that dwells through sequencing with the BLAST software analysis that NCBI provides.
Express framework 2.1.3 make up isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene respectively.
1. use the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of pcr amplification yeast saccharomyces cerevisiae.
Primer 1:
5’CC
TACGTATCGAGTTTATCATTATCAAT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2:
5’GG
GCATGCTCGAAACTAAGTTCTTGGTG?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting genes of brewing yeast group DNA, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product proves the promoter sequence of its glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides.
[explain: genes of brewing yeast group DNA extraction method: the Snailase solution (Snailase with 1mol/L sorbyl alcohol dissolving) that brewing yeast cell is added on 9mg/ml extracts its genomic dna according to the bacterial genomes DNA extraction method of routine then in 30 ℃ of joltings 30 minutes.]
2. by the synthetic alpha factor signal peptide of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
3. by the synthetic Transcription Termination subsequence of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
4.: with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
5. pcr amplification rDNA sequence from the genes of brewing yeast group
Primer 1:
5’CC
GGTACCTGAACTAACACCTTTTGTGG3’
Primer 2:
5’CC
TTCGAAGCTAATACATGCTTAAAATC3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Extracting genes of brewing yeast group DNA, is template with the genomic dna, uses primer 1 and carries out pcr amplification with primer 2, and the PCR product of acquisition proves the rDNA sequence in the genes of brewing yeast group through sequential analysis and the BLAST software analysis that provides with NCBI.
6. the expression cassette framework is built process:
A. the structure that contains isoamylase expression of gene framework:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of yeast saccharomyces cerevisiae is reconstituted in the MCS of pSG carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pSG carrier, and is located at the downstream of promoter sequence; The isoamylase gene order of false pseudomonas bacillus is reconstituted in the MCS of pSG carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pSG carrier, and is located at the gene order downstream.This carrier that contains the isoamylase gene expression construct is called pSG1.
B. contain glucose amylase gene and express the structure of framework
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of yeast saccharomyces cerevisiae is reconstituted in the MCS of pSG carrier; The aspergillar glucose amylase gene sequence that will comprise signal peptide is reconstituted in the MCS of pSG carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pSG carrier, and is located at the gene order downstream.This carrier that contains glucose amylase gene expression framework is called pSG2.
C. the structure of expression framework that contains the xylose isomerase gene of the hot bacterium that dwells
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of yeast saccharomyces cerevisiae is reconstituted in the MCS of pSG carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pSG carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of the hot bacterium that dwells is reconstituted in the MCS of pSG carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pSG carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains the hot bacterium that dwells is expressed framework is called pSG3.
7. accomplish the structure of expression vector
A. will express framework and be assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4 dna ligase, cut the expression framework of pSG2 and pSG3 carrier respectively, and this above two cover is expressed the MCS that framework is inserted in pSG1 successively.This carrier is called pSG123.
B. the effect through DNA restriction enzyme and T4 dna ligase successively with the rDNA sequence (DNA recombination sequence) of yeast saccharomyces cerevisiae and G418 recombination in the MCS of pSG123 carrier.Constitute and contain the yeast saccharomyces cerevisiae expression vector (accompanying drawing 2) that isoamylase gene gene expression construct, glucose amylase gene gene expression construct and xylose isomerase gene are expressed framework.
Contain the saccharomyces cerevisiae engineered yeast that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework 2.2 make up
The electricity consumption method for transformation will contain the yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae that isoamylase gene, glucose amylase gene and xylose isomerase gene are expressed framework; To pass through the yeast saccharomyces cerevisiae of electric transformation and coat G418-YPD (2% peptone; 1% yeast extract, 2% glucose, 1.5% agar powder; Final concentration is the G418 of 700 μ g/ml) flat board, grow bacterium colony (recon) 30 ℃ of cultivations after 3 days.Verify recon with PCR method amplification target gene: using the special primer of above-described isoamylase gene, glucose amylase gene and xylose isomerase gene respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that its isoamylase gene of sequencing proof, glucose amylase gene and xylose isomerase gene have been reconstituted in recon.The also process that grows in the G418 resistant panel was carried out shake flask fermentation 2 days at 30 ℃ respectively with the recon that gene specific primer carries out the PCR checking; Measure isoamylase activity, glucose-amylase activity and the xylose isomerase enzymic activity of fermented liquid with ordinary method; According to enzyme assay, the recon of the above-described three kinds of enzymes of screening high expression level is expressed the saccharomyces cerevisiae engineered yeast of framework as containing isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene.
