CN102304508A - Method for preparing DL2000 DNA molecular weight marker as well as product and applications thereof - Google Patents

Abstract

The invention discloses a method for preparing a DL2000 DNA molecular weight marker. The method is characterized by adopting a plasmid enzyme-cut method comprising the following steps of: (1) firstly distributing six fragments to two carriers for amplification, wherein the DL2000 DNA molecular weight marker comprises the six DNA fragments as follows: 100bp, 250bp, 500bp, 750bp, 1kb and 2kb; the carrier 1 comprises the fragment 100bp with the copy number 10, the fragment 250bp with the copy number 4, the fragment 500bp with the copy number 2, the fragment 750bp with the copy number 1, and the fragment 1kb with the copy number 1; and the carrier 2 comprises 2kb with the copy number 1 and the fragment 750bp with the copy number 4; and (2) carrying out enzyme-cutting on the carrier 1 and the carrier 2 by restriction enzyme, and then mixing, thus the molecular weight marker is obtained. According to the invention, the brightness of each belt in the product obtained finally is uniform, the molecular weight marker is convenient to produce, and is convenient for large scale production, and the quality of each batch is stable.

Description

A kind of method for preparing DL2000 dna molecular amount standard and products thereof and application

Technical field

The invention belongs to bioengineering field, particularly a kind of method for preparing the DL2000DNA molecular weight standard and products thereof and application.

Background technology

Dna molecular amount standard is commonly called as DNA Marker, is that the dna fragmentation by a series of known length mixes, and is a kind of reagent the most frequently used in the molecular biology experiment.Dna fragmentation and DNA Marker through gained in will testing carry out electrophoresis in same block of sepharose, through sample fragment and DNA Marker are compared, just can roughly estimate the size of the dna fragmentation of experiment gained.

Each band of DNA Marker has two kinds to prepare scheme usually: pcr amplification and digested plasmid.

The scheme of pcr amplification designs many cover PCR primers exactly and increases, and obtains the dna fragmentation of corresponding size.And then each fragment carried out purifying, quantitatively.In proportion each fragment is mixed at last, just obtained required product.The pcr amplification legal system is equipped with DNA Marker and exists bigger defective, and the one, the volume of amplification has certain restriction.Present each Kongzui of PCR appearance volume that increases can not surpass 70 microlitres more, is example with PCR appearance 96 holes, at most once can increase 7 milliliters.Bigger amount increases the PCR appearance with regard to needs and repeatedly increases.The 2nd, pcr amplification receives multiple condition influence bigger, like instrument, and template, enzyme use in amplification, the primer of different batches, and other reagent, difference can be bigger between therefore different increase batch.The 3rd, the success ratio of pcr amplification is relatively low, and the band that has the more time to increase has assorted band, or the target stripe specificity is not too strong, the band broad that is increased, or the amplification productive rate is lower, and other unsuccessful situation.

The method of conventional plasmid enzyme restriction, because band brightness and its size of DNA have proportional relationship, its brightness possibly have than big-difference after each fragment enzyme was cut in a plasmid, big fragment is brighter than small segment.Therefore can cause brightness irregularities between each band of prepared finished product.

Dna molecular amount standard is a kind of reagent the most frequently used in the Molecular Biology Lab, and belongs to the product of consumption-type, and the market consumption is very big.And the dna molecular amount standard of DL2000 type, by 100bp, 250bp, 500bp, 750bp (adding bright as index strip), 1kb, 2kb totally 6 dna fragmentations form.It is use in the laboratory most convenient, also be to use maximum a kind of products, consumption is very big.Many companies all have similar products like to sell.Because comprised the small pieces segment DNA in this dna molecular amount standard, many companies all adopt the scheme of PCR to carry out product prepn.Because need to consume a large amount of manpower and PCR appearance during PCR produces, and adopt the scheme efficient of pcr amplification low especially as this very little dna fragmentation of 100bp, each band after the amplification all need carry out purifying, and quantitatively.And then band is prepared adjustment one by one, obtains final product.Thereby can exist than big difference between the different batches in the pcr amplification, and very labor intensive and reagent, Production Flow Chart is difficult to stdn.

