CN102533564B - A kind of screening method of bio-control trichoderma in corn seedling stage root rot period - Google Patents
A kind of screening method of bio-control trichoderma in corn seedling stage root rot period Download PDFInfo
- Publication number
- CN102533564B CN102533564B CN201110371101.6A CN201110371101A CN102533564B CN 102533564 B CN102533564 B CN 102533564B CN 201110371101 A CN201110371101 A CN 201110371101A CN 102533564 B CN102533564 B CN 102533564B
- Authority
- CN
- China
- Prior art keywords
- trichoderma
- root rot
- seedling stage
- bio
- maize
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to biological field, particularly disclose a kind of screening method of bio-control trichoderma in corn seedling stage root rot period.The screening method of this bio-control trichoderma in corn seedling stage root rot period, is characterized in that: comprise the steps: (1) soil sample collection; (2) preparation of the soil solution; (3) separation and purification of Trichoderma; (4) screening of Trichoderma.The beneficial effect of the screening method of bio-control trichoderma in corn seedling stage root rot period of the present invention is: method is simple and easy to operate, and cost is lower; It is long for storage period that the Trichoderma filtered out prepares trichoderma, and can effectively store more than 1 year, protection effect is good, seedling rate improves about 45%, and survival rate is higher by 50% than contrast, and seedling protecting effect is good, disease-sensitive index reduces by 60%, to people and animals and ecotope harmless, noresidue, does not develop immunity to drugs, raw material sources are wide, production cost, lower than chemical pesticide derosal etc., can also be turned waste into wealth, have good economic benefit and social benefit.
Description
(1) technical field
The present invention relates to biological field, particularly a kind of screening method of bio-control trichoderma in corn seedling stage root rot period.
(2) background technology
Maize at Seedling Stage root rot is a kind of wide, that harm is serious, Species of Pathogens is various and control is more difficult worldwide disease that distributes.This disease is caused by multiple pathogenic bacteria Combined Infection, the root of main harm corn and basal part of stem, causes be injured position browning of root system and basal part of stem downright bad, and affect the absorption of crop to moisture and nutrient, tawny moire shape spot appears in overground part blade edge.The Symptoms of Maize at Seedling Stage root rot is: in the corn 3-6 leaf phase, and overground part growth is suppressed, and plant type is short and small, and yellow symptom appears in lower blade from leaf margin, and then blade or whole strain turn yellow, or occurs brown macules; Radicle and fibrous root there is brown scab, or rots, or contracting of hanging.The lighter can recover gradually, but growth tendency obviously weakens, and affects output, and severe one is dead, causes the disconnected ridge that is short of seedling.
External report causes the pathogenic bacteria of fusarium root rot of maize to have: P.graminicola Subram, Fusarium graminearum, compacted spore bacterium, fusarium moniliforme, Fusarium oxysporum, dry thread Pyrenomycetes etc., the main pathogenic fungi is pythium spp and sickle-like bacteria.The pathogenic bacteria of domestic report has: fusarium moniliforme, the mutation of fusarium moniliforme glue spore, Fusarium graminearum, compacted spore bacterium, pythium spp, rhizoctonia etc.The sociales in Jilin Province are that sickle-like bacteria accounts for 66-80%, and rhizoctonia accounts for 5%-10%; Zhejiang Province's fusarium moniliforme accounts for 49%-79.7%, and the cross frequence of pythium spp is also higher; Hebei province is based on sickle-like bacteria, and dry thread Pyrenomycetes is auxiliary.In general, the main pathogenic fungi of fusarium root rot of maize is fusarium moniliforme and Fusarium graminearum, and different areas pathogenic bacteria composition is slightly difference because of the difference of ecotope.
The primary source of infection of Maize at Seedling Stage root rot is the pathogenic bacteria in seed and soil, invades plant underground part under appropriate conditions, causes morbidity.The mainly chemical agent seed dressing of traditional prevention and controls.But there is more shortcoming in this prevention and controls: one is that chemical agent can only kill seed and pathogenic bacteria around, and helpless to pathogenic bacteria slightly far away, and while killing pathogenic bacteria, also by beneficial microorganism without selectively killing; Two is chemical control, and dose is large, and toxicity is large, and pollute heavy, life-time service can cause pathogenic bacteria to develop immunity to drugs, and makes chemical agent lose original preventive and therapeutic effect.
Trichoderma, as a kind of biocontrol microorganisms, can prevent and treat the Major Diseases of a lot of cash crop, to occurring in root and leaf diseases has good prevention effect, also has research in recent years to shelf time disease.The control of Trichoderma to some soil-borne plant pathogens has good effect, and these pathogenic bacterias comprise: Rhizoctonia (
rhizoctonia), sclerotium (
sclerotium), Fusarium (
fusarium), pythium (
pythium), phytophthora (
phytophthora) etc., and the different offspring individuals of the even same bacterial strain of different strains not of the same race, of the same race of Trichoderma all also exist the difference on the difference of Antagonism and antagonism object type.As ubiquity there is the antagonistic microbe of affluent resources, in the biological control of soil-borne disease, there is consequence.The mechanism of action of Trichoderma almost includes all mechanisms, and is paid close attention to therefore and widely, is also its of many uses, remarkably productive major reason.It is reported, Trichoderma has following several mechanism of action at least: Competition, antibiosis, bacteriolysis, parasitization, induction of resistance, joint action of antagonism.
Since Weindling in 1932 finds that Trichoderma has antagonistic action to plant pathogenic fungi, over more than 70 year, many trials and deep research have been done in external expert, the exploitation of scholar to Trichoderma biological agent.The Trichoderma preparation YC458 that the Topshield (trichoderma harziarum T22) of the U.S., the Trichodex (trichoderma harziarum T39) of Israel, Zelanian Trichoderma preparation Trichodry and Trichoflow, the Trichoderma preparation (Myco1) of Russian doctor Kolombet development, Korea S professor Chung research and develop, Spain professor Monte adopt the biological prevention and control agent TUSAL of trichoderma harziarum and viride mixed developing, and these preparations all obtain good prevention effect and obvious production-increasing function in control of plant disease.In recent years, domestic scientific research personnel also comes in the diversion of biological control to Antagonistic Trichoderma, and makes it progressively be applied in field.The Trichoderma preparation control Radix Panacis Quinquefolii damping-off such as fourth Bandung, Li Liang has been trichoderma harziarum T.harzianum and has prevented and treated jasmine southern blight, and Xing Yunzhang etc. prevent and treat ginseng maize ear rot with viride T.viride and achieve certain effect.But existing Trichoderma protection effect in control of maize root rot in seedling stage is not good, and survival rate of seedlings is lower, and effect is undesirable.
