CN102533564A - Method for screening bio-control trichoderma in corn seedling stage root rot period - Google Patents
Method for screening bio-control trichoderma in corn seedling stage root rot period Download PDFInfo
- Publication number
- CN102533564A CN102533564A CN2011103711016A CN201110371101A CN102533564A CN 102533564 A CN102533564 A CN 102533564A CN 2011103711016 A CN2011103711016 A CN 2011103711016A CN 201110371101 A CN201110371101 A CN 201110371101A CN 102533564 A CN102533564 A CN 102533564A
- Authority
- CN
- China
- Prior art keywords
- trichoderma
- corn
- root rot
- soil
- seedling stage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to the biological filed and especially discloses a method for screening bio-control trichoderma in a corn seedling stage root rot period, which is characterized by including the following steps: (1) soil sample collecting; (2) preparing of soil solution; (3) separating and purifying of trichoderma; and (4) screening of trichoderma. The method for screening bio-control trichoderma in the corn seedling stage root rot period has the advantages that the method is simple, convenient and easy to operate and low in cost; and trichoderma agents prepared through the screened trichoderma are long in storage life which can reach more than one year and good in disease prevention effect, emergence rate is improved by about 45%, survival rate is 50% higher than comparison, seedling protection effect is good, disease infection index is reduced by 60%, the trichoderma agents have no harm on people and livestock and ecological environment, have no residues, do not generate drug resistance and are wide in raw material sources, production cost is lower than chemical pesticides like carbendazol, waste materials can be changed into things of value, and therefore the trichoderma agents have good economic benefit and social benefit.
Description
(1) technical field
The present invention relates to biological field, the screening method of particularly a kind of corn root rot in seedling stage biocontrol trichoderma bacterium.
(2) background technology
Corn root rot in seedling stage is a kind of worldwide disease serious, that the pathogenic bacteria kind is various and control is difficult that distributes extensively, endangers.This disease is to be caused by compound the infecting of multiple pathogenic bacteria, and the root of main harm corn and basal part of stem cause that be injured position browning of root system and basal part of stem is downright bad, influence crop to moisture and nutrient absorbing, and tawny moire shape spot appears in the overground part blade edge.The symptom of corn root rot in seedling stage shows as: in the corn 3-6 leaf phase, the overground part growth is suppressed, and plant type is short and small, and lower blade begins to occur the yellow symptom from leaf margin, and then blade or whole strain flavescence, or brown macules occurs; The brown scab is arranged on radicle and the fibrous root, or rot, or hang and contract.The lighter can recover gradually, but growth tendency obviously weakens, and influences output, and weight person is dead, causes the disconnected ridge that is short of seedling.
External report causes that the pathogenic bacteria of fusarium root rot of maize has: standing grain is given birth to pythium spp, Fusarium graminearum, wriggle spore bacterium, fusarium moniliforme, Fusarium oxysporum, dry thread Pyrenomycetes etc., and The main pathogenic fungi is pythium spp and sickle-like bacteria.The pathogenic bacteria of domestic report has: fusarium moniliforme, the mutation of fusarium moniliforme glue spore, Fusarium graminearum, wriggle spore bacterium, pythium spp, rhizoctonia etc.The sociales in Jilin Province are that sickle-like bacteria accounts for 66-80%, and rhizoctonia accounts for 5%-10%; Zhejiang Province's fusarium moniliforme accounts for 49%-79.7%, and the cross frequence of pythium spp is also higher; Hebei province is main with sickle-like bacteria, and dry thread Pyrenomycetes is auxilliary.In general, the The main pathogenic fungi of fusarium root rot of maize is fusarium moniliforme and Fusarium graminearum, and different areas pathogenic bacteria composition is slightly variant because of the difference of ecotope.
The primary source of infection of corn root rot in seedling stage is the pathogenic bacteria in seed and the soil, under suitable condition, invades the plant underground part, causes morbidity.Traditional method of preventing and treating mainly is the chemical agent seed dressing.But there is more shortcoming in this method of preventing and treating: the one, and chemical agent can only kill seed and pathogenic bacteria on every side, and powerless to pathogenic bacteria far away slightly, and in kill pathogenic bacteria, also useful microbe is not had and selectively kill; The 2nd, chemical control, dose is big, and toxicity is big, pollutes to weigh, and life-time service can cause pathogenic bacteria to develop immunity to drugs, and makes chemical agent lose original preventive and therapeutic effect.
Trichoderma can prevent and treat the main disease of a lot of cash crop as a kind of biocontrol microorganisms, to occurring in root and leaf diseases good control effect is arranged all, in recent years the shelf time disease is also had research.Trichoderma has good effect to the control of some soil-borne plant pathogens, and these pathogenic bacterias comprise: Rhizoctonia (
Rhizoctonia), sclerotium (
Sclerotium), Fusarium (
Fusarium), pythium (
Pythium), phytophthora (
Phytophthora) etc., and different offspring's individualities of different strains not of the same race, of the same race of Trichoderma even same bacterial strain all exist the difference of antagonism property and the difference on the antagonism object kind.As ubiquity and have the antagonistic microbe of affluent resources, in the biological control of soil-borne disease, has consequence.The mechanism of action of Trichoderma has comprised that almost institute might be machine-processed, and therefore receives concern widely, also is its of many uses, remarkably productive major reason.It is reported that Trichoderma has following several kinds of mechanism of action at least: competition effect, antibiosis, bacteriolysis, parasitization, induction of resistance, joint action of antagonism.
Since Weindling in 1932 finds that Trichoderma has antagonistic action to plant pathogenic fungi, external expert, scholar have done many trials and deep research to the exploitation of Trichoderma biological agent over more than 70 year.Wooden removing mildew YC458, Spain professor Monte of the wooden removing mildew (Myco1) of the Trichodex (trichoderma harziarum T39) of the Top shield of the U.S. (trichoderma harziarum T22), Israel, Zelanian wooden removing mildew Trichodry and Trichoflow, Russian doctor Kolombet development, Korea S professor Chung research and development adopts the biological prevention and control agent TUSAL of trichoderma harziarum and viride mixed developing, and these preparations are all obtained good control effect and tangible production-increasing function in control of plant disease.In recent years, domestic scientific research personnel also the diversion of biological control on the antagonism Trichoderma, and it progressively is applied in the field.Fourth Bandung etc. are with wooden removing mildew control Radix Panacis Quinquefolii damping-off, and Li Liang has done trichoderma harziarum T.harzianum control jasmine southern blight, and usefulness viride T.vi ride such as Xing Yunzhang control genseng root rot has all obtained certain effect.But existing Trichoderma protection effect aspect control of maize root rot in seedling stage is not good, and survival rate of seedlings is lower, and effect is undesirable.