Summary of the invention

The preparing method's process that the present invention is directed to existing DL2000DNA molecular weight standard is loaded down with trivial details; Unstable quality, the deficiency that is difficult to scale operation, provide a kind of new preparation DL2000 type dna molecular amount standard method and products thereof and use; It is convenient for production; Can be mass-produced steady quality between each batch, each condition brightness homogeneous of DL2000 dna molecular amount standard.

The present invention has solved the problems referred to above through following technical proposals:

First technical scheme of the present invention is: a kind of method of the DL2000 of preparation dna molecular amount standard, adopt the plasmid enzyme restriction method, and may further comprise the steps: (1) DL2000 dna molecular amount standard comprises 6 dna fragmentation: 100bp; 250bp, 500bp, 750bp; 1kb, 2kb is with increasing in these 6 fragment allocation to two carriers; And make them in carrier, have specific copy number, wherein these 6 segmental distribution and copy number are specific as follows: comprise fragment 100bp in the carrier 1, copy number 10; Fragment 250bp, copy number 4; Fragment 500bp, copy number 2; Fragment 750bp, copy number 1; With fragment 1kb, copy number 1; Comprise 2kb in the carrier 2, copy number 1; With fragment 750bp, copy number 4; (2) carrier 1 and carrier 2 usefulness restriction enzymes are carried out enzyme and cut, mix then, promptly get.

Wherein, can take the conventional plasmid enzyme restriction method in this area in the step (1), make the dna fragmentation that comprises each copy number in the carrier, be restriction enzyme digestion sites between the dna fragmentation.After the carrier amplification, use the digestion with restriction enzyme carrier, promptly obtain the dna fragmentation of each copy number.These fragments are mixed, promptly get DL2000 dna molecular amount standard of the present invention.Wherein, the carrier of use can be the conventional carrier in this area, like plasmid etc.Described carrier 1 is genetically engineered plasmid pTZ19R-250 preferably, and Nucleotide is shown in SEQ ID NO:3 in the sequence table; Carrier 2 is genetically engineered plasmid pUCS1-2k-750 preferably, and Nucleotide is shown in SEQ ID NO:4 in the sequence table.Restriction enzyme site among pTZ19R-250 and the pUCS1-2k-750 between the dna fragmentation is Hind III.Also can be other this areas restriction enzyme sites commonly used, preferred Hind III.PTZ19R-250 and pUCS1-2k-750 are carried out enzyme with restriction endonuclease Hind III respectively to be cut; Then; The enzyme of pTZ19R-250 and pUCS1-2k-750 is cut product after electrophoresis detection is qualified, adopts the affinity column chromatography method to carry out purifying, mixes again; Blending ratio is 2.5: 1～1.5: 1 with pTZ19R-250 and pUCS1-2k-750 two plasmid mass ratioes preferably, and best is 1.9: 1.Amount with 1.9: 1 is mixed, and can guarantee that the concentration of the band of 1kb equates with the concentration of the band of 2kb.

Second technical scheme of the present invention is: by the DL2000 dna molecular amount standard of the method for the invention described above preparation.

The 3rd technical scheme of the present invention is: the application of aforesaid DL2000 dna molecular amount standard of the present invention generally is used for agarose gel electrophoresis.

The 4th technical scheme of the present invention is: a kind of genetically engineered plasmid pTZ19R-250, Nucleotide is shown in SEQ ID NO:1 in the sequence table.

The 5th technical scheme of the present invention is: a kind of genetically engineered plasmid pUCS1-2k-750, Nucleotide is shown in SEQ ID NO:2 in the sequence table.

Main points of the present invention and advantage are following:

1, makes up special plasmid, wherein each band is done corresponding copy adjustment, make it that concentration is more reasonable each other.The plasmid that is extracted has directly just obtained every needed ratio of dna fragmentation after enzyme is cut, needn't be as also need carefully carrying out the concentration adjustment between each band of PCR gained.