Mix isoamylase, glucoamylase and xylose isomerase 2.3 produce reorganization
The saccharomyces cerevisiae engineered yeast that will contain isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene expression framework is inoculated in solid-state fermentation culture medium and (in per 1000 grams, contains Semen Maydis powder 44 grams respectively; Dregs of beans 2.5 grams; Husk 2.5 grams; Water 51 grams) fermentation is 3 days in, the centrifuging and taking supernatant.With isoamylase, glucoamylase and the xylose isomerase in the conventional His label affinity purification method purified fermentation broth.With purifying obtain reorganization mixing isoamylase, glucoamylase and xylose isomerase be applied to the hydrolysis tapioca(flour) and generate the high fructose syrup test, obtain high fructose syrup, prove that above mixed enzyme of producing has the function of hydrolyzed starch production high fructose syrup.
Explanation. prepare the basic skills of the method for high fructose syrup, but the enzyme of usefulness is to express reorganization mixing isoamylase, glucoamylase and the xylose isomerase that the saccharomyces cerevisiae engineered yeast of framework is produced with above-described isoamylase gene expression construct, glucose amylase gene expression framework and the xylose isomerase gene of containing according to the enzymatic hydrolysis starch production high fructose syrup of routine.
Embodiment 3:
3.1 make up the subtilis expression vector
3.1.1 structure cloning vector
By the synthetic two strands that contains two base complementrities of penbritin (AMP) gene order, polyclone joint and intestinal bacteria replication orgin of dna sequence dna Synesis Company of specialty, and at the two ends of every DNA chain-ordering formation sticky end.Effect through dna ligase makes its cyclisation, forms dna cloning vector.With its cloning vector called after pBG
3.1.2 obtain gene
1. the isoamylase gene of the false pseudomonas bacillus of pcr amplification (Pseudomonas)
Primer 1:5 ' CG
GATATCGCCATCAACAGCATGAGC3 '
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
Primer 2: 5 ' CA
GCGGCCGCCTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CTTGGAGATCAACAGCAGCAGCGATTG3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
The method of using conventional bacterial genomes DNA extraction is extracted the genomic dna of false pseudomonas bacillus; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the isoamylase gene order of false pseudomonas bacillus through sequencing with the BLAST software analysis that NCBI provides.
2. the glucose amylase gene (comprising signal peptide) of reverse transcription PCR amplification aspergillus (Aspergillus)
Primer 1:
5’CC
GGATCCATGTCGTTCCGATCTCTTCT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCCTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCGCCAGGTGTCAGTCACCGTCGCGGT 3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Using fungus RNA extracts test kit and extracts the total RNA of aspergillar; Use synthetic its cDNA of cDNA synthetic agent box; Use primer 1 and carry out pcr amplification with primer 2, the PCR product of acquisition proves the glucose amylase gene sequence that aspergillar contains signal peptide through sequential analysis with the BLAST software analysis that NCBI provides.
3. the pcr amplification xylose isomerase gene of hot bacterium of dwelling
Primer 1:
5 ' GC
GAATTCATGTACGAGCCCAAACCGG3 ' [explain: 8 bases of 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (it is enzyme recognition sites that 6 bases of underscore are wherein arranged)]
Primer 2:
5 ' CA
GCGGCCGCTTA
[explain: 10 bases of 5 ' are that enzyme is cut protection base (2 bases) and enzyme recognition site (8 bases) to CCCCCGCACCCCCAGGAGGTACTCCACC3 ', and 18 bases in the square frame are dna sequence dnas of 6 Histidines of coding.]
