CN102304508B - Method for preparing DL2000 DNA molecular weight marker as well as product and applications thereof - Google Patents

Abstract

The invention discloses a method for preparing a DL2000 DNA molecular weight marker. The method is characterized by adopting a plasmid enzyme-cut method comprising the following steps of: (1) firstly distributing six fragments to two carriers for amplification, wherein the DL2000 DNA molecular weight marker comprises the six DNA fragments as follows: 100bp, 250bp, 500bp, 750bp, 1kb and 2kb; the carrier 1 comprises the fragment 100bp with the copy number 10, the fragment 250bp with the copy number 4, the fragment 500bp with the copy number 2, the fragment 750bp with the copy number 1, and the fragment 1kb with the copy number 1; and the carrier 2 comprises 2kb with the copy number 1 and the fragment 750bp with the copy number 4; and (2) carrying out enzyme-cutting on the carrier 1 and the carrier 2 by restriction enzyme, and then mixing, thus the molecular weight marker is obtained. According to the invention, the brightness of each belt in the product obtained finally is uniform, the molecular weight marker is convenient to produce, and is convenient for large scale production, and the quality of each batch is stable.

Description

A kind of method for preparing DL2000 dna molecular amount standard and products thereof and application

Technical field

The invention belongs to bioengineering field, particularly a kind of method for preparing the DL2000DNA molecular weight standard and products thereof and application.

Background technology

Dna molecular amount standard is commonly called as DNA Marker, is that the dna fragmentation by a series of known length mixes, and is a kind of reagent the most frequently used in the molecular biology experiment.Dna fragmentation and DNAMarker by gained in will testing carry out electrophoresis in the same sepharose, by sample fragment and DNA Marker are compared, just can roughly estimate the size of the dna fragmentation of experiment gained.

Each band of DNA Marker has two kinds to prepare scheme usually: pcr amplification and digested plasmid.

The scheme of pcr amplification designs exactly many cover PCR primers and increases, and obtains the dna fragmentation of corresponding size.And then each fragment carried out purifying, quantitatively.In proportion each fragment is mixed at last, just obtained required product.The standby DNA Marker of pcr amplification legal system exists larger defective, and the one, the volume of amplification has certain restriction.Present each Kongzui of PCR instrument volume that increases can not surpass 70 microlitres more, take PCR instrument 96 holes as example, at most once can increase 7 milliliters.Larger amount increases the PCR instrument with regard to needs and repeatedly increases.The 2nd, pcr amplification is subjected to multiple condition influence larger, such as instrument, and template, enzyme is used in amplification, the primer of different batches, and other reagent, therefore different amplification batch differences can be larger.The 3rd, the success ratio of pcr amplification is relatively low, and the band that has the more time to increase may have assorted band, or the target stripe specificity is not too strong, and the band that increases is wider, or the amplification productive rate is lower, and other unsuccessful situation.

The method of conventional plasmid enzyme restriction, because band brightness and its size of DNA have proportional relationship, its brightness may have larger difference after each fragment enzyme was cut in a plasmid, large fragment is brighter than small segment.Therefore can cause brightness irregularities between each band of prepared finished product.

Dna molecular amount standard is a kind of reagent the most frequently used in the Molecular Biology Lab, and belongs to the product of consumption-type, and the market consumption is very large.And the dna molecular amount standard of DL2000 type, by 100bp, 250bp, 500bp, 750bp (highlighting as index strip), 1kb, 2kb totally 6 dna fragmentations form.It is to use to get most convenient in the laboratory, also is to use maximum a kind of products, and consumption is very large.Many companies have similar product to sell.Owing to comprised the small pieces segment DNA in this dna molecular amount standard, many companies all adopt the scheme of PCR to carry out the product preparation.Because need to consume a large amount of manpower and PCR instrument in the PCR production, and adopt the scheme efficient of pcr amplification low especially as this very little dna fragmentation of 100bp, each band after the amplification all needs to carry out purifying, and quantitatively.And then band is prepared adjustment one by one, obtains final product.Thereby can exist than big difference between the different batches in the pcr amplification, and very labor intensive and reagent, Production Flow Chart is difficult to stdn.