2, the work of PCR is changed into the extraction of DNA plasmid and the enzyme of DNA is cut operation.Such conversion, the stdn of in actual production, being convenient to produce and the extension of scale, pcr amplification be limited between volume and each amplification batch of each amplification than big-difference, mortality is higher, is not easy mass-producing and extension.

3, because plasmid extracts and enzyme to cut operation be very sophisticated molecular biology operation; And very easy enlargement of scale; The quality control of the column criterion of going forward side by side; Therefore the present invention can carry out the production of dna molecular amount standard in enormous quantities, and guarantees to have between each batch almost completely consistent quality standard.

Description of drawings

Below in conjunction with description of drawings characteristic of the present invention and beneficial effect.

Fig. 1 is a pTZ19R-250 vector construction schema.

Fig. 2 is a pUCS1-2k-750 vector construction schema.

Fig. 3 is pTZ19R-250 carrier structure figure.

Fig. 4 is pUCS1-2k-750 carrier structure figure.

Fig. 5 is 1.2% agarose electrophoresis figure of DL2000 dna molecular amount standard prod of the present invention.

Embodiment

The inventor is implemented in the different dna fragmentation of 6 length that comprises in the DL2000 dna molecular amount standard respectively in two carriers; Restriction enzyme digestion is directly used in this two carriers amplification back; After enzyme cut product and mix; Just obtained the DL2000 dna molecular amount standard formed by these 6 different lengths dna fragmentations, and, just can make the 5 band brightness unanimity of the DL2000 dna molecular amount standard that obtains only as long as the blending ratio of adjustment two plasmids; Index strip (750bp) brightness is the twice of other band, in electrophoresis, clearly shows every band.Embodiment is following:

1, the structure of two carrier DNAs

A) summation

Among the present invention two carriers all with the very high commodity carrier pTZ19R of output (available from Fermentas life sciences; Catalog number: SD0141) be the basis; Adopt conventional experimental technique; Carry out suitable point mutation operation, and from the suitable fragment of Lambda DNA amplification, the point mutation of making series makes up basic fragment.The carrier of then basic fragment and sudden change being transformed links to each other and makes up final carrier.

B) 6 segmental distribution

Carrier 1:pTZ19R-250 comprises 100bp*10,250bp*4,500bp*2,750bp*1,1kb*1.

Carrier 2:pUCS1-2k-750 comprises 2kb*1,750bp*4.

The copy number of fragment in carrier of wherein representing this length behind the asterisk *.

C) sudden change skeleton carrier

I. experimental technique: the mutation method of employing is operated according to sudden change scheme general on the molecular biology, and these schemes have been very sophisticated, and has the reagent corresponding box can supply to select for use.Adopt the most sophisticated PCR method to carry out point mutation in the present invention experiment,, carry out conventional PCR method and increase, and carry out conventional molecular cloning method screening and obtain required plasmid to the synthetic a pair of primer in each site to be suddenlyd change.Final plasmid verifies that through order-checking the result meets the requirement of experimental design.

Four pairs of required in mutation process mutant primer sequences are following:

855F：tgcccgctttccaagcttgaaacctgtcgtgccagctgcattaatga；

855R：gcacgacaggtttcaagcttggaaagcgggcagtgagcgcaacgca；

1359F：aggtcgttcgctccaagcttggctgtgtgcacgaaccccccgt；

1359R：ggggttcgtgcacacagccaagcttggagcgaacgacctacaccga；

1858F：tctaaagtatatatgagtaagcttggtctgacagttaccaatgctt；

1858R：tggtaactgtcagaccaagcttactcatatatactttagattgattt；

2858F：cccgaaaagtgaagcttgacgcgccctgtagcggcg；

2858R：cagggcgcgtcaagcttcacttttcggggaaatgtgcgcgga。

The MCS of ii sudden change pTZ19R carrier, aagctt makes cagctt into sequence, removes the HindIII of MCS.

Iii. suddenly change successively other sites on the pTZ19R carrier, 1858:aaactt → aagctt, 1359:aagctg → aagctt, 855:agtcgg → aagctt, 2858:ccacct → aagctt.