Use the method for conventional bacterial genomes DNA extraction and extract the genomic dna of the hot bacterium that dwells; With the genomic dna is template; Use primer 1 and carry out pcr amplification with primer 2, the PCR product proves the xylose isomerase gene sequence of the hot bacterium that dwells through sequencing with the BLAST software analysis that NCBI provides.
Express framework 3.1.3 make up isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene respectively.
1. use the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of pcr amplification bacillus megaterium (Bacillus megaterium)
Primer 1:
5’CCTACGTAGATCCATTATCGGTGAACCA?3’
Primer 2:
5’GG
GCATGCGGGTATTTCCTCCTTGAATGT?3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)]
[huge subtilis genome DNA extracting method: the Snailase solution (Snailase is with the sorbyl alcohol dissolving of 1mol/L) that the bacillus subtilis mycetocyte is added on 9mg/ml in 30 ℃ of joltings 30 minutes, extracts its genomic dna according to the bacterial genomes DNA extraction method of routine to the genomic dna of extraction bacillus megaterium then.]; Genomic dna with bacillus megaterium is a template; Use primer 1 and carry out pcr amplification with primer 2; The PCR product proves the promoter sequence [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the glyceraldehyde 3-phosphate dehydrogenase promoter sequence of bacillus megaterium] of bacillus megaterium glyceraldehyde 3-phosphate dehydrogenase gene through sequencing with the BLAST software analysis that NCBI provides:
CCTACGTAGATCCATTATCGGTGAACCATCTATTAAAGACATGCTTCATTTAATTAAGTCCGCTGGTATGGTTGTTCACGGAATAGGAGACGCTATGACAATGGCAGAACGCCGTAAAACACCACAAGCAGACTTAGAAAAAGTGAAAAATGGACATGCTGTAGGTGAGGCATTTGGATACTATTTTAATCATCAAGGCGAAGTTGTTCATAAAGTTAAAACAGTTGGCATACAACTCGATGATTTAAAGAACAATAAATGTGTTATTGCTGTTGCAGGAGGTTCATCAAAAGCAAAGGCAATTAAAGCGTTTATGCAACAAGCGCATGATTCGATTCTCATTACAGATGAAGGCGCCGCAAAAGAGTTAGTAAGGGATTTTAATTAATCCCTCATATAAAAAATACTTTTTACATTCAAGGAGGAAATACCC
GCATGCCC
2. by the synthetic alpha factor signal peptide of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the alpha factor signal peptide sequence]:
CCGCATGCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTAC
ACTAGTCC
3. by the synthetic Transcription Termination subsequence of dna sequence dna Synesis Company of specialty [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is the Transcription Termination subsequence]:
GGACTAGTCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTT
ATCGATCC
4.: with the synthetic following G418 resistant gene sequence of intussusception PCR method [what sequence had underscore as follows is that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases), and what do not have underscore is G418 resistant gene sequence]
GGATCGATCCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
GGTACCGG
5. with the PCR rDNA sequence that from the subtilis genome, increases
5’CC
GGTACCgacgaacgctggcggcgtgc3’
Primer 2.
5’CC
TTCGAAgcaccttccgatacggctacct3’
[explain: 8 bases of primer 5 ' end are that enzyme is cut protection base (2 bases) and DNA restriction enzyme enzyme recognition site (6 bases that underscore is arranged)].
Extract subtilis genomic dna (genome DNA extracting method is with the genome DNA extracting method of above-described huge subtilis); Is that template applications primer 1 carries out pcr amplification with primer 2 with the genomic dna, the PCR product of acquisition proves the rDNA sequence in the subtilis genome through sequential analysis and the BLAST software analysis that provides with NCBI.
6. the expression cassette framework is built process:
A. the structure that contains isoamylase expression of gene framework:
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of bacillus megaterium is reconstituted in the MCS of pBG carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBG carrier, and is located at the downstream of promoter sequence; The isoamylase gene order of false pseudomonas bacillus is reconstituted in the MCS of pBG carrier, and is located at the downstream of signal peptide sequence; The Transcription Termination subsequence is reconstituted in the MCS of pBG carrier, and is located at the gene order downstream.This carrier that contains the isoamylase gene expression construct is called pBG1.