(3) summary of the invention
The present invention, in order to make up the deficiencies in the prior art, provides the screening method of a kind of low cost, bio-control trichoderma in corn seedling stage root rot period simple and easy to operate.
The present invention is achieved through the following technical solutions:
A screening method for bio-control trichoderma in corn seedling stage root rot period, is characterized in that: comprise the steps:
(1) soil sample collection:
Choose corn planting field, the sampling of 5, each plot, every sampling spot along corn rhizosphere never co-located sample 3 times, fetch earth degree of depth 0-20cm, same field 5 sampling after mixed loading aseptic plastic bag;
(2) preparation of the soil solution:
The soil sample collected is broken into pieces, air-dry after sieve, the soil sample 10g getting fully mixing, in volumetric flask, adds sterilized water and is settled to 100mL, and vibration 30min, gets 10mL Soil Slurry and add in 90mL sterilized water, be diluted to 10 successively
-6doubly, after fully shaking up for separating of;
(3) separation and purification of Trichoderma:
Vibrate the Soil Slurry after dilution 10-20s on the oscillator, draw 1mL Soil Slurry to LB agar plate central authorities, smoothen with spreading rod, and carry out concentration markers, the LB agar plate coated leaves standstill 5min, Soil Slurry is made to penetrate in LB agar plate, the LB agar plate coated is inverted in 28 DEG C of thermostat containers and cultivates, every concentration repeats 3 times, after LB agar plate grows bacterium colony, purifying repeatedly on picking colony edge children tender mycelia to PDA flat board, transplants mycelium freezen protective on PDA inclined-plane from the bacterium colony of the single dispersion formed;
(4) screening of Trichoderma:
After the trichoderma strain PDA substratum of separation is sieved again and get final product.
PDA substratum sieves again and belongs to prior art, no longer describes in detail.
The beneficial effect of the screening method of bio-control trichoderma in corn seedling stage root rot period of the present invention is: method is simple and easy to operate, and cost is lower; It is long for storage period that the Trichoderma filtered out prepares trichoderma, and can effectively store more than 1 year, protection effect is good, seedling rate improves about 45%, and survival rate is higher by 50% than contrast, and seedling protecting effect is good, disease-sensitive index reduces by 60%, to people and animals and ecotope harmless, noresidue, does not develop immunity to drugs, raw material sources are wide, production cost, lower than chemical pesticide derosal etc., can also be turned waste into wealth, have good economic benefit and social benefit.
(4) accompanying drawing explanation
Below in conjunction with accompanying drawing, the present invention is further illustrated.
Accompanying drawing 1 is the effect diagram of different carriers to Trichoderma sporulation quantity.
(5) embodiment
(A) isolation identification of Maize at Seedling Stage Pathogens Causing Root Rot Disease:
(I) method:
1. pathogenicbacteria separation:
Maize at Seedling Stage Pathogens Causing Root Rot Disease is separated: rinsed well by maize seedling root clear water, and the strong intersection of clip root disease organizes about 0.5cm, after carrying out tissue surface sterilization, is placed on PDA and CMA substratum respectively, 28 DEG C of cultivations by ordinary method.After 5 days, preliminary evaluation is carried out to isolate.If Fusariumsp (
fusariumspp.) then forward on F8 liquid nutrient medium, produce after macroconidium until it, picking monospore is further purified, for strain identification and test.
PDA substratum: peeling potatoes 200g, shred the 1000mL that adds water, boil 20min, filtered through gauze, filtrate complements to 1000mL, adds glucose 20g, agar 15g, is heated to fusing;
CMA substratum: get 60g corn grain and put into water and boil 1h, filter, get liquid and add 20g agar, 20g glucose, adds water to 1000mL, pH=7.0, packing, sterilizing;
F8 liquid nutrient medium: KH
2pO
42g; KNO
32g; KCl1g; MgSO
41g; FeSO
4, FeCl
3, MnSO
4, ZnSO
4each 0.0002g; Sug1g; Water 1000mL; PH=5.0, packing, sterilizing.
2. pathogen identification:
By isolate according to Wei Jingchao (Fungal identification handbook " and Maleolme.shurtleff. " eompendiumofcorndisease " (1980) described by asexual organ morphology feature and cultivate shape identify.
(II) results and analysis:
Maize at Seedling Stage Pathogens Causing Root Rot Disease kind:
Be separated from Maize at Seedling Stage root rot diseased plant the pathogenic bacteria obtained and have Fusarium moniliforme, Fusarium graminearum, Fusarium oxysporum, pythium spp, dry thread Pyrenomycetes etc., wherein the cross frequence of Fusarium moniliforme is the highest, is respectively 43.66%; The cross frequence of Fusarium graminearum is 13.57%; The cross frequence of other pathogenic bacteria all below 5% (table 1).Result illustrates, causes the main pathogenic fungi of Maize at Seedling Stage root rot to be Fusarium moniliforme and Fusarium graminearum.