Iv. pass through top four site mutation, the bearer number of acquisition is 250-3.Its nucleotide sequence is shown in SEQ ID NO:1 in the sequence table.

D) make up the insertion fragment

Insert fragment and be basis with the Lambda dna sequence dna, the sequence that the method through point mutation obtains expecting, and with this sequence clone to the pGH carrier of using always.Its nucleotide sequence is shown in SEQ IDNO:2 in the sequence table.

E) preparation of whole carrier

Adopt the routine operation of molecular cloning, the fragment that the carrier of reincarnate is good with sudden change is connected with two sites of KpnI and XhoI, transforms, and screening finally obtains needed whole carrier pTZ19R-250.Its nucleotide sequence is shown in SEQ ID NO:3 in the sequence table.The structure schematic flow sheet of pTZ19R-250 carrier is seen Fig. 1, and the structure iron of pTZ19R-250 is seen Fig. 3.

F) structure of carrier 2:pUCS1-2k-750

PUCS1 carrier 2023bp is long, is to serve as that the basis is removed unnecessary sequence transformation and formed with the pUC18 carrier.Concrete construction process is a method of taking conventional sudden change, is the basis with the pUC18 carrier, a pair of primer pUCS1F:aggatccgtcgactctagaactagtagaggcggtttgcgtattgggcgc tc below using; PUCS1R:tctcgagaggcgcgcctctgcaggaatggtttcttagacgtcagg increases, and obtains the fragment of 2kb; Amplified production is handled through phosphorylation, connects certainly, transforms then; Screen, obtain the carrier of needs, and confirm through sequence measurement.The nucleotide sequence of pUCS1 carrier is shown in SEQ IDNO:5 in the sequence table.

PUCS1-2k-750 is the basis with vectorette pUCS1, the suitable fragment that increases, and connection is inserted in the pUCS1 carrier, finally obtains the pUCS1-2k-750 carrier.PUCS1-2k-750 carrier size 5.0kb, main characteristic is the HindIII restriction enzyme site that comprises 5 specific sites.The constructing plan and the pTZ19R-250 of this carrier are similar, all take conventional Protocols in Molecular Biology to make up, and omit concrete construction step at this.The nucleotide sequence of pUCS1-2k-750 is shown in SEQ ID NO:4 in the sequence table.PUCS1-2k-750 vector construction schematic flow sheet is seen Fig. 2, and the structure iron of pUCS1-2k-750 is seen Fig. 4.

2, the optimization of working condition

G) plasmid preparation

Carrier pTZ19R-250 that builds and pUCS1-2k-750 adopt conventional experimental technique to carry out the preparation of DNA.The scheme of taking the Routine Test Lab triangular flask to shake bacterium contains the engineering bacteria of required plasmid and cultivates.These two kinds of plasmids are the high yield plasmid, adopt conventional scheme to carry out the plasmid preparation, and average every liter of culture bacteria liquid can prepare the plasmid of 5～10mg.Adopt the enlarged culturing volume or take the method for fermentation culture, also can carry out more massive preparation.In this work, plasmid extracts takes centrifugal column type plasmid to prepare test kit (JaRa is biological) in a large number, and preparation flow is succinct, and the plasmid quality of being extracted is enough high, can satisfy the requirement that follow-up enzyme cut is done.

H) enzyme is cut

Adopted the most frequently used HindIII restriction enzyme in this structure, price is enough cheap, and activity guarantees to some extent.The average every 264bp of pTZ19R-250 comprises a HindIII site, and preferred average enzyme is cut the HindIII restriction endonuclease of 1 μ g plasmid with 4 units.The average every 1000bp of pUCS1-2k-750 comprises a HindIII, and through optimizing, average enzyme is cut the HindIII restriction endonuclease of 1 μ g plasmid with 1 unit.Qualified through electrophoresis detection.

I) purifying

Enzyme is cut product and is carried out purifying through the post affinity chromatography, and products therefrom is dissolved among an amount of TE, is used for the preparation of finished product DNA Marker after quantitatively.