Summary of the invention

The preparation method's process that the present invention is directed to existing DL2000DNA molecular weight standard is loaded down with trivial details, unstable quality, the deficiency that is difficult to scale operation, provide a kind of new preparation DL2000 type dna molecular amount standard method and products thereof and use, it is convenient for production, can be mass-produced steady quality between each batch, each condition brightness homogeneous of DL2000DNA molecular weight standard.

The present invention has solved the problems referred to above by following technical proposals:

The first technical scheme of the present invention is: a kind of method of the DL2000DNA of preparation molecular weight standard, adopt the plasmid enzyme restriction method, may further comprise the steps: (1) DL2000DNA molecular weight standard comprises 6 dna fragmentation: 100bp, 250bp, 500bp, 750bp, 1kb, 2kb, to increase in these 6 fragment allocation to two carriers, and make them have specific copy number in carrier, wherein the distribution of these 6 fragments and copy number are specific as follows: comprise fragment 100bp in the carrier 1, copy number 10; Fragment 250bp, copy number 4; Fragment 500bp, copy number 2; Fragment 750bp, copy number 1; With fragment 1kb, copy number 1; Comprise 2kb in the carrier 2, copy number 1; With fragment 750bp, copy number 4; (2) carrier 1 and carrier 2 usefulness restriction enzymes are carried out enzyme and cut, then mix, and get final product.

Wherein, can take the plasmid enzyme restriction method of this area routine in the step (1), make the dna fragmentation that comprises each copy number in the carrier, be restriction enzyme digestion sites between the dna fragmentation.After the carrier amplification, use the digestion with restriction enzyme carrier, namely obtain the dna fragmentation of each copy number.These fragments are mixed, namely get DL2000DNA molecular weight standard of the present invention.Wherein, the carrier of use can be the conventional carrier in this area, such as plasmid etc.Described carrier 1 is genetically engineered plasmid pTZ19R-250 preferably, and Nucleotide is shown in SEQ ID NO:3 in the sequence table; Carrier 2 is genetically engineered plasmid pUCS1-2k-750 preferably, and Nucleotide is shown in SEQ ID NO:4 in the sequence table.Restriction enzyme site among pTZ19R-250 and the pUCS1-2k-750 between the dna fragmentation is Hind III.Also can be other this areas restriction enzyme sites commonly used, preferred Hind III.PTZ19R-250 and pUCS1-2k-750 are carried out enzyme with restriction endonuclease Hind III respectively to be cut; Then, the enzyme of pTZ19R-250 and pUCS1-2k-750 is cut product after electrophoresis detection is qualified, adopts the affinity column chromatography method to carry out purifying, mixes again, blending ratio is preferably take pTZ19R-250 and pUCS1-2k-750 two plasmid mass ratioes as 2.5:1 ~ 1.5:1, and that best is 1.9:1.Amount with 1.9:1 is mixed, and can guarantee that the concentration of the band of 1kb equates with the concentration of the band of 2kb.

The second technical scheme of the present invention is: by the DL2000DNA molecular weight standard of the method for the invention described above preparation.

The 3rd technical scheme of the present invention is: the application of aforesaid DL2000DNA molecular weight standard of the present invention generally is used for agarose gel electrophoresis.

The 4th technical scheme of the present invention is: a kind of genetically engineered plasmid pTZ19R-250, Nucleotide is shown in SEQ ID NO:3 in the sequence table.

The 5th technical scheme of the present invention is: a kind of genetically engineered plasmid pUCS1-2k-750, Nucleotide is shown in SEQ ID NO:4 in the sequence table.

Main points of the present invention and advantage are as follows:

1, makes up special plasmid, wherein each band is done corresponding copy adjustment, make it that concentration is more reasonable each other.The plasmid that extracts has directly just obtained every needed ratio of dna fragmentation after enzyme is cut, needn't also need carefully to carry out the concentration adjustment between each band as the PCR gained.