B. contain glucose amylase gene and express the structure of framework
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of bacillus megaterium is reconstituted in the MCS of pBG carrier; The aspergillar glucose amylase gene sequence that will comprise signal peptide is reconstituted in the MCS of pBG carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pBG carrier, and is located at the gene order downstream.This carrier that contains glucose amylase gene expression framework is called pBG2.
C. the structure of expression framework that contains the xylose isomerase gene of the hot bacterium that dwells
Through the effect of DNA restriction enzyme and T4 dna ligase, the glyceraldehyde 3-phosphate dehydrogenase promoter DNA sequence of bacillus megaterium is reconstituted in the MCS of pBG carrier; The alpha factor signal peptide dna sequence dna is reconstituted in the MCS of pBG carrier, and is located at the downstream of promoter sequence; The xylose isomerase gene sequence of the hot bacterium that dwells is reconstituted in the MCS of pBG carrier, and is located at the downstream of promotor; The Transcription Termination subsequence is reconstituted in the MCS of pBG carrier, and is located at the downstream of signal peptide sequence.The carrier that this xylose isomerase gene that contains the hot bacterium that dwells is expressed framework is called pBG3.
7. accomplish the structure of expression vector
A. will express framework and be assembled in same cloning vector.
Through the effect of DNA restriction enzyme and T4 dna ligase, cut the expression framework of pBG2 and pBG3 carrier respectively, and this above two cover is expressed the MCS that framework is inserted in pBG1 successively.This carrier is called pBG123.
B. the effect through DNA restriction enzyme and T4 dna ligase successively with the rDNA sequence (DNA recombination sequence) of subtilis and G418 recombination in the MCS of pBG123 carrier.Constitute and contain the subtilis expression vector (accompanying drawing 3) that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework.
Contain the subtilis engineering bacteria that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework 3.2 make up
The electricity consumption method for transformation will contain the subtilis expression vector conversion subtilis that isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene are expressed framework; To pass through the subtilis of electric transformation and coat the G418-LB [(configuration of per 100 milliliters of LB solid mediums: 1% Tryptones; 0.5% yeast extract, 1% sodium-chlor, 1.5% agar powder; Add water to 100 milliliters, autoclaving); In dissolved LB solid medium (temperature 45-50 ℃), adding final concentration is the G418 of 700 μ g/ml, pours in the flat board behind the mixing] flat board, grow bacterium colony (recon) 37 ℃ of cultivations after 2 days.Verify recon with PCR method amplification target gene: using the special primer of above-described isoamylase gene, glucose amylase gene and xylose isomerase gene respectively, is template with the recon genomic dna, carries out pcr amplification; Recon can amplify the pcr amplification band of target sizes, and its PCR product is carried out the genome that its isoamylase gene of sequencing proof, glucose amylase gene and xylose isomerase gene have been reconstituted in recon.With grow in the G418 resistant panel and through the recon that carries out PCR checking with gene specific primer respectively at solid-state fermentation culture medium (straw powder 150 grams, Semen Maydis powder 250 grams, glucose 50 grams, Tryptones 20 grams, NH
4NO
315 grams, KH
2PO
410 grams, H
2O 500 grams) cultivated 2 days for 37 ℃; Measure isoamylase activity, glucose-amylase activity and the xylose isomerase enzymic activity of fermented liquid with ordinary method; According to enzyme assay, the recon of the above-described three kinds of enzymes of screening high expression level is expressed the subtilis engineering bacteria of framework as containing isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene.Mix isoamylase, glucoamylase and xylose isomerase 3.3 produce reorganization
The subtilis engineering bacteria that will contain isoamylase gene expression construct, glucose amylase gene expression framework and xylose isomerase gene expression framework is inoculated in solid-state fermentation culture medium, and (straw powder 150 grams, Semen Maydis powder 250 grams, glucose 50 grams, Tryptones 20 restrain, NH
4NO
315 grams, KH
2PO
410 grams, H
2O 500 grams) cultivated the centrifuging and taking supernatant 2 days for 37 ℃.With isoamylase, glucoamylase and the xylose isomerase in the conventional His label affinity purification method purified fermentation broth.Reorganization mixing isoamylase, glucoamylase and xylose isomerase that purifying is obtained are applied to the test of hydrolysis tapioca(flour) generation high fructose syrup, obtain high fructose syrup, prove that above mixed enzyme of producing has the function of hydrolyzed starch production high fructose syrup.