3, the preparation scheme of finished product

J) calculate through theoretical, pTZ19R-250 after the HindIII enzyme is cut, 100bp, 250bp, 500bp, the segmental content of 1kb equates.The segmental mass ratio of 750bp fragment and 2kb is 3: 2 among the pUCS1-2k-750.

K) with pTZ19R-250 and two plasmid enzyme restrictions of pUCS1-2k-750, purifying.Mix with pTZ19R-250 and pUCS1-2k-750 two plasmid certain mass ratio then.This mass ratio can be 2.5: 1～1.5: 1.Best is 1.9: 1, can guarantee that the band of 2kb is identical with the concentration of the band of 1kb, and the dosage band of Theoretical Calculation 750bp is 2.25 times of other band concentration like this.Because this DNAMarker has only 6 bands, such add bright concentration and can accept.More the DNA Marker of the multi-ribbon concentration that generally will add bright band is made 3 times of other bands or more more, so that outstandingly more add bright index strip.After adjusting concentration, the fragment that enzyme is cut is dissolved in 1xLoading Buffer, as finished product, can carry out quality examination, divides the packing delivery.Preferable in final product, make 100bp, 250bp, 500bp, 1kb, each band final concentration of 2kb is 10ng/ μ L, and the concentration of the band of 750bp is 22.5ng/ μ L, and Loading buffer is diluted to the concentration of 1x.

Emphasis of the present invention has solved output and batch stability problem in the conventional DNA Marker preparation; The engineering plasmid that makes up with Protocols in Molecular Biology separates preparation and enzyme to be cut and substitutes than every single band preparation DNA Marker of traditional P CR amplification, makes the quality of product and stability increase substantially.Plasmid with two high copy numbers among the present invention is the basis; Rely on this breadboard gene synthesis technology, ingenious two engineering plasmids, the empirical tests of having made up; These two plasmids all are high yield plasmids, and each HindIII site of design all can be carried out enzyme fully and cut.After suitable optimization, the plasmid that average 1L bacterium liquid is extracted can be handled the finished product DL2000 product that obtains more than 200.The product batches differences of gained is minimum, and product is highly stable.In 1xLoading buffer, product of the present invention is as long as can reach enough stability in the normal temperature placement, and this will bring very big accessibility to routine experimentation work.

Further specify the present invention with embodiment below, but the present invention is not limited.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

The Fixedpoint mutation modified carrier of embodiment 1PCR method

Experimental technique: the mutation method of employing is operated according to sudden change scheme general on the molecular biology, and these schemes have been very sophisticated, and has the reagent corresponding box can supply to select for use.Adopt the most sophisticated PCR method to carry out point mutation in the present invention experiment,, carry out conventional PCR method and increase, and carry out conventional molecular cloning method screening and obtain required plasmid to the synthetic a pair of primer in each site to be suddenlyd change.Final plasmid verifies that through order-checking the result meets the requirement of experimental design.Here specifically narrate with the point mutation in 855 sites of pTZ19R carrier, the point mutation process of other positions is just the same, and just the primer with correspondence position gets final product.

All from the personal usually reagent in laboratory, these reagent Routine Test Labs also possess for used primer synthetic, other related reagents, and except that specifying, used reagent does not have particular requirement.

The primer sequence that 855 positions are to be suddenlyd change is following:

855F：tgcccgctttccaagcttgaaacctgtcgtgccagctgcattaatga；

855R：gcacgacaggtttcaagcttggaaagcgggcagtgagcgcaacgca。

PCR system: (50 μ l)

Each 10pmole of 855F/855R primer, dNTP 200 μ M, pfu:3 unit, template: 50ng, whole system is carried out in 1x pfu damping fluid.

The pcr amplification condition: 94 ℃ 20 seconds, 60 ℃ 20 seconds, 72 ℃ 3 minutes, totally 15 circulations.

It should be noted that and selecting extension during the time, select the suitable time according to the performance and the template length of the pfu enzyme of being selected for use.Pfu enzyme used in this experiment can reach 1kb/ minute amplification rate, and template length 2.9kb is so use 3 minutes extension time here.