2, the work of PCR is changed into the extraction of DNA plasmid and the enzyme of DNA is cut operation.The stdn of producing and the extension of scale are convenient in such conversion in actual production, pcr amplification is limited to the larger difference between the volume of each amplification and each amplification batch, and mortality is higher, is not easy mass-producing and extension.

3, because plasmid extraction and enzyme are cut operation is very ripe molecular biology operation, and very easy expansion scale, the quality control of the column criterion of going forward side by side, therefore the present invention can carry out the production of dna molecular amount standard in enormous quantities, and guarantees to have between each batch almost completely consistant mass standard.

Description of drawings

Below in conjunction with description of drawings feature of the present invention and beneficial effect.

Fig. 1 is pTZ19R-250 vector construction schema.

Fig. 2 is pUCS1-2k-750 vector construction schema.

Fig. 3 is pTZ19R-250 carrier structure figure.

Fig. 4 is pUCS 1-2k-750 carrier structure figure.

Fig. 5 is 1.2% agarose electrophoresis figure of DL2000DNA molecular weight standard product of the present invention.

Embodiment

The inventor is implemented in the different dna fragmentation of 6 length that comprises in the DL2000DNA molecular weight standard respectively in two carriers, directly use restriction enzyme digestion after this two carriers amplification, after enzyme cut product and mix, just obtained the DL2000DNA molecular weight standard that formed by these 6 different lengths dna fragmentations, and only as long as adjust the blending ratio of two plasmids, just can make 5 band brightness of the DL2000DNA molecular weight standard that obtains consistent, index strip (750bp) brightness is the twice of other band, clearly shows every band in electrophoresis.Embodiment is as follows:

1, the structure of two carrier DNAs

A) summation

Among the present invention two carriers all with the very high commodity carrier pTZ19R(of output available from Fermentas life sciences, catalog number: SD0141) be the basis, adopt conventional experimental technique, carry out suitable point mutation operation, and from the suitable fragment of Lambda DNA amplification, the point mutation of making series makes up basic fragment.Then the carrier of basic fragment and sudden change being transformed links to each other and makes up final carrier.

B) distribution of 6 fragments

Carrier 1:pTZ19R-250 comprises 100bp*10,250bp*4,500bp*2,750bp*1,1kb*1.

Carrier 2:pUCS1-2k-750 comprises 2kb*1,750bp*4.

The copy number of fragment in carrier that wherein represents this length behind the asterisk *.

C) sudden change skeleton carrier

I. experimental technique: the mutation method of employing operates according to sudden change scheme general on the molecular biology, and these schemes have been very ripe, and has the corresponding test kit can be for selecting.Adopt the most ripe PCR method to carry out point mutation in the present invention experiment, for the synthetic pair of primers in each site to be suddenlyd change, carry out conventional PCR method and increase, and carry out conventional molecular cloning method screening and obtain required plasmid.Final plasmid carries out the requirement that the result meets experimental design by order-checking.

Four pairs of required in mutation process mutant primer sequences are as follows:

855F:tgcccgctttccaagcttgaaacctgtcgtgccagctgcattaatga；

855R:gcacgacaggtttcaagcttggaaagcgggcagtgagcgcaacgca；

1359F:aggtcgttcgctccaagcttggctgtgtgcacgaaccccccgt；

1359R:ggggttcgtgcacacagccaagcttggagcgaacgacctacaccga；

1858F:tctaaagtatatatgagtaagcttggtctgacagttaccaatgctt；

1858R:tggtaactgtcagaccaagcttactcatatatactttagattgattt；

2858F:cccgaaaagtgaagcttgacgcgccctgtagcggcg；

2858R:cagggcgcgtcaagcttcacttttcggggaaatgtgcgcgga。

Ii. the suddenly change multiple clone site of pTZ19R carrier makes sequence aagctt into cagctt, removes the HindIII of multiple clone site.