(3) summary of the invention
The present invention is in order to remedy the deficiency of prior art, and the screening method of a kind of low cost, corn root rot in seedling stage biocontrol trichoderma bacterium simple and easy to operate is provided.
The present invention realizes through following technical scheme:
The screening method of a kind of corn root rot in seedling stage biocontrol trichoderma bacterium is characterized in that: comprise the steps:
(1) soil sample collection:
Choose corn planting field piece, 5 samplings in each plot, every sampling spot is along the never co-located sampling 3 times of corn rhizosphere, and the degree of depth that fetches earth 0-20cm mixes the aseptic plastic bag of packing into it after 5 samplings of same field piece;
(2) preparation of the soil solution:
The soil sample that collects is broken into pieces, sieved after air-dry, and the soil sample 10g that gets abundant mixing adds sterilized water and is settled to 100mL in volumetric flask, and vibration 30min gets 10mL soil suspension-s and adds in the 90mL sterilized water, is diluted to 10 successively
-6Doubly, be used for after fully shaking up separating;
(3) separation and purification of Trichoderma:
With the soil suspension-s 10-20s that on vibrator, vibrates after the dilution, draw 1mL soil suspension-s to LB agar plate central authorities, smoothen with spreading rod; And carry out the concentration mark; The LB agar plate that coats leaves standstill 5min, and soil suspension-s is penetrated in the LB agar plate, the LB agar plate that coats is inverted in 28 ℃ of thermostat containers cultivates; Every concentration repeats 3 times; After treating to grow bacterium colony on the LB agar plate, the tender mycelia of picking colony edge children purifying repeatedly to the PDA flat board is transplanted mycelium freezing preservation on the PDA inclined-plane from the single dispersive bacterium colony that forms;
(4) screening of Trichoderma:
Promptly get after isolating trichoderma strain sieved with the PDA substratum again.
The PDA substratum sieves again and belongs to prior art, no longer details.
The beneficial effect of the screening method of corn root rot in seedling stage biocontrol trichoderma bacterium of the present invention is: method is simple and easy to operate, and cost is lower; It is long that the Trichoderma that filters out prepares the Trichoderma developing agent storage phase, can effectively store more than 1 year, and protection effect is good, and seedling rate improves about 45%; The survival rate comparison is according to high by 50%, and seedling protecting effect is good, and susceptible index reduces by 60%, and is harmless to people and animals and ecotope; Noresidue is not developed immunity to drugs, and raw material sources are wide; Production cost is lower than chemical pesticide derosal etc., can also turn waste into wealth, and has good economic benefits and social benefit.
(4) description of drawings
Below in conjunction with accompanying drawing the present invention is further described.
Accompanying drawing 1 is the influence figure of different carriers to the Trichoderma sporulation quantity.
(5) embodiment
(A) corn root rot in seedling stage separation and Identification of Pathogens:
(I) method:
1. pathogenic bacteria separates:
Corn root rot in seedling stage pathogenic bacteria separates: the maize seedling root is clean with flushing with clean water, and the sick strong intersection of clip root is organized about 0.5cm, carry out the tissue surface sterilization with ordinary method after, be placed on PDA and the CMA substratum 28 ℃ of cultivations respectively.After 5 days isolate is carried out preliminary evaluation.If sickle spore bacterium (
Fusarium spp.) then forward on the F8 liquid nutrient medium, treat that it produces macroconidium after, the picking monospore is further purified, and supplies strain identification and test to use.
The PDA substratum: peeling potatoes 200g, chopping adds water 1000mL, boils 20min, filtered through gauze, filtrating complements to 1000mL, adds glucose 20g, and agar 15g is heated to fusing;
The CMA substratum: get the 60g corn grain and put into water and boil 1h, filter, get liquid and add 20g agar, 20g glucose adds water to 1000mL, pH=7.0, packing, sterilization;
F8 liquid nutrient medium: KH
2PO
42g; KNO
32g; KCl 1g; MgSO
41g; FeSO
4, FeCl
3, MnSO
4, ZnSO
4Each 0.0002g; Sug 1g; Water 1000mL; PH=5.0, packing, sterilization.
2. pathogen identification:
With isolate according to Wei Jingchao (the fungi identification handbook " and " eompendium of corn disease " (1980) the described asexual organ morphology characteristic of Maleolme.shurtleff. and cultivate shape and identify.
(II) result and analysis:
Corn root rot in seedling stage pathogenic bacteria kind:
Separating the pathogenic bacteria that obtains from corn root rot in seedling stage diseased plant has Fusarium moniliforme, Fusarium graminearum, fusarium oxysporum bacterium, pythium spp, dry thread Pyrenomycetes etc., and wherein the cross frequence of Fusarium moniliforme is the highest, is respectively 43.66%; The cross frequence of Fusarium graminearum is 13.57%; The cross frequence of other pathogenic bacteria is all at (table 1) below 5%.Presentation of results, the The main pathogenic fungi that causes corn root rot in seedling stage is Fusarium moniliforme and Fusarium graminearum.
Table 1 corn root rot in seedling stage pathogenic bacteria cross frequence
(B) screening method of corn root rot in seedling stage biocontrol trichoderma bacterium:
(I) method:
1. soil sample collection:
Picked at random corn planting field piece; 5 samplings in each plot, every sampling spot is along the never co-located sampling 3 times of corn rhizosphere, the degree of depth that fetches earth 0~20cm; After 5 samplings of same field piece it is mixed the aseptic plastic bag of packing into; Indicate numbering, place, acquisition time, take back the laboratory and supply to separate usefulness, gather 36 parts of soil samples altogether;
2. the preparation of the soil solution:
The soil sample that collects is broken into pieces, sieved after air-dry, and the soil sample 10g that gets abundant mixing adds sterilized water and is settled to 100mL in volumetric flask, vibration 30min.Get 10mL soil suspension-s and add in the 90mL sterilized water, be diluted to 10 successively
-6Doubly, be used for after fully shaking up separating;
3. the separation and purification of Trichoderma:
With the soil suspension-s 10~20s that on vibrator, vibrates after the dilution; Draw 1mL soil suspension-s to LB agar plate central authorities, smoothen with spreading rod, and carry out the concentration mark; The LB agar plate that coats leaves standstill 5min; Soil suspension-s is penetrated in the LB agar plate, the LB agar plate that coats is inverted in 28 ℃ of thermostat containers cultivates, every concentration repeats 3 times.After treating to grow bacterium colony on the LB agar plate, the tender mycelia of picking colony edge children purifying repeatedly to the PDA flat board.For use from the single dispersive bacterium colony transplanting mycelium freezing preservation on the PDA inclined-plane that forms;
4. the screening of Trichoderma:
From 36 parts of soil samples of gathering, isolate 92 strain trichoderma strains.Obtain antagonistic effect 10 trichoderma strains preferably after sieving again with the PDA substratum, be numbered: T-A2, T-B5, T-B8, T-B11, T-C7, T-C10, T-D3, T-E4, T-E8, T-F3;
5. face-off is cultivated:
Use punch tool to break into the bacterium cake of size respectively Trichoderma and the Fusarium moniliforme cultivated on the PDA flat board about 5d as 6mm; Be inoculated in respectively on the PDA flat board; 2 bacterium cakes are at a distance of 5cm; In 28 ℃ of cultivation 7d, observe and write down the colony growth distance and the antagonism situation of Trichoderma and Fusarium moniliforme day by day, calculate inhibiting rate.