It is basic identical that the PCR method is carried out the operation that fragment makes up, as long as do experiment according to the corresponding primer of needed sequences Design, no longer is elaborated here.

Follow-up enzyme is cut processing: after the PCR product cooling of amplification gained, add 1 μ l DpnI restriction endonuclease, 37 ℃ 30 minutes.

The transformation and selection operation:

The PCR product of handling well is got 5 μ l carry out conventional conversion operation, concrete operations are following:

1.100 μ l bacillus coli DH 5 alpha competent cell places on ice, gently cell is evenly suspended after thawing fully.

2. add 5 μ l PCR products, mixing was placed 20 minutes on ice gently.

3.42 degree water-bath heat shock 60 seconds was placed 2 minutes on ice.

4. add 500 μ l SOC substratum, 37 degree 200-300rpm concussions were cultivated 1 hour.

5. bacterium is coated on the preprepared Amp flat board.

6. flat board is inverted overnight cultures under 37 degree.

Screening:

From the suitable bacterial plaque of picking on the flat board of cultivating that spends the night, carry out plasmid with the LB culture medium culturing and extract.The plasmid that extracts detects with suitable experimental technique takes positive colony, and the plasmid that finally obtains expecting through sequence verification.

Embodiment 2 whole vector constructions

PTZ19R-250 makes up:

Enzyme is cut carrier and fragment:

DNA～1μg

10xBamHI ⁺buffer?5μl

KpnI：1μl(10u/μl)

XhoI：1μl(10u/μl)

DdH ₂O complements to 50 μ l

TV: 50 μ l

Enzyme was cut about 2 hours, after enzyme to be detected cuts entirely, reclaimed test kit with glue and reclaimed corresponding vectors and fragment, did connection.The specification sheets that concrete operations step reference reagent box is provided gets final product.

Ligation:

Carrier :～100ng

Fragment: 100-200ng

10x?T4DNA?buffer?1.5μl

T4DNA?ligase?1μl(5u/μl)

DdH2O complements to 15 μ l

TV: 15 μ l

Connect more than 1 hour, get 5 μ l and connect product transformed into escherichia coli DH5 α competent cell, operation steps is identical with the step of converting in the PCR method rite-directed mutagenesis.

Reformer plate is chosen bacterium extraction plasmid and is identified, obtains needed engineering bacteria carrier.

The complete same pTZ19R-250 of the construction process of pUCS1-2k-750 just changes corresponding vectors into and fragment gets final product.

Transform the positive transformant that the back Screening and Identification obtains, promptly contain the engineering bacteria and the engineering bacteria that contains the pUCS1-2k-750 carrier of pTZ19R-250 carrier.

The amplification and the extraction of embodiment 3 plasmids

Engineering bacteria is cultivated:

The 250mL substratum meets bacterial classification 200 μ L, shakes bacterium 12-14 hour at a high speed.Substratum adopts 2xYT high-yield culture medium (every liter contains the 16g peptone, 10g yeast powder, 5g NaCl).

Plasmid extracts:

1. receive bacterium: in the 50ml round bottom centrifuge tube, pour 3/4 pipe bacterium liquid into, the centrifugal 5min of 1500g abandons supernatant.Receive 2 times bacterium.Half a minute on the back-off thieving paper.Receive the about 60mL of bacterium for twice altogether.

2. add Sol I: add 6ml sol I, vortex oscillation is uniformly dispersed thalline.

3. add Sol II: add 10ml sol II, tenderness is put upside down 5～10 times.

4. add Sol III: add 7ml sol III, first tenderness is put upside down 3 times, firmly sways again, makes abundant mixing.Leave standstill 5min.

5. the centrifugal 7min of protein precipitation: 10000rpm.

6. cross the leaching supernatant: be folded into funnel-form with one deck lens wiping paper, supernatant is filtered in the clean 50ml round bottom centrifuge tube.

7. add Virahol: add the 13ml Virahol, shake up, place 20min for-20 ℃.