Iii. suddenly change successively other sites on the pTZ19R carrier, 1858:aaactt → aagctt, 1359:aagctg → aagctt, 855:agtcgg → aagctt, 2858:ccacct → aagctt.

Iv. pass through the sudden change in top four sites, the bearer number of acquisition is 250-3.Its nucleotide sequence is shown in SEQ ID NO:1 in the sequence table.

D) make up Insert Fragment

Insert Fragment is take the Lambda dna sequence dna as the basis, the sequence that the method by point mutation obtains expecting, and with this sequence clone to pGH carrier commonly used.Its nucleotide sequence is shown in SEQ ID NO:2 in the sequence table.

E) preparation of whole carrier

Adopt the routine operation of molecular cloning, with carrier and the good fragment of sudden change of reincarnate, are connected a site with XhoI with KpnI and connect, transform, screen, finally obtain needed whole carrier pTZ19R-250.Its nucleotide sequence is shown in SEQ ID NO:3 in the sequence table.PTZ19R-250 Vector construction schematic flow sheet is seen Fig. 1, and the structure iron of pTZ19R-250 is seen Fig. 3.

F) structure of carrier 2:pUCS1-2k-750

PUCS1 carrier 2023bp is long, is to remove unnecessary sequence transformation take the pUC18 carrier as the basis to form.Concrete construction process is the method for taking conventional sudden change, take the pUC18 carrier as the basis, with following pair of primers pUCS1F:aggatccgtcgactctagaactagtagaggcggtttgcgtattgggcgc tc, pUCS1R:tctcgagaggcgcgcctctgcaggaatggtttcttagacgtcagg, increase, obtain the fragment of 2kb, amplified production connects certainly through phosphatizing treatment, then transform, screen, obtain the carrier of needs, and confirm through sequence measurement.The nucleotide sequence of pUCS1 carrier is shown in SEQ ID NO:5 in the sequence table.

PUCS1-2k-750 take vectorette pUCS1 as the basis, the suitable fragment that increase, the connection be inserted in the pUCS1 carrier, finally obtain the pUCS1-2k-750 carrier.PUCS1-2k-750 carrier size 5.0kb, main feature is the HindIII restriction enzyme site that comprises 5 specific sites.This Vector construction scheme and pTZ19R-250 are similar, all take conventional Protocols in Molecular Biology to make up, and omit concrete construction step at this.The nucleotide sequence of pUCS1-2k-750 is shown in SEQ ID NO:4 in the sequence table.PUCS1-2k-750 vector construction schematic flow sheet is seen Fig. 2, and the structure iron of pUCS1-2k-750 is seen Fig. 4.

2, the optimization of working condition

G) plasmid preparation

The carrier pTZ19R-250 that builds and pUCS1-2k-750 adopt conventional experimental technique to carry out the preparation of plasmid DNA.The scheme of taking the Routine Test Lab triangular flask to shake bacterium contains the recombinant of required plasmid.These two kinds of plasmids are the high yield plasmid, adopt conventional scheme to carry out the plasmid preparation, cultivate the plasmid that bacterium liquid can prepare 5 ~ 10mg for average every liter.Adopt the enlarged culturing volume or take the method for fermentation culture, also can carry out more massive preparation.In this work, plasmid extraction takes centrifugal column type plasmid to prepare in a large number test kit (JaRa is biological), and preparation flow is succinct, and the plasmid quality of extracting is enough high, can satisfy the requirement that follow-up enzyme cut is done.

H) enzyme is cut

Adopted the most frequently used HindIII restriction enzyme in this structure, price is enough cheap, and activity guarantees to some extent.The average every 264bp of pTZ19R-250 comprises a HindIII site, and preferred average enzyme is cut 1 μ g plasmid with the HindIII restriction endonuclease of 4 units.The average every 1000bp of pUCS1-2k-750 comprises a HindIII, and through optimizing, average enzyme is cut 1 μ g plasmid with the HindIII restriction endonuclease of 1 unit.Qualified through electrophoresis detection.