Table 1 Maize at Seedling Stage Pathogens Causing Root Rot Disease cross frequence
(B) screening method of bio-control trichoderma in corn seedling stage root rot period:
(I) method:
1. soil sample collection:
Random selecting corn planting field, the sampling of 5, each plot, every sampling spot along corn rhizosphere never co-located sample 3 times, the degree of depth that fetches earth 0 ~ 20cm, loading aseptic plastic bag is mixed after same field 5 sampling, indicate numbering, place, acquisition time, take back laboratory for separation, gather 36 parts of soil samples altogether;
2. the preparation of the soil solution:
The soil sample collected is broken into pieces, air-dry after sieve, the soil sample 10g getting fully mixing, in volumetric flask, adds sterilized water and is settled to 100mL, vibration 30min.Get 10mL Soil Slurry to add in 90mL sterilized water, be diluted to 10 successively
-6doubly, after fully shaking up for separating of;
3. the separation and purification of Trichoderma:
Vibrate the Soil Slurry after dilution 10 ~ 20s on the oscillator, draw 1mL Soil Slurry to LB agar plate central authorities, smoothen with spreading rod, and carry out concentration markers, the LB agar plate coated leaves standstill 5min, make Soil Slurry penetrate in LB agar plate, be inverted in 28 DEG C of thermostat containers by the LB agar plate coated and cultivate, every concentration repeats 3 times.After LB agar plate grows bacterium colony, purifying repeatedly on picking colony edge children tender mycelia to PDA flat board.Mycelium freezen protective on PDA inclined-plane is transplanted stand-by from the bacterium colony of the single dispersion formed;
4. the screening of Trichoderma:
From the 36 parts of soil samples gathered, isolate 92 strain trichoderma strains.Obtain good 10 trichoderma strains of antagonistic effect after sieving again with PDA substratum, be numbered: T-A2, T-B5, T-B8, T-B11, T-C7, T-C10, T-D3, T-E4, T-E8, T-F3;
5. opposite culture:
The Trichoderma and Fusarium moniliforme of PDA flat board being cultivated about 5d are broken into punch tool the bacterium cake that size is 6mm respectively, be inoculated on PDA flat board respectively, 2 bacterium cakes are at a distance of 5cm, 7d is cultivated in 28 DEG C, day by day observe and record Trichoderma and Fusarium moniliforme colony growth distance and antagonism situation, calculate inhibiting rate.
In inhibiting rate/%=[(dCK-dB)/dCK] × 100 formulas, dCK represents contrast pathogenic bacteria colony diameter, and dB represents process pathogenic bacteria colony diameter.
Preventive effect=(contrast disease index-process disease index)/contrast disease index × 100%
During opposite culture 72h, the film-making of picking two bacterium colony interface mycelia, with microscopic examination Trichoderma and pathogenic bacteria common factor place mycelial growth situation and tracing observation.Again only to inoculate Fusarium moniliforme for contrast, the pure culture simultaneously doing Trichoderma and Fusarium moniliforme is tested and records the bacterium colony full ware time, often processes and repeats for 3 times.
The inhibiting rate of opposite culture:
As seen from Table 2, the good trichoderma strain of 10 strain antagonistic effect all has restraining effect in various degree to Fusarium moniliforme, and inhibiting rate is greater than 70% 5 strains.Wherein, the inhibiting rate of T-C7 higher than 85%, its initial growth speed be all obviously better than for examination pathogenic bacteria, after opposite culture 36h, two bacterium colony mycelia contact with each other, after can see that the Fusarium moniliforme speed of growth reduces rapidly.Due to the antagonism of Trichoderma, Fusarium moniliforme colony radius increases slowly.Can see under microscope that mycelia is wound around mutually folding, the spore of Trichoderma grows on pathogenic bacteria bacterium colony.
Table 2 Trichoderma is to the antagonistic effect of pathogenic bacteria
(II) results and analysis:
1. potted plant controlling experiment:
Fusarium moniliforme is connected on PDA substratum, is placed in 28 DEG C of constant incubators and cultivates, with under sterilizing washing after its generation spore, be made into 10
4the spore suspension of individual/mL.Selecting uniform corn seed, is wash 3 times with sterilized water after the alcohol disinfecting 5min of 70% by volumetric concentration, then with massfraction be 0.1% mercuric chloride solution sterilizing 5min after wash 5 times with sterilized water.The heavy 5kg of every basin soil, sows 6.Choose the strain of growth uniform seedling 3 after sprouting, be divided into following 3 process (each process repeats for 3 times): process 1:10
7the mixed solution of the above-mentioned spore suspension of Trichoderma T-C7 bacterium liquid 50mL and 50mL of individual/mL processes; The mixed solution of the above-mentioned spore suspension of 58% metalaxyl-mn-zn WP liquid 50mL and 50mL of process 2:1mg/mL processes; The mixed solution of process 3:50mL clear water and the above-mentioned spore suspension of 50mL processes.Water seedling (every basin 100mL) respectively with three kinds of mixed solutions of above-mentioned three kinds for the treatment of processs, 30d " Invest, Then Investigate " respectively processes the incidence of corn, calculates disease index and preventive effect.Fusarium root rot of maize grade scale: 0=root system perfects, without scab; 1=root system there is fragmentary scab, but not in flakes; 2=root disease spot in flakes, but is less than the l/4 of root girth; 3=root disease spot is greater than 1/4 of root girth, but is less than l/2; 4=root disease spot is greater than 1/2 of girth, but is less than 3/4; The whole root of 5=all has scab to surround, butt rot.
2. the prevention effect of potted plant controlling experiment:
Potted plant controlling experiment result (table 3) shows, by Trichoderma T-C7 control of maize root rot in seedling stage, preventive effect is 45.19%, and by 58% metalaxyl-mn-zn WP liquid control of maize root rot in seedling stage, preventive effect is 35.87%, lower than trichoderma strain T-C7.Observe the maize seedling growing state of each process, the growing way through the maize seedling of Trichoderma T-C7 process is better than metalaxyl-mn-zn process, shows, the growth of Trichoderma T-C7 to maize seedling has certain promoter action.
The prevention effect of the potted plant controlling experiment of table 3
(C) qualification of bio-control trichoderma in corn seedling stage root rot period:
(I) materials and methods:
1. material:
(a) strains tested: trichoderma strain T-C7.
B () main agents: GoldView nucleic acid dye, is purchased from match Parkson, Beijing biotechnology company limited; Taq enzyme, DL2000PlusMarker and cloning vector pMD18-T, be purchased from Takara company; DNA reclaims test kit, is purchased from Beijing Bo Maide biotechnology company limited; Pcr amplification primer: ITS1:5 ' TCCGTAGGT-GAACCTGCGG3 ' and ITS4:5 ' TCCTCCGCTTATTGATATGC3 ', is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
2. method: strain identification:
(a) cultural colony and morphologic observation:
Trichoderma strain T-C7 to be identified is accessed PDA dull and stereotyped, 28 DEG C of cultivations, observe color and the form of bacterium colony every 24h.In basis of microscopic observation mycelia, conidiophore and conidial size and geometric after 72h.Method according to Rifai and Bissett carries out taxonomic identification.