Explanation. prepare the basic skills of the method for high fructose syrup, but the enzyme of usefulness is to express reorganization mixing isoamylase, glucoamylase and the xylose isomerase that the subtilis engineering bacteria of framework is produced with above-described isoamylase gene expression construct, glucose amylase gene expression framework and the xylose isomerase gene of containing according to the enzymatic hydrolysis starch production high fructose syrup of routine.
Claims (2)
1. produce the method that hydrolyzed starch generates the enzyme system of high fructose syrup for one kind, it is characterized in that its concrete steps are following:
1), the xylose isomerase gene of isoamylase gene, aspergillar glucose amylase gene and the hot bacterium that dwells of the false pseudomonas bacillus of applied molecular biology technology clone;
2), make up yeast expression vector, yeast saccharomyces cerevisiae expression vector and the subtilis expression vector of the expression framework that contains said gene respectively;
3), the yeast expression vector with above-mentioned structure transforms pichia spp acquisition pichia spp recon; The yeast saccharomyces cerevisiae expression vector transformed saccharomyces cerevisiae of above-mentioned structure is obtained the yeast saccharomyces cerevisiae recon, with the subtilis expression vector conversion subtilis acquisition subtilis recon of above-mentioned structure;
4), the pichia spp recon of the above-described isoamylase of screening high expression level, glucoamylase and xylose isomerase is expressed the Pichia yeast engineering of the xylose isomerase gene expression framework of the framework and the hot bacterium that dwells as the isoamylase gene expression construct that contains false pseudomonas bacillus, aspergillar glucose amylase gene; The xylose isomerase gene that the yeast saccharomyces cerevisiae recon of the above-described isoamylase of screening high expression level, glucoamylase and xylose isomerase is expressed the framework and the hot bacterium that dwells as the isoamylase gene expression construct that contains false pseudomonas bacillus, aspergillar glucose amylase gene is expressed the yeast saccharomyces cerevisiae engineering of framework, and the xylose isomerase gene that the subtilis recon of the above-described isoamylase of screening high expression level, glucoamylase and xylose isomerase is expressed the framework and the hot bacterium that dwells as the isoamylase gene expression construct that contains false pseudomonas bacillus, aspergillar glucose amylase gene is expressed the subtilis engineering of framework;
5), ferment respectively above-described Pichia yeast engineering, saccharomyces cerevisiae engineered yeast and subtilis engineering bacteria produced the enzyme system (isoamylase, glucoamylase and xylose isomerase) that hydrolyzed starch generates high fructose syrup.
2. according to the said a kind of method that hydrolyzed starch generates the enzyme system of high fructose syrup of producing of claim 1, it is characterized in that: the method for utilizing the described production hydrolyzed starch of claim 1 to generate the enzyme system of high fructose syrup prepares enzyme system (isoamylase, glucoamylase and xylose isomerase) product that hydrolyzed starch generates high fructose syrup.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102518374A CN102747062A (en) | 2012-07-09 | 2012-07-09 | Method for producing enzyme system of starch hydrolyzing-generated high fructose corn syrup |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102518374A CN102747062A (en) | 2012-07-09 | 2012-07-09 | Method for producing enzyme system of starch hydrolyzing-generated high fructose corn syrup |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102747062A true CN102747062A (en) | 2012-10-24 |
Family
ID=47027554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102518374A Pending CN102747062A (en) | 2012-07-09 | 2012-07-09 | Method for producing enzyme system of starch hydrolyzing-generated high fructose corn syrup |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102747062A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9951326B2 (en) | 2015-07-13 | 2018-04-24 | MARA Renewables Corporation | Enhancing microbial metabolism of C5 organic carbon |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698840A (en) * | 2009-10-25 | 2010-04-28 | 中国热带农业科学院热带生物技术研究所 | Method for expressing xylose isomerase by applying pGAP regulation of Pichia pastoris |