I) purifying

Enzyme is cut product and is carried out purifying through the post affinity chromatography, and products therefrom is dissolved among an amount of TE, is used for the preparation of finished product DNA Marker after quantitatively.

3, the preparation scheme of finished product

J) calculate through theory, pTZ19R-250 after the HindIII enzyme is cut, 100bp, 250bp, 500bp, the content of 1kb fragment equates.The mass ratio of 750bp fragment and 2kb fragment is 3:2 among the pUCS1-2k-750.

K) with pTZ19R-250 and two plasmid enzyme restrictions of pUCS1-2k-750, purifying.Then mix with pTZ19R-250 and the certain mass ratio of pUCS1-2k-750 two plasmids.This mass ratio can be 2.5:1 ~ 1.5:1.That best is 1.9:1, can guarantee that the band of 2kb is identical with the concentration of the band of 1kb, and the dosage band of Theoretical Calculation 750bp is 2.25 times of other band concentration like this.Because this DNAMarker only has 6 bands, such highlight concentration and can accept.More the DNAMarker of the multi-ribbon concentration that generally will add bright band is made 3 times of other bands or more more, so that the more outstanding index strip that highlights.After adjusting concentration, the fragment that enzyme is cut is dissolved in 1xLoading Buffer, as finished product, can carry out quality examination, minute packing delivery.Better in final product, make 100bp, 250bp, 500bp, 1kb, each band final concentration of 2kb is 10ng/ μ L, and the concentration of the band of 750bp is 22.5ng/ μ L, and Loading buffer is diluted to the concentration of 1x.

Emphasis of the present invention has solved output and batch stability problem in the conventional DNA Marker preparation, cut every single preparation DNA Marker that is with of alternative more traditional pcr amplification with engineering plasmid separation preparation and enzyme that Protocols in Molecular Biology makes up, so that the quality of product and stability increase substantially.Among the present invention take the plasmid of two high copy numbers as the basis, rely on the gene synthesis technology in this laboratory, ingenious two engineering plasmids, the empirical tests of having made up, these two plasmids all are high yield plasmids, and each HindIII site of design all can be carried out fully enzyme and cut.After suitable optimization, the plasmid that average 1L bacterium liquid extracts can be processed the finished product DL2000 product that obtains more than 200.Difference is minimum between the product batches of gained, and product is highly stable.In 1xLoading buffer, product of the present invention is as long as can reach enough stability in the normal temperature placement, and this will be to bringing great convenience property of routine experimentation work.

The below further specifies the present invention with embodiment, but the present invention is not limited.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

The Fixedpoint mutation modified carrier of embodiment 1PCR method

Experimental technique: the mutation method of employing operates according to sudden change scheme general on the molecular biology, and these schemes have been very ripe, and has corresponding test kit can supply to select.Adopt the most ripe PCR method to carry out point mutation in the present invention experiment, for the synthetic pair of primers in each site to be suddenlyd change, carry out conventional PCR method and increase, and carry out conventional molecular cloning method screening and obtain required plasmid.Final plasmid carries out the requirement that the result meets experimental design by order-checking.Here specifically narrate with the point mutation in 855 sites of pTZ19R carrier, the point mutation process of other positions is just the same, and just the primer with correspondence position gets final product.

All from the usually personal reagent in laboratory, these reagent Routine Test Labs also possess for used primer synthetic, other related reagents, and except specifying, used reagent does not have particular requirement.

The primer sequence that 855 positions are to be suddenlyd change is as follows:

855F:tgcccgctttccaagcttgaaacctgtcgtgccagctgcattaatga；

855R:gcacgacaggtttcaagcttggaaagcgggcagtgagcgcaacgca。

PCR system: (50 μ l)

Each 10pmole of 855F/855R primer, dNTP 200 μ M, pfu:3 unit, template: 50ng, whole system is carried out in 1x pfu damping fluid.

The pcr amplification condition: 94 ℃ 20 seconds, 60 ℃ 20 seconds, 72 ℃ 3 minutes, totally 15 circulations.