(b) Molecular Identification:
Adopt cetyl trimethylammonium bromide method (i.e. CTAB method) to extract trichoderma strain T-C7 STb gene, carry out pcr amplification with universal primer ITS1 and ITS4.
25.00 μ l reaction systems:
2.50 μ l10 × Buffer, 2.00 μ l2.5mmol/LdNTPs, 2.00 μ l25mmol/LMgCl2,1.00 μ l10 μm ol/LITS1 primer, 1.00 μ l10 μm ol/LITS4 primer, 0.25 μ l5U/ μ lTaq enzyme, 2.00 μ lDNA templates, complement to 25.00 μ l with sterilizing distilled water.
Response procedures: 94 DEG C of sex change 5min; 94 DEG C of sex change 30s, 51 DEG C of annealing 30s, 72 DEG C extend 1min, 32 circulations; 72 DEG C extend 10min.Electrophoresis detection is carried out with 1% agarose containing nucleic acid dye, amplified production reclaims test kit through DNA and reclaims, the PCR primer of recovery is connected on cloning vector, recombinant plasmid transformed is in bacillus coli DH 5 alpha host cell, the LB agar plate screening containing Amp is used to contain the white colonies of recombinant plasmid, send Beijing Nuo Sai gene company limited to check order after being verified by bacterium colony PCR, in sequencing result and GenBank, the ITS sequence of known Trichoderma is compared.
(II) results and analysis: the qualification of Trichoderma T-C7:
1. cultural colony and morphological specificity:
On PDA flat board; colony growth is rapid; flocculence, light green is to deep green, and on conidiophore main shaft, elementary branch is often positioned at base portion; and it is how irregular; the secondary branch distributed architecture of sporophore main shaft is complicated, usually has 2-3 and returns branch, and bottle metulae portion shrinks not obvious; conidium ellipse or oval, smooth surface.The morphologic description mould to long shoot wood is very similar, is initially identified as long shoot wood mould.
2. ITS sequence amplification:
The genomic dna of Trichoderma T-C7 obtains single object band through pcr amplification.Learnt by sequential analysis, sequence length is the DNA fragmentation of 549bp.Mensuration sequence is carried out Blast comparison, in GenBank database, carries out homology search, the ITS sequence of bacterial strain T-C7 and accession number be the long shoot wood of HM192931.1, GQ203535.1, EU401572.1 and FJ858772.1 mould (
trichodermalongibrachiatum) the homology of ITS sequence reach 100%.According to the ITS sequence analytical results of bacterial strain T-C7 and cultural colony and morphological specificity, be accredited as long shoot wood mould (
trichodermalongibrachiatum).
1ccgagtttacaactcccaaaccccaatgtgaacgttaccaatctgttgcctcggcgggat
61tctcttgccccgggcgcgtcgcagccccggatcccatggcgcccgccggaggaccaactc
121caaactcttttttctctccgtcgcggctcccgtcgcggctctgttttatttttgctctga
181gcctttctcggcgaccctagcgggcgtctcgaaaatgaatcaaaactttcaacaacggat
241ctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcag
301aattcagtgaatcatcgaatctttgaacgcacattgcgcccgccagtattctggcgggca
361tgcctgtccgagcgtcatttcaaccctcgaacccctccggggggtcggcgttggggatcg
421gcccctcaccgggccgcccccgaaatacagtggcggtctcgccgcagcctctcctgcgca
481gtagtttgcacactcgcaccgggagcgcggcgcggccacagccgtaaaacaccccaaact
541tctgaaatg。
(D) zymotechnique of Trichoderma:
(I) materials and methods:
1. trichoderma strain: Trichoderma longibrachiatum strain;
2. nutritional condition:
(a) slant medium: Trichoderma longibrachiatum strain to be inoculated on PDA substratum 30 DEG C and to cultivate 5 days;
(b) liquid nutrient medium: composition is wheat bran 0.5-0.8g, ammonium sulfate 0.2-0.4g, potassium primary phosphate 0.1-0.3g, calcium carbonate 0.1-0.3g, glucose 1-2g, by above-mentioned substance sterilized water obtaining liq fermention medium 100mL, adjusted to ph is 5.5-6, autoclaving 30-40min, after cooling, access long shoot Trichoderma kind, stops after 26-30 DEG C of shaking culture 60h, for subsequent use;
The selection of (c) solid fermentation culture medium:
Microbial inoculum Research on processing technology is carried out for fermentation strain with Trichoderma T-C7, according to existing report, select bacterium chaff and corn stalk powder as trichoderma strain fermentation culture matrix, bacterium chaff utilizes the raw material such as stalk, wood chip to carry out edible mushrooms substituting stuff cultivation, substratum residuum after receiving, is commonly called as edible fungus culturing waste material, bacterium slag or clout; The residual body of hypha of edible fungus and through edible mushrooms enzymolysis, the mixture of the compositions such as the robust fibre of structure generation qualitative change.
The culture medium of different ratio and water content are on the impact of sporulation quantity:
Select bacterium chaff: the weight ratio of corn stalk powder=1:0.5,1:1,1:1.5,1:2,1:2.5,1:3,1:3.5,1:4,1:4.5,1:5, the two mixing total amount is 50g, water content is respectively 50%, 55%, 60%, 65%, 70%(W/W), load in 500mL triangular flask, repeat 3 times, sterilizing is for subsequent use.Spore suspension 5.0mL(1.0 × 10 of access trichoderma strain T-C7
7cfu/mL), gauze seals, and ensure good ventilation property, 26 DEG C of cultivations (illumination: dark=12:12), culture environment relative humidity is 90%.From 4d, stir once every 1d, be cultured to 10d, natural air drying.Then get in Partial fermentation product 60 DEG C of loft drier and dry 24h, measure spore amount.With 50g corn stalk powder for contrast.