| CN101717795A (en) * | 2009-11-30 | 2010-06-02 | 中国热带农业科学院热带生物技术研究所 | Method for producing ethanol by applying starch |
| CN102286443A (en) * | 2011-07-16 | 2011-12-21 | 中国热带农业科学院热带生物技术研究所 | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase |
-
2012
- 2012-07-09 CN CN2012102518374A patent/CN102747062A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698840A (en) * | 2009-10-25 | 2010-04-28 | 中国热带农业科学院热带生物技术研究所 | Method for expressing xylose isomerase by applying pGAP regulation of Pichia pastoris |
| CN101717795A (en) * | 2009-11-30 | 2010-06-02 | 中国热带农业科学院热带生物技术研究所 | Method for producing ethanol by applying starch |
| CN102286443A (en) * | 2011-07-16 | 2011-12-21 | 中国热带农业科学院热带生物技术研究所 | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase |
Non-Patent Citations (2)
| Title |
|---|
| 易国辉等: "用P. pastoris的pAOX1表达系统表达木糖异构酶", 《生物技术》 * |
| 陈騊声 等: "《微生物工程》", 31 December 1987 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9951326B2 (en) | 2015-07-13 | 2018-04-24 | MARA Renewables Corporation | Enhancing microbial metabolism of C5 organic carbon |
| US10662418B2 (en) | 2015-07-13 | 2020-05-26 | MARA Renewables Corporation | Enhancing microbial metabolism of C5 organic carbon |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Molecular characterization and expression of microbial inulinase genes | |
| CN102286443B (en) | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase | |
| Jones et al. | Ethanolic fermentation of blackstrap molasses and sugarcane juice using very high gravity technology | |
| CN101608192B (en) | Method for producing succinic acid employing corn cob | |
| CN102373230A (en) | Nucleotide sequence of Clostridium D-tagatose 3-epimerase and application thereof | |
| CN108603186B (en) | Yeast strain co-expressing exogenous saccharifying enzyme, method for obtaining yeast strain and application of yeast strain in production of bioethanol | |
| CN103321074A (en) | Method for degrading plant lignin by using Bacillus subtilis engineering bacterial | |
| CN114561303B (en) | Trichoderma reesei engineering strain secreting high-performance cellulase and application thereof | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN103952326B (en) | The recombinant pichia yeast strain of a kind of coexpression alantin excision enzyme and restriction endonuclease and construction method and application | |
| Onsoy et al. | Ethanol production from Jerusalem artichoke by Zymomonas mobilis in batch fermentation | |
| CN101386868A (en) | Method for improving expression level of recombinant protein in kluyveromyces | |
| CN105177084B (en) | A kind of method of inulin enzyme mutant fermenting and producing oligofructose | |
| CN101323838B (en) | Recombinant distiller's yeast and use thereof in eutrit production | |
| CN103695323B (en) | Stable and high-yield strain for alpha-transglucosidase | |
| CN105062908A (en) | Candida tropicalis gene engineering bacteria for high yield of xylitol and application of xylitol | |
| CN102367448A (en) | Construction method of genetic engineering strain for high expression and easy purification of beta-mannanase | |
| CN102747063A (en) | Xylose isomerase producing method | |
| CN104789586A (en) | Escherichia coli genome integration vector, genetically engineered bacterium and application of genetically engineered bacterium to xylitol production | |
| CN101880643B (en) | Gluconobacter oxydans gene engineering bacterium and construction method thereof | |
| CN105985969B (en) | Gene engineering yeast and its preparation method and application with saccharification function | |
| CN103695383B (en) | Aspergillus niger strain for efficiently expressing alpha-transglucosidase | |
| CN102747062A (en) | Method for producing enzyme system of starch hydrolyzing-generated high fructose corn syrup | |
| CN104073449B (en) | One strain is suitable for bakery yeast and the selection thereof of plain doughs fermentation | |
| CN102936576B (en) | A kind of Xylitol genetic engineering bacterium and mixing thereof transform the method for producing Xylitol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121024 |