It should be noted that and selecting extension during the time, select the suitable time according to performance and the template length of selected pfu enzyme.Pfu enzyme used in this experiment can reach 1kb/ minute amplification rate, and template length 2.9kb is so use 3 minutes extension time here.

It is basic identical that the PCR method is carried out the operation that fragment makes up, as long as do experiment according to the corresponding primer of needed sequences Design, no longer is elaborated here.

Follow-up enzyme is cut processing: after the PCR product cooling of amplification gained, add 1 μ l DpnI restriction endonuclease, 37 ℃ 30 minutes.

The transformation and selection operation:

The PCR product of handling well is got 5 μ l carry out conventional conversion operation, concrete operations are as follows:

1.100 μ l bacillus coli DH 5 alpha competent cell places on ice, gently cell is evenly suspended after thawing fully.

2. add 5 μ l PCR products, mixing was placed 20 minutes on ice gently.

3.42 degree water-bath heat shock 60 seconds was placed 2 minutes on ice.

4. add 500 μ l SOC substratum, 37 degree 200-300rpm concussions were cultivated 1 hour.

5. bacterium is coated on the preprepared Amp flat board.

6. flat board is inverted overnight incubation under 37 degree.

Screening:

From the suitable bacterial plaque of picking on the flat board of cultivating that spends the night, carry out plasmid extraction with the LB culture medium culturing.The plasmid that extracts detects with suitable experimental technique takes positive colony, and the plasmid that finally obtains expecting through sequence verification.

Embodiment 2 whole vector constructions

PTZ19R-250 makes up:

Enzyme is cut carrier and fragment:

DNA~1μg

10xBamHI ⁺buffer 5μl

KpnI:1μl(10u/μl)

XhoI:1μl(10u/μl)

DdH ₂ O complements to 50μ l

Cumulative volume: 50 μ l

Enzyme was cut about 2 hours, after enzyme to be detected cuts entirely, reclaimed test kit with glue and reclaimed corresponding carrier and fragment, did connection.The specification sheets that concrete operation step reference reagent box provides gets final product.

Ligation:

Carrier: ~ 100ng

Fragment: 100-200ng

10x T4DNA buffer 1.5μl

T4DNA ligase 1μl(5u/μl)

DdH2O complements to 15μ l

Cumulative volume: 15 μ l

Connect more than 1 hour, get 5 μ l and connect product conversion bacillus coli DH 5 alpha competent cell, operation steps is identical with the step of converting in the PCR method rite-directed mutagenesis.

Reformer plate is chosen bacterium extraction plasmid and is identified, obtains needed engineering bacteria carrier.

The complete same pTZ19R-250 of the construction process of pUCS1-2k-750 just changes corresponding carrier and fragment into and gets final product.

Transform the positive transformant that rear Screening and Identification obtains, namely contain the engineering bacteria and the engineering bacteria that contains the pUCS1-2k-750 carrier of pTZ19R-250 carrier.

Amplification and the extraction of embodiment 3 plasmids

Recombinant:

The 250mL substratum meets bacterial classification 200 μ L, shakes bacterium 12-14 hour at a high speed.Substratum adopts 2xYT high-yield culture medium (every liter contains the 16g peptone, 10g yeast powder, 5g NaCl).

Plasmid extraction:

1. receive bacterium: in the 50ml round bottom centrifuge tube, pour 3/4 pipe bacterium liquid into, the centrifugal 5min of 1500g abandons supernatant.Receive 2 times bacterium.Half a minute on the back-off thieving paper.Receive altogether the about 60mL of bacterium for twice.

2. add Sol I: add 6ml sol I, vortex oscillation is uniformly dispersed thalline.

3. add Sol II: add 10ml sol II, tenderness is put upside down 5 ~ 10 times.

4. add Sol III: add 7ml sol III, first tenderness is put upside down 3 times, firmly sways again, makes abundant mixing.Leave standstill 5min.

5. the centrifugal 7min of protein precipitation: 10000rpm.