In inhibiting rate/%=[(dCK-dB)/dCK] * 100 formulas, dCK representes to contrast the pathogenic bacteria colony diameter, and dB representes to handle the pathogenic bacteria colony diameter.
Preventive effect=(contrast disease index-processing disease index)/contrast disease index * 100%
When 72h was cultivated in face-off, picking two bacterium colony interface mycelia film-makings were with microscopic examination Trichoderma and pathogenic bacteria common factor place mycelial growth situation and tracing observation.Be contrast only to inoculate Fusarium moniliforme again, do the pure culture test and the full ware time of record bacterium colony of Trichoderma and Fusarium moniliforme simultaneously, every processing repeats for 3 times.
The inhibiting rate that face-off is cultivated:
Find out that from table 2 10 strain antagonistic effects trichoderma strain preferably all have restraining effect in various degree to Fusarium moniliforme, inhibiting rate has 5 strains greater than 70%.Wherein, the inhibiting rate of T-C7 is higher than 85%, and its initial growth speed all obviously is superior to supplying the examination pathogenic bacteria, and two bacterium colony mycelia were in contact with one another after 36h was cultivated in face-off, after can see that the Fusarium moniliforme speed of growth reduces rapidly.Because the antagonism of Trichoderma, the Fusarium moniliforme colony radius increases slowly.Microscopically can see that mycelia twines foldingly each other, and the spore of Trichoderma is grown on the pathogenic bacteria bacterium colony.
Table 2 Trichoderma is to the antagonistic effect of pathogenic bacteria
(II) result and analysis:
1. potted plant control test:
Fusarium moniliforme is connected on the PDA substratum, places 28 ℃ of constant incubators to cultivate, treat to wash with aqua sterilisa after it produces spore, be made into 10
4The spore suspension of individual/mL.Select uniform corn seed, use volumetric concentration be behind 70% the alcohol disinfecting 5min with sterilized water washing 3 times, be with sterilized water washing 5 times behind 0.1% the mercuric chloride solution sterilization 5min with massfraction again.The heavy 5kg of every basin soil sows 6.Choose uniform seedling 3 strains of growth after the sprouting, be divided into following 3 processing (each is handled 3 times and repeats): handle 1:10
7The Trichoderma T-C7 bacterium liquid 50mL of individual/mL and the mixed solution of the above-mentioned spore suspension of 50mL are handled; Handling the 58% metalaxyl-mn-zn WP soup 50mL of 2:1mg/mL and the mixed solution of the above-mentioned spore suspension of 50mL handles; Handling the mixed solution of 3:50mL clear water and the above-mentioned spore suspension of 50mL handles.Three kinds of mixed solutions with above-mentioned three kinds of treatment processs water seedling (every basin 100mL) respectively, and the 30d " Invest, Then Investigate " is respectively handled the incidence of corn, calculate disease index and preventive effect.The fusarium root rot of maize grade scale: the 0=root system is sound, no scab; Fragmentary scab is arranged on the 1=root system, but not in flakes; 2=root disease spot in flakes, but less than the l/4 of root girth; 3=root disease spot is greater than 1/4 of root girth, but less than l/2; 4=root disease spot is greater than 1/2 of girth, but less than 3/4; The whole root of 5=all has scab to surround butt rot.
The control effect of 2. potted plant control test:
The potted plant test-results (table 3) of preventing and treating shows that with Trichoderma T-C7 control of maize root rot in seedling stage, preventive effect is 45.19%, and with 58% metalaxyl-mn-zn WP soup control of maize root rot in seedling stage, preventive effect is 35.87%, is lower than trichoderma strain T-C7.Maize seedling growing state to each processing is observed, and the growing way of the maize seedling of handling through Trichoderma T-C7 is superior to metalaxyl-mn-zn to be handled, and shows that Trichoderma T-C7 has certain promoter action to the growth of maize seedling.
The control effect of the potted plant control test of table 3
(C) evaluation of corn root rot in seedling stage biocontrol trichoderma bacterium:
(I) materials and methods:
1. material:
(a) strains tested: trichoderma strain T-C7.
(b) main agents: the GoldView nucleic acid dye, purchase match Parkson biotechnology ltd in Beijing; Taq enzyme, DL2000 PlusMarker and cloning vector pMD18-T purchase the company in Takara; DNA reclaims test kit, purchases the Bo Maide biotechnology ltd in Beijing; Pcr amplification primer: ITS1:5 ' TCCGTAGGT-GAACCTGCGG3 ' and ITS4:5 ' TCCTCCGCTTATTGATATGC3 ', synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
2. method: strain identification:
(a) cultivate proterties and morphologic observation:
It is dull and stereotyped that trichoderma strain T-C7 to be identified is inserted PDA, 28 ℃ of cultivations, the color and the form of whenever observing bacterium colony at a distance from 24 h.Observe mycelia, conidiophore and conidial size and form in microscopically behind the 72h.According to the evaluation of classifying of the method for Rifai and Bissett.
(b) Molecular Identification:
Adopt cetyl trimethylammonium bromide method (being the CTAB method) to extract the total DNA of trichoderma strain T-C7, carry out pcr amplification with universal primer ITS1 and ITS4.
25.00 μ l reaction system:
2.50 μ l 10 * Buffer; 2.00 μ l 2. 5mmol/L dNTPs, 2.00 μ l, 25 mmol/LMgCl2,1.00 μ l10 μ mol/LITS1 primers; 1.00 μ l10 μ mol/L ITS4 primer; 0.25 μ l5U/ μ lTaq enzyme, 2.00 μ lDNA templates complement to 25.00 μ l with the sterilization distilled water.