8. the centrifugal 10min of deposition DNA: 12000rpm abandons supernatant, back-off half a minute on the thieving paper.During centrifugation, attention will be managed end marked, then mark upwards placed, and the back is located washing precipitation with emphasis at this.

9. washing precipitation: add 10ml 75% ethanol, the centrifugal 5min of 12000rpm abandons supernatant.Back-off is half a minute on thieving paper.37 ℃ or 50 ℃ of oven dry.

10. solute grain: every pipe adds 2ml TE damping fluid, fully blows place of settling with the 1mL rifle, is placed on 37 ℃ then and fully dissolves in 5 minutes.

11. just the upgrading grain carries out electrophoresis detection, estimates the extraction situation, is used for follow-up enzyme cut then and does.

Obtain pTZ19R-250DNA and pUCS1-2k-750DNA.

The extensive enzyme of HindIII of embodiment 4 plasmids is cut (50mL system)

(whole enzyme is cut concentration to pTZ19R-250DNA:5mg: 100ng/ μ L)

10xBuffer?R 5mL

HindIII:10000～20000 units needs to add suitable amount according to the activity of every crowd of HindIII

Distilled water: complement to 50mL

TV: 50mL

Enzyme is cut 3 to 6 hours time, and middle sampling detects, and after the affirmation enzyme cut entirely ,-20 ℃ of preservations were to be purified.

PUCS1-2k-750 enzyme butt case is identical with pTZ19R-250, just with the amount of HindIII reduce to 1/4 can cut complete.

Embodiment 5 post affinity chromatography plasmid purification enzymes are cut product

In this experiment the enzyme of two plasmids is cut product and carry out whole purifying, be about to 5 fragments that pTZ19R-250 will cut purifying together, with two fragments that pUCS1-2k-750 cut purifying together.Each fragment of each plasmid enzyme restriction gained needn't be earlier separately purifying come out, so not only bothered but also there is no need.Be exactly and purifying also has each segmental ratio of a benefit to remain unchanged together, total the DNA that calculates like this amount just can be extrapolated each segmental amount.

The purpose of purifying is that the composition of non-DNA is all got rid of, and guarantees to obtain the purest DNA.

The post affinity chromatography adopts the pillar of Qiagen tip 100000 to carry out purifying, Qiagen order catalog number (Cat.No.): 12191.The pillar capacity is 10mg.

The concrete operations flow process is (more detailed step and each solution situation can with reference to Qiagen related kit handbook) as follows:

1, with QBT solution 75ml balance pillar for use.

2, sample absorption: will detect the enzyme of confirming and cut product and cut 1: 5 ratio of product and QBT solution according to enzyme and mix, and join the good pillar of balance and carried out post and adsorb, the volume of pillar maximum is 140ml, can carry out multiple adsorb when volume is big.

3, rinsing: the usefulness QC solution of 600mL is altogether carried out rinsing, and other impurity are washed off.

4, wash-out: the pillar that rinsing is good carries out wash-out with the QF solution of 100mL, and DNA is washed from pillar.

5, deposition:

A) elutriant is added 70mL Virahol (0.7 times of supernatant volume) and mix, precipitation at room temperature 20 minutes,

B) with the cf-of 12000g centrifugal 20 minutes, carefully outwell supernatant,

C) once, centrifugal 10 minutes of 12000g carefully outwells supernatant with 20ml 70% washing with alcohol,

D) inhale and to remove remaining liquid,, be used for follow-up work according to the amount of DNA TE solution dissolving DNA with proper volume.

6, detect quantitatively:

A) DNA of gained suitably carries out the OD value measurement of 260nm after the dilution, and is converted into DNA concentration.Convenient for ease of subsequent operations, the sample concentration unification is adjusted to 500ng/ μ l preserves.

B) according to the DNA concentration of being surveyed, carry out electrophoresis detection again, further examine concentration and the band quality of gained DNA.

C) DNA that obtains carries out record, and is for use in-20 ℃ of preservations.