6. cross the leaching supernatant: be folded into funnel-form with one deck lens wiping paper, supernatant is filtered in the clean 50ml round bottom centrifuge tube.

7. add Virahol: add the 13ml Virahol, shake up, place 20min for-20 ℃.

8. the centrifugal 10min of precipitation plasmid DNA: 12000rpm abandons supernatant, back-off half a minute on the thieving paper.During centrifugation, attention will be managed the end and be carried out mark, then mark upwards be placed, and the back is located washing precipitation with emphasis at this.

9. washing precipitation: add 10ml 75% ethanol, the centrifugal 5min of 12000rpm abandons supernatant.Back-off is half a minute on thieving paper.37 ℃ or 50 ℃ of oven dry.

10. solute grain: every pipe adds 2ml TE damping fluid, fully blows place of settling with the 1mL rifle, then is placed on 37 ℃ and fully dissolves in 5 minutes.

11. just the upgrading grain carries out electrophoresis detection, estimates the extraction situation, then is used for follow-up enzyme cut and does.

Obtain pTZ19R-250DNA and pUCS1-2k-750DNA.

The extensive enzyme of HindIII of embodiment 4 plasmids is cut (50mL system)

(whole enzyme is cut concentration to pTZ 19R-250DNA:5mg: 100ng/ μ L)

10xBuffer R 5mL

HindIII:10000 ~ 20000 units needs to add suitable amount according to the activity of every crowd of HindIII

Distilled water: complement to 50mL

Cumulative volume: 50mL

Enzyme is cut 3 to 6 hours time, and middle sampling detects, and after the affirmation enzyme cut entirely ,-20 ℃ of preservations were to be purified.

PUCS1-2k-750 enzyme butt case is identical with pTZ19R-250, just the amount of HindIII is reduced to 1/4 can cut complete.

Embodiment 5 post affinity chromatography plasmid purification enzymes are cut product

In this experiment the enzyme of two plasmids is cut product and carry out whole purifying, be about to together purifying of 5 fragments that pTZ19R-250 cuts, two fragments that pUCS1-2k-750 is cut are purifying together.Each fragment of each plasmid enzyme restriction gained needn't be first separately purifying out so not only bothered but also there is no need.Be exactly and purifying also has the ratio of each fragment of benefit to remain unchanged together, total the DNA that calculates like this amount just can be extrapolated the amount of each fragment.

The purpose of purifying is that the composition of non-DNA is all got rid of, and guarantees to obtain the purest DNA.

The post affinity chromatography adopts the pillar of Qiagen tip 100000 to carry out purifying, Qiagen order catalog number (Cat.No.): 12191.The pillar capacity is 10mg.

Concrete operations flow process following (more detailed step and each solution situation can with reference to Qiagen related kit handbook):

1, with the stand-by pillar of QBT solution 75ml balance.

2, sample absorption: will detect the enzyme of confirming and cut product and cut product according to enzyme and mix with the ratio of QBT solution 1:5, and join the good pillar of balance and carried out post and adsorb, the volume of pillar maximum is 140ml, can carry out multiple adsorb when volume is large.

3, rinsing: the usefulness altogether QC solution of 600mL is carried out rinsing, and other impurity are washed off.

4, wash-out: the pillar that rinsing is good carries out wash-out with the QF solution of 100mL, and DNA is washed from pillar.

5, precipitation:

A) elutriant is added 70mL Virahol (0.7 times of supernatant liquor volume) and mix, precipitation at room temperature 20 minutes,

B) with centrifugal 20 minutes of the centrifugal force of 12000g, carefully outwell supernatant liquor,

C) with 20ml 70% washing with alcohol once, centrifugal 10 minutes of 12000g carefully outwells supernatant liquor,

D) suck remaining liquid, according to the amount of the DNA TE solution dissolving DNA with proper volume, be used for follow-up work.

6, detect quantitatively:

A) DNA of gained suitably carries out the OD value measurement of 260nm after the dilution, and is converted into DNA concentration.Convenient for ease of subsequent operations, the sample concentration unification is adjusted to 500ng/ μ l preserves.