Different vaccination amount is on the impact of fermentation time and sporulation quantity:
It is 50g that the mixture (the two weight ratio is 1:4) of bacterium chaff and corn stalk powder is mixed total amount, adding distil water 100mL, and load in 500mL triangular flask, sterilizing is for subsequent use.Access trichoderma strain T-C7 spore suspension 5.0mL respectively, spore suspension concentration is respectively 1.0 × 10
5cfu/mL, 1.0 × 10
6cfu/mL, 1.0 × 10
7cfu/mL, 1.0 × 10
8cfu/mL, 1.0 × 10
9cfu/mL, with 6 layers of gauze sealing, ensures good ventilation property, cultivates (illumination: dark=12:12) 5d, 7d, 10d and 12d respectively for 26 DEG C.Culture environment relative humidity is 90%.From 4d, stir once every 1d.After fermentation ends, get in Partial fermentation product 60 DEG C of loft drier and dry 24h, check spore amount.Each process repetition 4 times.
(II) results and analysis:
1. the culture medium of solid fermentation different ratio and water content are on the impact of sporulation quantity:
The culture medium of table 4 different ratio and water content are on the impact of sporulation quantity
Found out by table 4, after 26 DEG C of cultivations (illumination: dark=12:12) 10d, bacterium chaff: corn stalk powder weight ratio is in 1:0.5,1:1,1:1.5,1:2,1:2.5,1:3,1:3.5,1:4,1:4.5,1:5 ten proportionings, along with the increase of water content in culture medium, tunning spore amount is also in rising, wherein best with the water content tunning of 60%.After fermentation ends, 1:0.5 and 1:1 two air-dry fragmentations of proportioning tunning are more difficult, and fermentation costs increases.When water content arrives 70%, in fermenting process there is dew condensation phenomenon in subiculum surface, and unfavorable to product spore, sporulation quantity reduces.Also find in test, along with the increase of bacterium chaff ratio, sporulation quantity can increase successively, but fermenting process medium viscosity becomes large, and ventilation property reduces, and can increase the risk of bacterial contamination.1:3 proportioning has slight caking, and the tunning of 1:3.5,1:4 and 1:5 two proportionings is air-dry rear very loose, without the need to fragmentation.
Consider that whether ventilation property and the air-dry aftertreatment of tunning of fermentation costs, spore output, fermenting process be easy, select the ratio of bacterium chaff and corn stalk powder to be that the best is fermented proportioning with 1:4, optimum water content is 60%.
2. different vaccination amount is on the impact of the mould fermentation time of wood and sporulation quantity:
Table 5 different vaccination amount is on the impact of fermentation time and sporulation quantity
Found out by table 5 result, different vaccination amount has larger impact to fermentation time.The inoculum size (1 × 10 of minimum concentration
5cfu/mL) until the sporulation quantity of 12d just reaches the result identical with other inoculum size.Along with the increase of inoculum size, fermentation time reduction.7d, 1 × 10
7cfu/mL, 1 × 10
8cfu/mL, 1 × 10
9namely the fermented product spore output of cfu/mL tri-inoculum sizes reaches higher level, and every gram of fermented product is 1.37 × 10 containing spore amount
10-1.51 × 10
10individual, without significant difference.5d to 7d is these three inoculation volume production spore peak periods.Along with time lengthening, spore amount also has the trend increased, but increasing amount is lower.From test-results comprehensive evaluation, every 100g culture medium is selected to inoculate 10mL spore suspension (1 × 10
7cfu/mL), the 8d that ferments can arrive stable spore output.
(III) trichoderma strain T-C7 solid fermentation process:
Comprehensive result of study above, the fermentation condition of biocontrol trichoderma bacterial strain T-C7 employing solid fermentation method is: culture medium is bacterium chaff and corn stalk powder (weight ratio is 1:4), and water content is 60%(W/W), 120 DEG C of sterilizing 30min; Fermentation inoculum size is every 100g culture medium inoculation 10mL concentration is 1 × 10
7the spore suspension of cfu/mL; Leavening temperature 26 DEG C; Yeasting relative humidity more than 90%; Fermentation 8d can stop, and namely air-dry rear storage obtains the conidial solid culture medium of fully loaded Trichoderma.Every gram of solid culture medium spore amount can reach 1.37 × 10
10-1.51 × 10
10individual.
(E) preparation method of trichoderma:
(I) materials and methods:
1. strains tested: Trichoderma T-C7.
2. the screening of carrier:
Comprise kaolin, calcium carbonate, talcum powder, diatomite, silica gel, wilkinite or vermiculite for examination carrier, above carrier is commercially available.
A () carrier is on the impact of the Trichoderma speed of growth:
Add various in PDA substratum and make flat board for examination carrier with the ratio of 5 ﹪, the Trichoderma cake (d=5mm) of 4d is cultivated in access, cultivates 4d at 25 DEG C, measures colony diameter size and also calculates colony diameter daily growth amount.
Colony diameter daily growth amount (cm/d)=(colony diameter-0.5cm)/4
B () carrier is on the impact of Trichoderma sporulation quantity:
Beat at the Trichoderma colony edge punch tool (d=5mm) of above-mentioned cultivation 4d and get 1 ferfas cake and be placed in 10ml sterilized water containing two tween-80s, fully shake up, spore is all come off, with blood counting chamber counting and Units of Account area sporulation quantity.Sporulation quantity (individual/cm
2)=(average every lattice spore count × 4 × 10
6× extension rate)/0.19625.
3. the screening of uv-protector:
Humic acids, xanthan gum, xitix is comprised for examination uv-protector.
A () uv-protector is on the impact of the Trichoderma speed of growth:
Humic acids, xanthan gum, each 0.5g of xitix are joined in 100mLPDA substratum respectively; make culture medium flat plate; by in Trichoderma block access culture medium flat plate; each process repetition 4 times; not add the process of uv-protector in PDA flat board for contrast, UV-irradiation 30min, cultivates in 25 DEG C of dark culturing casees; 4d measures colony diameter size, and calculates colony diameter daily growth amount.