Response procedures: 94 ℃ of sex change 5min; 94 ℃ of sex change 30 s, 51 ℃ of annealing 30s, 72 ℃ are extended 1min, 32 circulations; 72 ℃ are extended 10 min.1% agarose with containing nucleic acid dye carries out electrophoresis detection; Amplified production reclaims test kit through DNA and reclaims; The PCR product that reclaims is connected on the cloning vector, in recombinant plasmid transformed to the bacillus coli DH 5 alpha host cell, uses the LB agar plate screening that contains Amp to contain the white clone of recombinant plasmid; Through sending the order-checking of Beijing promise match gene ltd after the bacterium colony PCR checking, the ITS sequence of known Trichoderma is compared among sequencing result and the GenBank.
(II) result and analysis: the evaluation of Trichoderma T-C7:
1. cultivate proterties and morphological specificity:
On the PDA flat board, colony growth is rapid, flocculence; Light green is to deep green, and elementary branch often is positioned at base portion on the conidiophore main shaft, and how irregular; The secondary branch distributed architecture of sporophore main shaft is complicated, has 2-3 usually and returns branch, and bottle metulae portion shrinks not obvious; Conidium ellipse or oval, smooth surface.Very similar with the form description that long shoot wood is mould, preliminary evaluation is that long shoot wood is mould.
2. ITS sequence amplification result:
The genomic dna of Trichoderma T-C7 obtains single purpose band through pcr amplification.Learn that through sequential analysis sequence length is the dna fragmentation of 549 bp.To measure sequence and carry out Blast comparison, in the GenBank DB, carry out the homology search, the ITS sequence of bacterial strain T-C7 and accession number be the long shoot wood of HM192931.1, GQ203535.1, EU401572.1 and FJ858772.1 mould (
Trichoderma longibrachiatum) the homology of ITS sequence reach 100%.According to the ITS The sequencing results of bacterial strain T-C7 and cultivate proterties and morphological specificity, with its be accredited as long shoot wood mould (
Trichoderma longibrachiatum).
1?ccgagtttac?aactcccaaa?ccccaatgtg?aacgttacca?atctgttgcc?tcggcgggat
61?tctcttgccc?cgggcgcgtc?gcagccccgg?atcccatggc?gcccgccgga?ggaccaactc
121?caaactcttt?tttctctccg?tcgcggctcc?cgtcgcggct?ctgttttatt?tttgctctga
181?gcctttctcg?gcgaccctag?cgggcgtctc?gaaaatgaat?caaaactttc?aacaacggat
241?ctcttggttc?tggcatcgat?gaagaacgca?gcgaaatgcg?ataagtaatg?tgaattgcag
301?aattcagtga?atcatcgaat?ctttgaacgc?acattgcgcc?cgccagtatt?ctggcgggca
361?tgcctgtccg?agcgtcattt?caaccctcga?acccctccgg?ggggtcggcg?ttggggatcg
421?gcccctcacc?gggccgcccc?cgaaatacag?tggcggtctc?gccgcagcct?ctcctgcgca
481?gtagtttgca?cactcgcacc?gggagcgcgg?cgcggccaca?gccgtaaaac?accccaaact
541?tctgaaatg。
(D) zymotechnique of Trichoderma:
(I) materials and methods:
1. trichoderma strain: long shoot trichoderma strain;
2. nutritional condition:
(a) slant medium: the long shoot trichoderma strain is inoculated on the PDA substratum 30 ℃ cultivated 5 days;
(b) liquid nutrient medium: composition is wheat bran 0.5-0.8g, ammonium sulfate 0.2-0.4g, potassium primary phosphate 0.1-0.3g, lime carbonate 0.1-0.3g, glucose 1-2g; With sterilized water obtaining liq fermention medium 100mL, adjustment pH value is 5.5-6, autoclaving 30-40min with above-mentioned substance; After the cooling; Insert long shoot Trichoderma kind, behind 26-30 ℃ of shaking culture 60h, stop, subsequent use;
(c) selection of solid fermentation culture medium:
Be fermentation strain and carry out the microbial inoculum Research on processing technology with Trichoderma T-C7; According to existing report; Select bacterium chaff and corn stalk powder as trichoderma strain fermentation culture matrix; The bacterium chaff is to utilize raw materials such as stalk, wood chip to carry out the edible mushrooms substituting stuff cultivation, and the substratum residuum after receiving is commonly called as edible fungus culturing waste material, bacterium slag or clout; Be the residual body of hypha of edible fungus and through the edible mushrooms enzymolysis, the mixture of the compositions such as robust fibre of structure generation qualitative change.
The culture medium of different proportionings and water cut are to the influence of sporulation quantity:
Select the bacterium chaff: the weight ratio=1:0.5 of corn stalk powder, 1:1,1:1.5,1:2,1:2.5,1:3,1:3.5,1:4,1:4.5,1:5; The two mixes total amount is 50g; Water cut is respectively 50%, 55%, 60%, 65%, 70% (W/W); Pack in the 500mL triangular flask, repeat 3 times, it is subsequent use to sterilize.Insert the spore suspension 5.0mL (1.0 * 10 of trichoderma strain T-C7
7Cfu/mL), gauze seals, and guarantees air permeability and good, and (illumination: dark=12:12), culture environment relative humidity is 90% in 26 ℃ of cultivations.Since 4d, every separated 1d stirs once, is cultured to 10d, natural air drying.Get oven dry 24h in 60 ℃ of loft drier of part tunning then, measure the spore amount.With the 50g corn stalk powder is contrast.
The different vaccination amount is to the influence of fermentation time and sporulation quantity:
With mixture (the two weight ratio is 1:4) the mixing total amount of bacterium chaff and corn stalk powder is 50g, adding distil water 100mL, and in the 500mL triangular flask of packing into, it is subsequent use to sterilize.Insert trichoderma strain T-C7 spore suspension 5.0mL respectively, spore suspension concentration is respectively 1.0 * 10
5Cfu/mL, 1.0 * 10
6Cfu/mL, 1.0 * 10
7Cfu/mL, 1.0 * 10
8Cfu/mL, 1.0 * 10
9Cfu/mL seals with 6 layers of gauze, guarantees air permeability and good, cultivates (illumination: dark=12:12) 5d, 7d, 10d and 12d respectively for 26 ℃.Culture environment relative humidity is 90%.Since 4d, every separated 1d stirs once.After the fermentation ends, get oven dry 24h in 60 ℃ of loft drier of part tunning, inspection spore amount.Each handles repetition 4 times.