B) according to the DNA concentration of surveying, carry out again electrophoresis detection, further examine concentration and the band quality of gained DNA.

C) DNA that obtains makes a record, and is stand-by in-20 ℃ of preservations.

The preparation of embodiment 6 finished products

In the embodiment 5 concentration of gained as the sample of 500ng/ μ l as the preparation of raw material finished product.Take preparation 100ml finished product as example, its preparation program is as follows:

5xLoading buffer forms:

10mM Tris.HCl (pH7.6), 10mM EDTA, 0.03% dimethylbenzene cyanines, 0.03% tetrabromophenol sulfonphthalein, 30% glycerine.

Every batch of DL2000 finished product for preparing makes a record, and takes out the Detection of Stability that small portion carries out electrophoresis detection and room temperature.

Electrophoresis detection: get the sample 4 μ l that prepare, 5 μ l, 6 μ l and standard model 5 μ l carry out 1.2% agarose electrophoresis simultaneously, electrophoresis 1xTAE damping fluid, direct viewing and Taking Pictures recording on the glue face.Electrophorogram is seen Fig. 5.As seen each band brightness is consistent with standard model.And electrophoretic band is clear, and the bar interband is without assorted band, without background.Such sample can be delivered.

Room temperature stability detects: with every batch of finished product for preparing, get small portion and be placed on room temperature and 37 ℃, at 3 days, in 1 week, detect respectively on the time point in two weeks.Detected result shows that difference is minimum between the product batches of gained, and product is highly stable.In 1xLoading buffer, can reach enough stability as long as place product at normal temperature.

Then carry out the packing of finished product, be distributed into every finished product DL2000 of 0.5ml.Obtain the finished product DL2000 product more than 200 after the plasmid packing that average 1L bacterium liquid extracts.

Should be understood that after having read foregoing of the present invention, those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (6)

1. a method for preparing the DL2000DNA molecular weight standard is characterized in that, adopts the plasmid enzyme restriction method, may further comprise the steps:

(1) the DL2000DNA molecular weight standard comprises 6 dna fragmentation: 100bp, 250bp, 500bp, 750bp, 1kb, 2kb will increase in these 6 fragment allocation to two carriers, and makes them have specific copy number in carrier, wherein the distribution of these 6 fragments and copy number are specific as follows: carrier 1 is genetically engineered plasmid pTZ19R-250, its Nucleotide wherein comprises fragment 100bp shown in SEQ ID NO:3 in the sequence table, copy number 10; Fragment 250bp, copy number 4; Fragment 500bp, copy number 2; Fragment 750bp, copy number 1; With fragment 1kb, copy number 1; Carrier 2 is genetically engineered plasmid pUCS1-2k-750, and its Nucleotide wherein comprises 2kb shown in SEQ ID NO:4 in the sequence table, copy number 1; With fragment 750bp, copy number 4;

(2) carrier 1 and carrier 2 usefulness restriction enzyme Hind III are carried out enzyme and cut, then mix, and get final product.

2. the method for claim 1 is characterized in that, the blending ratio that the enzyme of pTZ19R-250 and pUCS1-2k-750 is cut product is 2.5:1 ~ 1.5:1, and described ratio is the mass ratio of pTZ19R-250 and two plasmids of pUCS1-2k-750.

3. the method for claim 1 is characterized in that, the blending ratio that the enzyme of pTZ19R-250 and pUCS1-2k-750 is cut product is 1.9:1, and described ratio is the mass ratio of pTZ19R-250 and two plasmids of pUCS1-2k-750.

4. the method for claim 1 is characterized in that, after enzyme is cut in the step (2), adopts post affinity chromatography purifying, remix.

5. genetically engineered plasmid pTZ19R-250, Nucleotide is shown in SEQ ID NO:3 in the sequence table.

6. genetically engineered plasmid pUCS1-2k-750, Nucleotide is shown in SEQ ID NO:4 in the sequence table.

Images