B () uv-protector is on the impact of Trichoderma sporulation quantity:
The Trichoderma colony edge punch tool (d=5mm) cultivating 4d in above-mentioned steps (a) is beaten and is got 1 ferfas cake and be placed in 10ml sterilized water containing two tween-80s, fully shakes up, spore is all come off, with blood counting chamber counting and Units of Account area sporulation quantity.Utilize SPSS data processing software (version 18.0) to process test-results, more different uv-protector affects with or without significance trichoderma strain growth.
4. the mensuration of vermiculite pH value:
Get 10g vermiculite and put into the Erlenmeyer flask with grinding port plug, add the distilled water 40mL of pH7.0, jam-pack bottle stopper acutely shakes 1min, then adding distil water 50mL, and shake 1min, gets supernatant liquid after leaving standstill, then measure pH value.
5. the preparation method of trichoderma:
Pulverized by vermiculite carrier, controlling its fineness is 40-60 order, and adjustment humidity is 8-12%, in carrier, add uv-protector, for subsequent use after allotment evenly; After the conidial solid culture medium Air drying of Trichoderma will be fully loaded with, Trichoderma conidial powder is ground into Universalpulverizer, Trichoderma conidial powder is dissolved in after mixing in the water of Trichoderma conidial powder weight 8 times, evenly be sprayed onto on the mixture of carrier and uv-protector, mixing, dry in air dry oven, make the relative humidity of microbial inoculum control at 10-15%, pack preservation and namely obtain trichoderma; Wherein the weight proportion of Trichoderma conidial powder, uv-protector, carrier is 10:1-5:85-90.
(II) results and analysis:
1. the screening of carrier:
Test-results (Fig. 1) shows; impact is had on be born long, sporulation quantity of Trichoderma for examination carrier; best to conidium vitality protection with vermiculite, even also have the effect promoting colony growth, the colony growth amount of other carriers and sporulation quantity have significant difference compared with the control.
2. the screening of uv-protector:
For humic acid in the uv-protector of examination, Trichoderma is born the long promoter action, little on sporulation quantity impact of having; Xanthan gum is born to grow to Trichoderma also has promoter action, but sporulation quantity reduces; Xitix has restraining effect, in table 6 to the colony growth of Trichoderma and sporulation quantity.
The different uv-protector of table 6 is on the impact of Trichoderma vigor
3. vermiculite pH value:
Drawn by replication, the pH value of vermiculite is 5-6, slant acidity, is applicable to Trichoderma growth.
Experiment shows, vermiculite process does not have the difference of significance with to impinging upon colony diameter daily growth amount and unit sporulation quantity, not obvious to the mould effect of vigor of wood, and humic acid to be born the long promoter action, little on sporulation quantity impact of having on Trichoderma.The above-mentioned determination to wood mould T-C7 bacterial strain tool good biological consistency uv-protector, for trichoderma bio-control agent formulating is laid a good foundation.
4. trichoderma storage experiment:
After trichoderma dress bag, put and store at normal temperatures, the 9th, 13 months time take out and measure its spore germination rate and be respectively: 100%, 94.6%; Carry out high/low temperature shelf test to microbial inoculum respectively, measure spore germination rate, store one week for 0 DEG C, spore germination rate reaches 99.60%, and store two weeks for 55 DEG C, spore germination rate reaches 90.2%, reaches the requirement of pesticide registration to storage period.
(F) trichoderma pharmacodynamic results:
(I) materials and methods:
1. microbial inoculum:
Trichoderma: the microbial inoculum of solid fermentation, as diseases prevention reagent, about contains spore amount 2 × 10
9g/g.
2. the selection of pathogenic bacteria:
Root inoculation method is dipped in utilization, to the mensuration of carrying out susceptible power, selects the bacterial strain that virulence is the strongest, and cultivate 7 days in culture dish, mycelia covers with culture dish, puts into tissue mincer and adds water 20 times and smash to pieces, for subsequent use.
3. biotechnological formulation is to naturally native potted plant fusarium root rot of maize efficiency test:
Every basin 5kg continuous cropping soil, fully mixes.5 corn seeds broadcast by every basin, 3 strains of keeping a full stand of seedings.Design three kinds of different treatment: 1, often spread manuer in holes into trichoderma 0.2g, simultaneously inoculation Fusarium moniliforme during maize planting; 2, clear water contrast: every cave does not apply microbial inoculum, does not inoculate Fusarium moniliforme during maize planting; 3, blank: every cave does not apply microbial inoculum, inoculates Fusarium moniliforme during maize planting.Often 3 repetitions are established in process.At seedlings investigation incidence, calculate mortality ratio, disease index and preventive effect.
4. field test:
Test is located at the experimental plot of the Boxing County that Maize at Seedling Stage root rot is retransmitted.Experimental plot soil property is consistent, and soil fertility is even, in soil fertility.This test take corn as research object, designs three kinds of different treatment: 1, often spread manuer in holes into trichoderma 0.2g, simultaneously inoculation Fusarium moniliforme during maize planting; 3, clear water contrast: every cave does not apply microbial inoculum, does not inoculate Fusarium moniliforme during maize planting; 2, blank: every cave does not apply microbial inoculum, inoculates Fusarium moniliforme during maize planting.Arrange Liang Ge district group to repeat for three times.Each district group comprises three communities, and each community is a process, its plot area 4 meters × 2.4 meters, and in district's group, three process adopt random alignment, and district's group area is 4 meters × 7 meters.
5. sample and investigate:
Seedling stage samples plant, investigates the incidence of each process corn, calculates mortality ratio, disease index and preventive effect.
6. add up:
Record data are carried out adding up and analyzes
Disease index=100 × ∑ (progression × this grade of strain number)/(highest number of falling ill × total strain number)
Preventive effect=(contrast disease index-process disease index)/contrast disease index × 100%
Dead decrement=(connect disease contrast mortality ratio-other process mortality ratio)/connect disease to contrast mortality ratio × 100%.
(II) results and analysis:
1. pot experiment trichoderma is to the prevention effect of potted plant fusarium root rot of maize:
Table 7 pot experiment trichoderma is to the prevention effect of potted plant fusarium root rot of maize
Pot experiment (table 7) confirms, clear water contrast disease index is 63.51%, and preventive effect is 11.09%.The corn of trichoderma process, its mortality ratio ratio connects disease contrast minimizing 71.66%, and disease index is 19.11%, and prevention effect is up to 73.24%.Visible Trichoderma prevention effect is apparently higher than clear water contrast and connect disease process.