The preparation of embodiment 6 finished products

With the concentration of gained among the embodiment 5 is that the sample of 500ng/ μ l is the preparation of raw material finished product.With preparation 100ml finished product is example, and its preparation program is following:

5xLoading buffer forms:

10mM Tris.HCl (pH7.6), 10mM EDTA, 0.03% YLENE cyanines, 0.03% tetrabromophenol sulfonphthalein, 30% glycerine.

Every batch of DL2000 finished product for preparing is carried out record, takes out the Detection of Stability that small portion carries out electrophoresis detection and room temperature.

Electrophoresis detection: get the sample 4 μ l that prepare, 5 μ l, 6 μ l and standard model 5 μ l carry out 1.2% agarose electrophoresis simultaneously, and electrophoresis is used the 1xTAE damping fluid, direct viewing and Taking Pictures recording on the glue face.Electrophorogram is seen Fig. 5.It is thus clear that each band brightness is consistent with standard model.And electrophoretic band is clear, and the bar interband does not have assorted band, no background.Such sample can be delivered.

Room temperature stability detects: with every batch of finished product for preparing, get small portion and be placed on room temperature and 37 ℃, at 3 days, in 1 week, detect respectively on two all time points.Detected result shows that the product batches differences of gained is minimum, and product is highly stable.In 1xLoading buffer, can reach enough stability as long as place product at normal temperature.

Carry out the packing of finished product then, be distributed into every finished product DL2000 of 0.5ml.Obtain the finished product DL2000 product more than 200 after the plasmid packing that average 1L bacterium liquid is extracted.

Should be understood that after having read foregoing of the present invention those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Claims (10)

1. a method for preparing DL2000 dna molecular amount standard is characterized in that, adopts the plasmid enzyme restriction method, may further comprise the steps:

(1) the DL2000DNA molecular weight standard comprises 6 dna fragmentation: 100bp, 250bp, 500bp; 750bp, 1kb, 2kb; With increasing in these 6 fragment allocation to two carriers; And make them in carrier, have specific copy number, wherein these 6 segmental distribution and copy number are specific as follows: comprise fragment 100bp in the carrier 1, copy number 10; Fragment 250bp, copy number 4; Fragment 500bp, copy number 2; Fragment 750bp, copy number 1; With fragment 1kb, copy number 1; Comprise 2kb in the carrier 2, copy number 1; With fragment 750bp, copy number 4;

(2) carrier 1 and carrier 2 usefulness restriction enzymes are carried out enzyme and cut, mix then, promptly get.

2. the method for claim 1 is characterized in that, carrier 1 is genetically engineered plasmid pTZ19R-250, and Nucleotide is shown in SEQ ID NO:3 in the sequence table; Carrier 2 is genetically engineered plasmid pUCS1-2k-750, and Nucleotide is shown in SEQ ID NO:4 in the sequence table.

3. method as claimed in claim 2 is characterized in that used restriction enzyme is HindIII.

4. the method for claim 1 is characterized in that, the blending ratio that the enzyme of pTZ19R-250 and pUCS1-2k-750 is cut product is 2.5: 1～1.5: 1, and described ratio is the mass ratio of pTZ19R-250 and two plasmids of pUCS1-2k-750.

5. the method for claim 1 is characterized in that, the blending ratio that the enzyme of pTZ19R-250 and pUCS1-2k-750 is cut product is 1.9: 1, and described ratio is the mass ratio of pTZ19R-250 and two plasmids of pUCS1-2k-750.

6. the method for claim 1 is characterized in that, after enzyme is cut in the step (2), adopts post affinity chromatography purifying, remix.

7. the DL2000DNA molecular weight standard for preparing like each described method of claim 1～6.

8. the application of DL2000DNA molecular weight standard as claimed in claim 7 in agarose gel electrophoresis.

9. genetically engineered plasmid pTZ19R-250, Nucleotide is shown in SEQ ID NO:1 in the sequence table.

10. genetically engineered plasmid pUCS1-2k-750, Nucleotide is shown in SEQ ID NO:2 in the sequence table.

Images