(II) result and analysis:
1. the culture medium of the different proportionings of solid fermentation and water cut are to the influence of sporulation quantity:
The culture medium of the different proportionings of table 4 and water cut are to the influence of sporulation quantity
Find out by table 4; In 26 ℃ of cultivations (illumination: behind the 10d of dark=12:12); The bacterium chaff: the corn stalk powder weight ratio is in 1:0.5,1:1,1:1.5,1:2,1:2.5,1:3,1:3.5,1:4,1:4.5, ten proportionings of 1:5; Along with the increase of water cut in the culture medium, tunning spore amount is also raising, and is wherein best with 60% water cut tunning.After the fermentation ends, two air-dry fragmentations of proportioning tunning of 1:0.5 and 1:1 are difficulty, and fermentation costs increases.When water cut arrived 70%, the dewfall phenomenon appearred in the subiculum surface in the fermenting process, and unfavorable to producing spore, sporulation quantity reduces.Find also in the test that along with the increase of bacterium chaff ratio, sporulation quantity can increase successively, but the fermenting process medium viscosity becomes big, ventilation property reduces, and can increase the risk of bacterial contamination.The 1:3 proportioning has slight caking, and is very loose after the tunning of 1:3.5,1:4 and two proportionings of 1:5 is air-dry, need not fragmentation.
Whether ventilation property and the air-dry aftertreatment of tunning of considering fermentation costs, spore output, fermenting process be easy, and the ratio of selecting bacterium chaff and corn stalk powder is best fermentation proportioning with 1:4, and the optimum water cut is 60%.
2. the different vaccination amount is to the influence of mould fermentation time of wood and sporulation quantity:
Table 5 different vaccination amount is to the influence of fermentation time and sporulation quantity
The result finds out by table 5, and the different vaccination amount has bigger influence to fermentation time.The inoculum size (1 * 10 of minimum concentration
5Cfu/mL) sporulation quantity up to 12d just reaches the result identical with other inoculum size.Along with the increase of inoculum size, fermentation time shortens.7d, 1 * 10
7Cfu/mL, 1 * 10
8Cfu/mL, 1 * 10
9The fermented product spore output of three inoculum sizes of cfu/mL promptly reaches higher level, and it is 1.37 * 10 that every gram fermented product contains the spore amount
10-1.51 * 10
10Individual, no significant difference.5d to the 7d is these three inoculation volume production spore peak periods.Along with time lengthening, the spore amount also has the trend that increases, but increasing amount is lower.From test-results comprehensive evaluation, select every 100g culture medium inoculation 10mL spore suspension (1 * 10
7Cfu/mL), fermentation 8d can arrive stable spore output.
(III) trichoderma strain T-C7 solid fermentation process:
Comprehensive front result of study, biocontrol trichoderma bacterial strain T-C7 adopts the fermentation condition of solid fermentation method to be: culture medium is bacterium chaff and corn stalk powder (weight ratio is 1:4), and water cut is 60% (W/W), 120 ℃ of sterilization 30min; The fermentation inoculum size is that every 100g culture medium inoculation 10mL concentration is 1 * 10
7The spore suspension of cfu/mL; 26 ℃ of leavening temperatures; Yeasting relative humidity is more than 90%; Fermentation 8d can stop, and air-dry back stores promptly to get is fully loaded with the conidial solid culture medium of Trichoderma.Every gram solid culture medium spore amount can reach 1.37 * 10
10-1.51 * 10
10Individual.
(E) preparation method of Trichoderma agent:
(I) materials and methods:
1. strains tested: Trichoderma T-C7.
2. the screening of carrier:
Supply the examination carrier to comprise kaolin, lime carbonate, talcum powder, zeyssatite, silica gel, wilkinite or vermiculite, above carrier is commercially available.
(a) carrier is to the influence of the Trichoderma speed of growth:
With the ratio of 5 ﹪ various confessions examination carriers are added in the PDA substratum and to process flat board, insert the Trichoderma cake (d=5mm) of cultivating 4d, cultivate 4d down for 25 ℃, measure the colony diameter size and also calculate the colony diameter daily growth amount.
Colony diameter daily growth amount (cm/d)=(colony diameter-0.5cm)/4
(b) carrier is to the influence of Trichoderma sporulation quantity:
Beat with punch tool (d=5mm) at the Trichoderma colony edge of above-mentioned cultivation 4d and to get 1 ferfas cake and place the 10ml sterilized water that contains two tween-80s, fully shake up, spore is all come off, with blood counting chamber counting and Units of Account area sporulation quantity.Sporulation quantity is (individual/cm
2Average every lattice spore count of)=(* 4 * 10
6* extension rate)/0.19625.
3. the screening of uv-protector:
Supply the examination uv-protector to comprise humic acids, XG 550, xitix.
(a) uv-protector is to the influence of the Trichoderma speed of growth:
Humic acids, XG 550, each 0.5g of xitix are joined respectively in the 100mLPDA substratum, process culture medium flat plate, the Trichoderma piece is inserted in the culture medium flat plate; Each handles repetition 4 times; Not add the contrast that is treated to of uv-protector in the PDA flat board, UV-irradiation 30min cultivates in 25 ℃ of dark culturing casees; 4d measures the colony diameter size, and calculates the colony diameter daily growth amount.
(b) uv-protector is to the influence of Trichoderma sporulation quantity:
The Trichoderma colony edge of cultivating 4d in above-mentioned steps (a) is beaten with punch tool (d=5mm) and is got 1 ferfas cake and place the 10ml sterilized water that contains two tween-80s, fully shakes up, and spore is all come off, and counts also Units of Account area sporulation quantity with blood counting chamber.Utilize SPSS data processing software (version 18.0) that test-results is handled, growth has or not the significance influence to more different uv-protectors to trichoderma strain.
4. the mensuration of vermiculite pH value:
Get the 10g vermiculite and put into the Erlenmeyer flask with grinding port plug, add the zero(ppm) water 40mL of pH 7.0, the jam-pack bottle stopper acutely shakes 1min, and adding distil water 50mL shakes 1min again, gets supernatant liquid after leaving standstill, and measures the pH value then.
5. the preparation method of Trichoderma agent:
The vermiculite carrier is pulverized, and controlling its fineness is the 40-60 order, and adjusting humidity is 8-12%, in carrier, adds uv-protector, and allotment evenly back is subsequent use; After will being fully loaded with the conidial solid culture medium Air drying of Trichoderma; Be ground into the Trichoderma conidial powder with Universalpulverizer, the Trichoderma conidial powder be dissolved in the water of 8 times of Trichoderma conidial powder weight behind the mixing, evenly be sprayed onto on the mixture of carrier and uv-protector; Mixing; In air dry oven, dry, make the relative humidity of microbial inoculum be controlled at 10-15%, pack preservation and promptly get the Trichoderma agent; Wherein the weight proportion of Trichoderma conidial powder, uv-protector, carrier is 10:1-5:85-90.
(II) result and analysis:
1. the screening of carrier:
Test-results (Fig. 1) shows; Confession examination carrier is born to Trichoderma and is grown, sporulation quantity is all influential; Best with vermiculite to spore vigor protection, even promote the effect of colony growth in addition, the colony growth amount of other carriers has been compared significant difference with sporulation quantity with contrast.
2. the screening of uv-protector:
Supply in the uv-protector of examination humic acid to the Trichoderma long promoter action, little that has of being born to the sporulation quantity influence; XG 550 is born to grow to Trichoderma also has promoter action, but sporulation quantity reduces; Xitix has restraining effect to colony growth and the sporulation quantity of Trichoderma, sees table 6.
The different uv-protectors of table 6 are to the influence of Trichoderma vigor
3. vermiculite pH value:
Draw through replication, the pH value of vermiculite is 5-6, and slant acidity is fit to the Trichoderma growth.
Experiment shows, vermiculite is handled and do not had the difference of significance to impinging upon colony diameter daily growth amount and unit sporulation quantity, and is not obvious to the mould effect of vigor of wood, and humic acid is to the Trichoderma long promoter action, to the sporulation quantity influence not quite of having of being born.Above-mentioned the mould T-C7 bacterial strain of wood tool good biological is learned confirming of consistency uv-protector, for the mould biological prevention and control agent formulating of wood is laid a good foundation.
4. Trichoderma agent storage experiment:
Behind the Trichoderma agent dress bag, be placed under the normal temperature and store, in the time of the 9th, 13 month, take out its spore germination rate of mensuration and be respectively: 100%, 94.6%; Respectively microbial inoculum is carried out high low temperature shelf test, measure spore germination rate, store a week for 0 ℃, spore germination rate reaches 99.60%, 55 ℃ and stored for two weeks, and spore germination rate reaches 90.2%, reaches the requirement of pesticide registration to storage period.
(F) Trichoderma agent drug effect result:
(I) materials and methods:
1. microbial inoculum:
The Trichoderma agent: the microbial inoculum of solid fermentation contains spore amount 2 * 10 approximately as diseases prevention reagent
9G/g.
2. the selection of pathogenic bacteria:
The root inoculation method is dipped in utilization, to carrying out the mensuration of susceptible power, selects the strongest bacterial strain of virulence, in petridish, cultivates 7 days, and mycelia is covered with petridish, puts into tissue mincer and adds water and smash to pieces for 20 times, and is subsequent use.
3. biotechnological formulation is to native naturally potted plant fusarium root rot of maize efficiency test:
Every basin 5kg continuous cropping soil, fully mixing.Every basin is broadcast 5 corn seeds, 3 strains of keeping a full stand of seedings.Design three kinds of different treatment: 1, whenever spread manuer in holes into Trichoderma agent 0.2g, simultaneously inoculation Fusarium moniliforme during maize planting; 2, clear water contrast: every cave does not apply microbial inoculum, does not inoculate Fusarium moniliforme during maize planting; 3, blank: every cave does not apply microbial inoculum, inoculation Fusarium moniliforme during maize planting.3 repetitions are established in every processing.Investigate incidence in seedling stage, calculate mortality ratio, disease index and preventive effect.
4. field test:
Test is located at the experimental plot of the Boxing County of corn root rot in seedling stage repeating transmission.The experimental plot soil property is consistent, and soil fertility is even, in the soil fertility on.This test is research object with the corn, designs three kinds of different treatment: 1, whenever spread manuer in holes into Trichoderma agent 0.2g, simultaneously inoculation Fusarium moniliforme during maize planting; 3, clear water contrast: every cave does not apply microbial inoculum, does not inoculate Fusarium moniliforme during maize planting; 2, blank: every cave does not apply microbial inoculum, inoculation Fusarium moniliforme during maize planting.Two district's groups are set to be repeated for three times.Each district's group comprises three sub-districts, and each sub-district is a processing, 4 meters * 2.4 meters of its sub-district areas, and the district organizes interior three and handles the employing random alignment, and district's group area is 4 meters * 7 meters.
5. take a sample and investigate:
Take a sample to plant seedling stage, and the incidence of corn is respectively handled in investigation, calculates mortality ratio, disease index and preventive effect.
6. add up:
Record data are added up and analyzed
Disease index=100 * ∑ (progression * this grade strain number)/(the highest number of falling ill * total strain number)
Preventive effect=(contrast disease index-processing disease index)/contrast disease index * 100%
Dead decrement=(connect disease contrast mortality ratio-other handle mortality ratio)/connect disease to contrast mortality ratio * 100%.
(II) result and analysis:
1. the agent of pot experiment Trichoderma is to the control effect of potted plant fusarium root rot of maize:
The agent of table 7 pot experiment Trichoderma is to the control effect of potted plant fusarium root rot of maize
Pot experiment (table 7) confirms that clear water contrast disease index is 63.51%, and preventive effect is 11.09%.The corn that the Trichoderma agent is handled, its mortality ratio ratio connect the disease contrast and reduce 71.66%, and disease index is 19.11%, and control effect is up to 73.24%.It is thus clear that the Trichoderma control effect is apparently higher than the clear water contrast and connect the disease processing.
2. the agent of field test Trichoderma is to the control effect of corn root rot in seedling stage:
The agent of table 8 field test Trichoderma is to the control effect of corn root rot in seedling stage
Field test results (table 8) shows that with Trichoderma agent control of maize root rot in seedling stage, its seedling rate significantly improves, and dead decrement is 72.13%, and seedling protecting effect is remarkable.Disease index is significantly to reduce, and preventive effect is 74.24%, and control effect is remarkable.
Sum up:
(ⅰ) investigation Accessories during Binzhou corn root rot in seedling stage incidence; The sick strong intersection tissue of corn root rot in seedling stage is cultivated; Separate the pathogenic bacteria that obtains Fusarium moniliforme, Fusarium graminearum, eggplant class sickle spore bacterium, bundle stalk sickle spore bacterium, fusarium oxysporum bacterium, pythium spp, dry thread Pyrenomycetes etc. are arranged; Wherein the cross frequence of Fusarium moniliforme is the highest, is respectively 43.66%; The cross frequence of Fusarium graminearum is 13.57%; The cross frequence of other several kinds of pathogenic bacterias is all below 5%.The result shows that the The main pathogenic fungi that causes Accessories during Binzhou corn root rot in seedling stage is Fusarium moniliforme and Fusarium graminearum.
(ⅱ) filter out the Trichoderma of antagonism corn root rot in seedling stage and identifying.From 36 parts of soil samples of gathering, isolate 92 strain trichoderma strains.Obtain antagonistic effect 10 trichoderma strains preferably after sieving again with the PDA substratum, 10 strain antagonistic effects trichoderma strain preferably all have restraining effect in various degree to Fusarium moniliforme, and inhibiting rate has 5 strains greater than 70%.Wherein, the inhibiting rate of T-C7 is higher than 85%, and its initial growth speed all obviously is superior to supplying the examination pathogenic bacteria, and two bacterium colony mycelia were in contact with one another after 36h was cultivated in face-off, after can see that sickle spore bacteria growing speed reduces rapidly.
(ⅲ) according to cultivating proterties and morphological specificity, T-C7 bacterial strain preliminary evaluation is that long shoot wood is mould.The back is through the rDNA-ITS sequential analysis, the ITS sequence of bacterial strain T-C7 and accession number be the long shoot wood of HM192931.1, GQ203535.1, EU401572.1 and FJ858772.1 mould (
Trichoderma longibrachiatum) the homology of ITS sequence reach 100%, satisfy with its be accredited as long shoot wood mould (
Trichoderma longibrachiatum).
(ⅳ) biocontrol trichoderma bacterial strain T-C7 adopts the fermentation condition of solid fermentation method to be: culture medium is bacterium chaff and corn stalk powder (weight ratio is 1:4), and water cut is 60% (W/W), 120 ℃ of sterilization 30min; The fermentation inoculum size is that every 100g culture medium inoculation 10mL concentration is 1 * 10
7The spore suspension of cfu/mL; 26 ℃ of leavening temperatures; Fermentation 8d can stop, and air-dry back stores.Every gram solid culture medium spore amount can reach 1.37 * 10
10-1.51 * 10
10Individual.
(ⅴ) Trichoderma agent preparation: the vermiculite carrier is pulverized, and controlling its fineness is the 40-60 order, and adjusting humidity is 8-12%, in carrier, adds uv-protector, and allotment evenly back is subsequent use; After will being fully loaded with the conidial solid culture medium Air drying of Trichoderma; Be ground into the Trichoderma conidial powder with Universalpulverizer, the Trichoderma conidial powder be dissolved in the water of 8 times of Trichoderma conidial powder weight behind the mixing, evenly be sprayed onto on the mixture of carrier and uv-protector; Mixing; In air dry oven, dry, make the relative humidity of microbial inoculum be controlled at 10-15%, pack preservation and promptly get the Trichoderma agent; Wherein the weight proportion of Trichoderma conidial powder, uv-protector, carrier is 10:1-5:85-90.
(ⅵ) behind the Trichoderma agent dress bag, be placed under the normal temperature and store, reach the requirement of pesticide registration storage period.
(ⅶ) field test results shows, with Trichoderma agent control of maize root rot in seedling stage, its mortality ratio ratio connects the disease contrast and reduces 75.43%, and disease index is 19.43%, and preventive effect is 74.24%.
The made Trichoderma agent of the present invention is harmless to people and animals and ecotope, and noresidue is not developed immunity to drugs, and production cost is lower than chemical pesticide derosal etc., can also turn waste into wealth, and has good economic benefits and social benefit.Concrete relatively like following table:
Agent of table 9 Trichoderma and the comprehensive contrast table of chemical pesticide characteristic
The made Trichoderma agent of the present invention is compared with other like product has following advantage:
(1) with short production cycle, sporulation quantity is big, and is easy to use.Sporulation quantity at solid fermentation stage trichoderma conidium is high, and it is 1.37 * 10 that every gram solid culture medium contains the spore amount
10-1.51 * 10
10Individual; Adopt perforated method to apply the Trichoderma pulvis, simple and easy to do, reduce labour cost;
(2) raw material sources are wide, and cost is low, and product can consume a large amount of corn straws; Not only avoid to turn waste into wealth, have good economic benefits and social benefit because of burning the topsoil that corn straw causes; Be that development is efficient, green, ecological agriculture ideal biological pesticide;
(3) operation of trichoderma conidium collection is easy, will be fully loaded with the conidial solid culture medium of Trichoderma after the normal temperature drying, is ground into the Trichoderma conidial powder with Universalpulverizer, is beneficial to production;
(4) storage period long, help products in circulation.Behind the Trichoderma agent dress bag, be placed under the normal temperature and store, in the time of the 9th, 13 month, take out its spore germination rate of mensuration and be respectively: 100%, 94.6%.
This Trichoderma agent is control of maize root rot in seedling stage effectively, promotes root growth, and can improve survival rate of seedlings, and then increase corn yield, promotes increasing peasant income.Binzhou maize sown area reached 370.39 ten thousand mu in 2010, and 492.8 kilograms of per mu yields are along with the influence of factor such as Global climate change in recent years; Corn root rot in seedling stage onset area has expansion trend; If improve 10% in survival rate, then every mu can be increased production about 50 kilograms, and whole Accessories during Binzhou can be increased production 200,000 tons; In 1600 yuan per ton, then can increase income 300,000,000 2,000 ten thousand yuan.Wood enzyme microbial inoculum can increase the plant living weight, and the effect that promotes growth is arranged, if promote output to increase by 1%, then can increase income 3,200 ten thousand yuan, and in actual production, increment rate will be higher than 1%.Can consume a large amount of corn straws when the Trichoderma agent prepares in addition, not only avoid to turn waste into wealth, have good economic benefits, help the development of rural area recycling economy because of burning the topsoil that corn straw causes.
The developing trend of agricultural chemicals at present is efficient, high security, mechanism of action variation and good Environmental compatibility.The operation of this product helps changing the Economic development mode, helps the agricultural chemicals upgrading of industries.This Trichoderma agent is compared with traditional agricultural chemicals, has characteristics such as target pest is single, consumption is few, toxicity is little, efficient is high, easy decomposition, meets the agricultural chemicals development trend.The widespread use of this microbial inoculum will reduce the usage quantity of chemical pesticide, reduces resistance and takes place, and reduces to pollute, and helps environment protection, and the improvement that promotes ecotope is had positive effect.
Claims (1)
1. the screening method of corn root rot in a seedling stage biocontrol trichoderma bacterium is characterized in that: comprise the steps:
(1) soil sample collection:
Choose corn planting field piece, 5 samplings in each plot, every sampling spot is along the never co-located sampling 3 times of corn rhizosphere, and the degree of depth that fetches earth 0-20cm mixes the aseptic plastic bag of packing into it after 5 samplings of same field piece;
(2) preparation of the soil solution:
The soil sample that collects is broken into pieces, sieved after air-dry, and the soil sample 10g that gets abundant mixing adds sterilized water and is settled to 100mL in volumetric flask, and vibration 30min gets 10mL soil suspension-s and adds in the 90mL sterilized water, is diluted to 10 successively
-6Doubly, be used for after fully shaking up separating;
(3) separation and purification of Trichoderma:
With the soil suspension-s 10-20s that on vibrator, vibrates after the dilution, draw 1mL soil suspension-s to LB agar plate central authorities, smoothen with spreading rod; And carry out the concentration mark; The LB agar plate that coats leaves standstill 5min, and soil suspension-s is penetrated in the LB agar plate, the LB agar plate that coats is inverted in 28 ℃ of thermostat containers cultivates; Every concentration repeats 3 times; After treating to grow bacterium colony on the LB agar plate, the tender mycelia of picking colony edge children purifying repeatedly to the PDA flat board is transplanted mycelium freezing preservation on the PDA inclined-plane from the single dispersive bacterium colony that forms;
(4) screening of Trichoderma:
Promptly get after isolating trichoderma strain sieved with the PDA substratum again.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110371101.6A CN102533564B (en) | 2011-11-21 | 2011-11-21 | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110371101.6A CN102533564B (en) | 2011-11-21 | 2011-11-21 | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102533564A true CN102533564A (en) | 2012-07-04 |
CN102533564B CN102533564B (en) | 2016-03-23 |
Family
ID=46341601
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201110371101.6A Expired - Fee Related CN102533564B (en) | 2011-11-21 | 2011-11-21 | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102533564B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104137845A (en) * | 2013-12-23 | 2014-11-12 | 北京首诚航天农业生物科技有限公司 | Preparation for preventing and treating trichoderma and application method of preparation |
CN104328059A (en) * | 2014-10-14 | 2015-02-04 | 江苏科技大学 | Mulberry surface corrosion-causing antagonistic bacteria screening method |
CN106399128A (en) * | 2016-11-21 | 2017-02-15 | 甘肃农业大学 | Method for rapidly separating trichoderma in plant rhizosphere saline-alkali soil |
CN108102932A (en) * | 2018-01-09 | 2018-06-01 | 上海交通大学 | A kind of Antagonistic Trichoderma vitro quick-screening method |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1102056A (en) * | 1993-10-23 | 1995-05-03 | 玉环县三联生物化学厂 | Plant germicide |
-
2011
- 2011-11-21 CN CN201110371101.6A patent/CN102533564B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1102056A (en) * | 1993-10-23 | 1995-05-03 | 玉环县三联生物化学厂 | Plant germicide |
Non-Patent Citations (1)
Title |
---|
刘治刚: "玉米苗期根腐病生防木霉菌的筛选", 《贵州农业科学》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104137845A (en) * | 2013-12-23 | 2014-11-12 | 北京首诚航天农业生物科技有限公司 | Preparation for preventing and treating trichoderma and application method of preparation |
CN104328059A (en) * | 2014-10-14 | 2015-02-04 | 江苏科技大学 | Mulberry surface corrosion-causing antagonistic bacteria screening method |
CN106399128A (en) * | 2016-11-21 | 2017-02-15 | 甘肃农业大学 | Method for rapidly separating trichoderma in plant rhizosphere saline-alkali soil |
CN108102932A (en) * | 2018-01-09 | 2018-06-01 | 上海交通大学 | A kind of Antagonistic Trichoderma vitro quick-screening method |
Also Published As
Publication number | Publication date |
---|---|
CN102533564B (en) | 2016-03-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102382791A (en) | Fermentation process of trichoderma | |
CN103146586B (en) | Trichoderma harzianum strain for controlling plant fungus diseases and application thereof | |
CN106754484B (en) | One plant of rhizobium leguminosarum and its fermentation culture method and application | |
CN102296036B (en) | Bacillus pumilus and application in disease prevention and growth promotion thereof | |
CN102086444B (en) | Paenibacillus elgii strain and application thereof | |
CN106164247A (en) | Inoculation microbial inoculum for stress soil | |
NZ587233A (en) | Methods and compositions comprising trichoderma atroviride for the biological control of soil borne plant pathogens and promoting plant growth | |
CN111690578B (en) | Salt and alkali resistant Siamese bacillus and production method and application of viable bacteria preparation thereof | |
CN102732443B (en) | Sugarcane endogenous nitrogen-fixing Pantoea bacteria and application thereof | |
CN107779408B (en) | Beauveria bassiana for preventing and treating scarab beetles and microbial agent thereof | |
CN106967652A (en) | Rhizobium and its application that one plant of promotion Jian Kuo pea grows | |
CN102839131A (en) | Trichoderma viride and application thereof | |
CN105238723B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt | |
CN102533564B (en) | A kind of screening method of bio-control trichoderma in corn seedling stage root rot period | |
CN110122485A (en) | A kind of trichoderma, Trichoderma and preparation method thereof | |
CN109182194A (en) | One plant of Yang Ling rhizobium for promoting coronule flower growth and its cultural method and application | |
CN109182219A (en) | One plant of Mo Haiwei bacillus for promoting the growth of Henry David Thoreau grass and its application | |
CN103146609A (en) | Pseudomonas fluorescens and method for preventing phytophthora capsici thereby | |
CN109055274A (en) | One plant of caragana rhizobium and its fermentation culture method and application | |
CN108795797A (en) | Raw enterobacter cloacae and its application in one plant of maize root system | |
CN112342173A (en) | Bacillus belgii and application thereof | |
CN105695342B (en) | Koning trichoderma bacterium TG-72 and its application in Aspergillus flavus biological control | |
CN102524306A (en) | Preparation method of trichoderma | |
CN104285575B (en) | Super hybridization rice oxygen supplement irrigation method | |
CN104560797B (en) | Separate the actinomyces bacterium WZW03 bacterial strains obtained and its application in terms of continuous cropping obstacle of watermelon is alleviated |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160323 Termination date: 20191121 |