2. field test trichoderma is to the prevention effect of Maize at Seedling Stage root rot:
Table 8 field test trichoderma is to the prevention effect of Maize at Seedling Stage root rot
Field test results (table 8) shows, by trichoderma control of maize root rot in seedling stage, its seedling rate significantly improves, and dead decrement is 72.13%, and seedling protecting effect is remarkable.Disease index is significantly reduce, and preventive effect is 74.24%, and prevention effect is remarkable.
Sum up:
(I) investigates Accessories during Binzhou Maize at Seedling Stage root rot incidence, the strong intersection tissue of Maize at Seedling Stage root rot disease is cultivated, be separated the pathogenic bacteria obtained and have Fusarium moniliforme, Fusarium graminearum, eggplant class Fusariumsp, bundle stalk Fusariumsp, Fusarium oxysporum, pythium spp, dry thread Pyrenomycetes etc., wherein the cross frequence of Fusarium moniliforme is the highest, is respectively 43.66%; The cross frequence of Fusarium graminearum is 13.57%; The cross frequence of other several pathogenic bacteria is all below 5%.Result shows, causes the main pathogenic fungi of Accessories during Binzhou Maize at Seedling Stage root rot to be Fusarium moniliforme and Fusarium graminearum.
(II) filters out the Trichoderma of antagonism Maize at Seedling Stage root rot and identifies.From the 36 parts of soil samples gathered, isolate 92 strain trichoderma strains.Obtain good 10 trichoderma strains of antagonistic effect after sieving again with PDA substratum, the good trichoderma strain of 10 strain antagonistic effect all has restraining effect in various degree to Fusarium moniliforme, and inhibiting rate is greater than 70% 5 strains.Wherein, the inhibiting rate of T-C7 higher than 85%, its initial growth speed be all obviously better than for examination pathogenic bacteria, after opposite culture 36h, two bacterium colony mycelia contact with each other, after can see that the Fusariumsp speed of growth reduces rapidly.
(III), according to cultural colony and morphological specificity, it is mould that T-C7 bacterial strain is initially identified as long shoot wood.Afterwards by rDNA-ITS sequential analysis, the ITS sequence of bacterial strain T-C7 and accession number be the long shoot wood of HM192931.1, GQ203535.1, EU401572.1 and FJ858772.1 mould (
trichodermalongibrachiatum) the homology of ITS sequence reach 100%, be then accredited as long shoot wood mould (
trichodermalongibrachiatum).
The fermentation condition of (IV) biocontrol trichoderma bacterial strain T-C7 employing solid fermentation method is: culture medium is bacterium chaff and corn stalk powder (weight ratio is 1:4), and water content is 60%(W/W), 120 DEG C of sterilizing 30min; Fermentation inoculum size is every 100g culture medium inoculation 10mL concentration is 1 × 10
7the spore suspension of cfu/mL; Leavening temperature 26 DEG C; Fermentation 8d can stop, air-dry rear storage.Every gram of solid culture medium spore amount can reach 1.37 × 10
10-1.51 × 10
10individual.
Prepared by (V) trichoderma: pulverized by vermiculite carrier, controlling its fineness is 40-60 order, and adjustment humidity is 8-12%, in carrier, add uv-protector, for subsequent use after allotment evenly; After the conidial solid culture medium Air drying of Trichoderma will be fully loaded with, Trichoderma conidial powder is ground into Universalpulverizer, Trichoderma conidial powder is dissolved in after mixing in the water of Trichoderma conidial powder weight 8 times, evenly be sprayed onto on the mixture of carrier and uv-protector, mixing, dry in air dry oven, make the relative humidity of microbial inoculum control at 10-15%, pack preservation and namely obtain trichoderma; Wherein the weight proportion of Trichoderma conidial powder, uv-protector, carrier is 10:1-5:85-90.
After (VI) trichoderma dress bag, put and store at normal temperatures, reach the requirement of pesticide registration to storage period.
(VII) field test results shows, by trichoderma control of maize root rot in seedling stage, its mortality ratio ratio connects disease contrast minimizing 75.43%, and disease index is 19.43%, and preventive effect is 74.24%.
The made trichoderma of the present invention to people and animals and ecotope harmless, noresidue, does not develop immunity to drugs, and production cost, lower than chemical pesticide derosal etc., can also be turned waste into wealth, have good economic benefit and social benefit.Specifically be compared as follows table:
Table 9 trichoderma and chemical pesticide characteristic Comprehensive Correlation table
The made trichoderma of the present invention has following advantage compared with other like product:
(1) with short production cycle, sporulation quantity is large, easy to use.In the solid fermentation stage, the sporulation quantity of trichoderma conidium is high, and every gram of solid culture medium is 1.37 × 10 containing spore amount
10-1.51 × 10
10individual; Perforated method is adopted to apply Trichoderma pulvis, simple and easy to do, reduce labour cost;
(2) raw material sources are wide, and cost is low, and product can consume a large amount of maize straw, not only avoiding the topsoil caused because burning maize straw, can also turn waste into wealth, there is good economic benefit and social benefit, that development is efficient, green, the biological pesticide that the ecological agriculture is desirable;
(3) operation of trichoderma conidium collection is easy, will be fully loaded with the conidial solid culture medium of Trichoderma after Air drying, and be ground into Trichoderma conidial powder, be beneficial to production with Universalpulverizer;
(4) storage period is long, is conducive to products in circulation.After trichoderma dress bag, put and store at normal temperatures, the 9th, 13 months time take out and measure its spore germination rate and be respectively: 100%, 94.6%.
This trichoderma can effective control of maize root rot in seedling stage, promotes root growth, and can improve survival rate of seedlings, and then increase corn yield, promote increasing peasant income.Within 2010, Binzhou maize sown area reaches 370.39 ten thousand mu, per mu yield 492.8 kilograms, along with the impact of the factor such as Global climate change in recent years, Maize at Seedling Stage root rot onset area has expansion trend, if improve 10% in survival rate, then every mu can be increased production about 50 kilograms, and whole Accessories during Binzhou can increase production 200,000 tons, in 1600 yuan per ton, then can increase income 300,000,000 2,000 ten thousand yuan.Wood enzyme microbial inoculum can increase biomass, has the effect of growth promoting effects, if promote, output increases by 1%, then can increase income 3,200 ten thousand yuan, and in actual production, increment rate is higher than 1%.A large amount of maize straw can be consumed when in addition prepared by trichoderma, not only avoid the topsoil caused because burning maize straw, can also turn waste into wealth, there is good economic benefit, being conducive to the development of Rural Circulation Economy.
The developing trend of current agricultural chemicals is efficient, that high security, mechanism of action are diversified and good Environmental compatibility.The operation of this product is conducive to Economic Development Mode Conversion, is conducive to agricultural chemicals upgrading of industries.This trichoderma, compared with traditional agricultural chemicals, has the characteristics such as target pest is single, consumption is few, toxicity is little, efficiency is high, easy decomposition, meets Agrochemicals trend.The widespread use of this microbial inoculum will reduce the usage quantity of chemical pesticide, reduces resistance and occurs, and reduces to pollute, is conducive to environment protection, to promoting that the improvement of ecotope has positive effect.
Claims (1)
1. a solid fermentation process of biocontrol trichoderma bacterial strain T-C7, its fermentation condition is: bacterium chaff and the corn stalk powder of culture medium to be weight ratio be 1:4, and water content is 60%(W/W), 120 DEG C of sterilizing 30min; Fermentation inoculum size is every 100g culture medium inoculation 10mL concentration is 1 × 10
7the trichoderma strain T-C7 spore suspension of cfu/mL; Leavening temperature 26 DEG C; Yeasting relative humidity more than 90%; Fermentation 8d, namely air-dry rear storage obtains the conidial solid culture medium of fully loaded Trichoderma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110371101.6A CN102533564B (en) | 2011-11-21 | 2011-11-21 | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110371101.6A CN102533564B (en) | 2011-11-21 | 2011-11-21 | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102533564A CN102533564A (en) | 2012-07-04 |
| CN102533564B true CN102533564B (en) | 2016-03-23 |
Family
ID=46341601
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110371101.6A Expired - Fee Related CN102533564B (en) | 2011-11-21 | 2011-11-21 | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533564B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104137845A (en) * | 2013-12-23 | 2014-11-12 | 北京首诚航天农业生物科技有限公司 | Preparation for preventing and treating trichoderma and application method of preparation |
| CN104328059A (en) * | 2014-10-14 | 2015-02-04 | 江苏科技大学 | Mulberry surface corrosion-causing antagonistic bacteria screening method |
| CN106399128A (en) * | 2016-11-21 | 2017-02-15 | 甘肃农业大学 | Method for rapidly separating trichoderma in plant rhizosphere saline-alkali soil |
| CN108102932B (en) * | 2018-01-09 | 2022-10-11 | 上海交通大学 | Antagonistic trichoderma in-vitro rapid screening method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1102056A (en) * | 1993-10-23 | 1995-05-03 | 玉环县三联生物化学厂 | Plant germicide |
-
2011
- 2011-11-21 CN CN201110371101.6A patent/CN102533564B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1102056A (en) * | 1993-10-23 | 1995-05-03 | 玉环县三联生物化学厂 | Plant germicide |
Non-Patent Citations (1)
| Title |
|---|
| 玉米苗期根腐病生防木霉菌的筛选;刘治刚;《贵州农业科学》;20101231;第38卷(第9期);114-115 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102533564A (en) | 2012-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103146586B (en) | Trichoderma harzianum strain for controlling plant fungus diseases and application thereof | |
| CN105296381B (en) | One bacillus subtilis CYY-25 and its application | |
| CN102382791A (en) | Fermentation process of trichoderma | |
| CN102086444B (en) | Paenibacillus elgii strain and application thereof | |
| CN102925386B (en) | Bacillus amyloliquefaciens and application thereof in prevention and treatment of walnut anthracnose | |
| CN106754484B (en) | One plant of rhizobium leguminosarum and its fermentation culture method and application | |
| CN106164247A (en) | Inoculation microbial inoculum for stress soil | |
| CN106591185A (en) | Application and preparation of bacillus amyloliquefaciens subsp. plantarum and bacterial agent thereof | |
| CN104263684B (en) | A kind of product siderophore series bacillus and application thereof | |
| CN101967455A (en) | Bacillus amyloliquefaciens EA19 for controlling wheat root diseases and preparation thereof | |
| CN111073825B (en) | Bacterium with plant soil-borne disease resistance effect and application thereof | |
| CN104286032B (en) | The preparation method of a kind of yellow basket bacterium spore powder, yellow basket bacterium wettable powder and preparation method thereof | |
| CN108277177B (en) | Streptomyces microflavus solid fermentation medium, preparation method and fermentation method thereof, fermentation product, biocontrol product and application | |
| CN105543132A (en) | Bacillus methylotrophicus YB-F7 and application thereof in preventing plant diseases | |
| CN104130958A (en) | Bacillus subtilis and application of bacillus subtilis in preventing and curing peony root-knot nematode | |
| CN105238723B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt | |
| CN101519644B (en) | Sinorhizobium sp. and application thereof | |
| CN102533564B (en) | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period | |
| CN110122485A (en) | A kind of trichoderma, Trichoderma and preparation method thereof | |
| CN105439657B (en) | A kind of preparation method of the special biologic organic fertilizer of resisting repeated stubbles of strawberry | |
| CN113234602B (en) | Chaetomium globosum, microbial inoculum, seed soaking liquid and application | |
| CN110200017A (en) | A kind of complex micro organism fungicide and preparation method thereof for preventing and treating root-knot nematode | |
| CN109182194A (en) | One plant of Yang Ling rhizobium for promoting coronule flower growth and its cultural method and application | |
| CN109182219A (en) | One plant of Mo Haiwei bacillus for promoting the growth of Henry David Thoreau grass and its application | |
| CN108841761B (en) | Method for promoting growth of clover and/or increasing yield of clover and microbial inoculum used by method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160323 Termination date: 20191121 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |