CN110923305A - DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection - Google Patents
DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection Download PDFInfo
- Publication number
- CN110923305A CN110923305A CN201911167650.4A CN201911167650A CN110923305A CN 110923305 A CN110923305 A CN 110923305A CN 201911167650 A CN201911167650 A CN 201911167650A CN 110923305 A CN110923305 A CN 110923305A
- Authority
- CN
- China
- Prior art keywords
- molecular weight
- dna
- weight standard
- dna molecular
- southern blot
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000002105 Southern blotting Methods 0.000 title claims abstract description 56
- 238000009396 hybridization Methods 0.000 title claims abstract description 55
- 208000001914 Fragile X syndrome Diseases 0.000 title claims abstract description 30
- 238000001514 detection method Methods 0.000 title claims abstract description 25
- 239000012634 fragment Substances 0.000 claims abstract description 67
- 239000000523 sample Substances 0.000 claims abstract description 52
- 238000000034 method Methods 0.000 claims abstract description 13
- 238000002360 preparation method Methods 0.000 claims abstract description 12
- 101150082209 Fmr1 gene Proteins 0.000 claims abstract description 6
- 238000003776 cleavage reaction Methods 0.000 claims abstract description 3
- 230000007017 scission Effects 0.000 claims abstract description 3
- 239000002773 nucleotide Substances 0.000 claims description 16
- 125000003729 nucleotide group Chemical group 0.000 claims description 16
- 238000001976 enzyme digestion Methods 0.000 claims description 13
- 239000013612 plasmid Substances 0.000 claims description 11
- 238000002156 mixing Methods 0.000 claims description 7
- 239000013598 vector Substances 0.000 claims description 4
- 230000002194 synthesizing effect Effects 0.000 claims description 3
- 238000010367 cloning Methods 0.000 claims description 2
- 238000003149 assay kit Methods 0.000 claims 1
- 238000005516 engineering process Methods 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 105
- 241000282414 Homo sapiens Species 0.000 description 17
- 108091008146 restriction endonucleases Proteins 0.000 description 12
- 238000011161 development Methods 0.000 description 10
- 230000015572 biosynthetic process Effects 0.000 description 9
- 238000006243 chemical reaction Methods 0.000 description 9
- 238000003786 synthesis reaction Methods 0.000 description 9
- 238000002474 experimental method Methods 0.000 description 8
- 238000001962 electrophoresis Methods 0.000 description 7
- 238000004925 denaturation Methods 0.000 description 6
- 230000036425 denaturation Effects 0.000 description 6
- 238000010586 diagram Methods 0.000 description 6
- 108090000790 Enzymes Proteins 0.000 description 5
- 102000004190 Enzymes Human genes 0.000 description 5
- 239000011543 agarose gel Substances 0.000 description 5
- 230000035772 mutation Effects 0.000 description 5
- 108700028369 Alleles Proteins 0.000 description 4
- 210000001766 X chromosome Anatomy 0.000 description 4
- 239000003153 chemical reaction reagent Substances 0.000 description 4
- 239000012528 membrane Substances 0.000 description 4
- 239000000126 substance Substances 0.000 description 4
- 241000588724 Escherichia coli Species 0.000 description 3
- 239000000872 buffer Substances 0.000 description 3
- 238000011084 recovery Methods 0.000 description 3
- 239000008223 sterile water Substances 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 201000010374 Down Syndrome Diseases 0.000 description 2
- 101000828537 Homo sapiens Synaptic functional regulator FMR1 Proteins 0.000 description 2
- 239000007984 Tris EDTA buffer Substances 0.000 description 2
- CUJRVFIICFDLGR-UHFFFAOYSA-N acetylacetonate Chemical compound CC(=O)[CH-]C(C)=O CUJRVFIICFDLGR-UHFFFAOYSA-N 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 208000029560 autism spectrum disease Diseases 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000011144 upstream manufacturing Methods 0.000 description 2
- 208000019901 Anxiety disease Diseases 0.000 description 1
- 206010003805 Autism Diseases 0.000 description 1
- 208000020706 Autistic disease Diseases 0.000 description 1
- 208000026350 Inborn Genetic disease Diseases 0.000 description 1
- 208000036626 Mental retardation Diseases 0.000 description 1
- 101100013186 Mus musculus Fmr1 gene Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 208000036623 Severe mental retardation Diseases 0.000 description 1
- 102100023532 Synaptic functional regulator FMR1 Human genes 0.000 description 1
- 206010044688 Trisomy 21 Diseases 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000036506 anxiety Effects 0.000 description 1
- 230000003796 beauty Effects 0.000 description 1
- 230000006399 behavior Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000013599 cloning vector Substances 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000009223 counseling Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 230000001815 facial effect Effects 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 208000016361 genetic disease Diseases 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 208000013403 hyperactivity Diseases 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 238000000338 in vitro Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000011987 methylation Effects 0.000 description 1
- 238000007069 methylation reaction Methods 0.000 description 1
- 239000003147 molecular marker Substances 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 210000001550 testis Anatomy 0.000 description 1
- 238000012549 training Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection, which contains 6 DNA fragments with the lengths as follows: 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb, each of which comprises a fragment capable of binding to a probe for FMR1 gene and does not contain an EagI or EcoRI cleavage site. The invention provides a specific DNA molecular weight standard for diagnosing the fragile X syndrome by the southern blot hybridization technology, and realizes accurate and rapid judgment of the type of a clinical detection sample. Can be normally used after being stored for 3 years at the temperature of minus 20 +/-5 ℃, and does not influence the detection result. The preparation is easy, and the stability and the repeatability are good in the storage and use processes; no biological infectivity.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection.
Background
Fragile X Syndrome (FXS) is a genetic disease that is primarily manifested by a lag in growth and development and mental retardation. Recent studies have also found that FXS is also a significant cause of Autism Spectrum Disorder (ASD).
The incidence rate of fragile X syndrome is only second to Down syndrome (trisomy 21), and according to statistics, the incidence rate of male is about 1:4000, and the incidence rate of female is 1: 8000-1: 6000. According to conservative estimation, at least 20 ten thousand patients with fragility X in China are mainly characterized by moderate to severe mental retardation, the condition of the patients is increased with the age, other clinical manifestations are special facial appearance, such as face growing or ear waving, large testis appears after adolescence, and many patients also manifest autism behaviors such as impulsion, hyperactivity, anxiety, fear, social intercourse, stiff speech and the like. The life of a patient is the same as that of a common person, but the patient cannot live independently, an effective treatment means is not available at present, the life quality of the patient can be improved limitedly only by comprehensive means such as special education, skill training, symptomatic medicine and the like, and serious psychological and economic burden is brought to families and society.
The FXS seriously harms the growth and development of children, is early discovered and treated, can also provide prenatal genetic counseling for family inheritance, avoids the same patients from appearing again in families, has great significance for family happiness and beauty and improvement of social population quality, and has immeasurable social benefit and economic benefit.
At present, the clinical detection gold standard is a Southern blot hybridization method, after EcoRI and EagI restriction enzymes are used for double digestion, the method can detect the states of premutation, total mutation allele and chimera of fragile X syndrome related gene FMR1, and can know the methylation state at the same time, so that the method is the most reliable diagnosis method. After hybridization of the normal human DNA digest with the probe, a band of 2.8kb in size was generated for male, a band of 2.8kb for female active X chromosome, and a band of 5.2kb for inactive X chromosome. The male carrier produces a band of 2.9-3.3 kb, the active X chromosome of the female carrier correspondingly produces a band of 2.9-3.3 kb, and the inactive X chromosome correspondingly produces a band of 5.3-5.7 kb. Therefore, 6-length fragments of 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb are particularly important for FMR1 genotyping, especially two fragments of 2.9kb and 5.2kb which are critical for distinguishing wild type from disease type. The current molecular marker aiming at the Southern blot technology aims at a wide range of items, and no bands capable of distinguishing the types exist. However, in the case of hybridization analysis, if appropriate DNA molecular weight standards are not available, difficulties arise in analyzing the results. For example, a female carrier may have the same degree of separation between two normal alleles with different sizes as between the normal allele and the pre-mutation allele, which may cause misjudgment of the carrier as a normal one; or judging the minor repeat number of the pre-mutation, if no better DNA molecular weight standard exists, the genotype is difficult to judge according to the size of the enzyme-digested fragment. Although internationally judged molecular typing standards can be detected by a number of unknown samples, molecular typing is presumed; however, lack of accuracy and, given the ease of sample collection, biological safety and ethical concerns, it is clearly inappropriate to continue preparation and use in large numbers of scientific and clinical studies.
At present, a DNA molecular weight standard which has good stability and repeatability, no biological infectivity and reliable result, can monitor the hybridization effect and can accurately classify and judge samples is lacked.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection. The DNA molecular weight standard contains 6 fragments of 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb, and is used for accurately typing fragile X syndrome related gene FMR 1.
The first purpose of the invention is to provide a DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection.
The second objective of the invention is to provide a method for preparing any of the DNA molecular weight standards.
The third purpose of the invention is to provide the application of any one of the DNA molecular weight standards in fragile X syndrome southern blot hybridization detection.
The fourth purpose of the invention is to provide the application of any one of the DNA molecular weight standards in the preparation of a fragile X syndrome southern blot hybridization detection kit.
In order to achieve the purpose, the invention is realized by the following technical scheme:
the invention provides a DNA molecular weight standard suitable for diagnosing fragile X syndrome by southern blot hybridization, DNA fragments with corresponding sizes are synthesized, each fragment comprises a southern blot probe sequence, and the DNA fragments can be hybridized with a probe and developed with the same sample; and inserting the fragments into a vector to prepare a plasmid, and then carrying out enzyme digestion on the combined plasmid to obtain the fragments with corresponding sizes. The DNA molecular weight standard prepared by mixing the fragments comprises 6 fragments of 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb respectively, is used for monitoring the hybridization effect and can accurately classify samples, and the 6 DNA fragments do not contain enzyme cutting sites of EagI or EcoRI.
A DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection contains 6 DNA fragments, and the lengths of the 6 DNA fragments are respectively as follows: 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb, and each fragment includes a fragment capable of binding to the probe.
This patent does not limit the position of the fragment at which each fragment can bind to a probe. Preferably, the fragment to which each fragment can bind to the probe is located at the 3' end of each fragment.
Preferably, the probe for FMR1 gene has the nucleotide sequence as shown in SEQ ID NO: shown at 16.
More preferably, the sequence of the fragment capable of binding to the probe is as shown in SEQ ID NO: shown at 13.
Most preferably, the DNA molecular weight standard comprises 6 DNA fragments having a nucleotide sequence as set forth in seq id NO: 1 to 6.
Preferably, SEQ ID NO: the copy number mixing ratio of the DNA fragments represented by 1-6 is 1-3: 2-4: 1-3: 2-4: 1-3.
In order to make the critical fragments of the negative and positive samples more obvious, the amount of the corresponding fragments is increased appropriately.
More preferably, the nucleotide sequence is as set forth in SEQ ID NO: the copy number mixing ratio of the DNA fragments shown in 1-6 is 2:3:2:2:3: 2.
The preparation method of the DNA molecular weight standard comprises the following steps:
s1, synthesizing a nucleotide sequence shown as SEQ ID NO: 1 to 6;
s2, respectively connecting the DNA fragments of S1 into cloning vectors to obtain recombinant plasmids;
s3, carrying out enzyme digestion on the recombinant plasmid to obtain a DNA fragment containing the DNA fragment of S1;
and S4, mixing the DNA fragments obtained in the step S3 according to copy ratio and fixing the volume.
Preferably, in step S2, the cloning vector is pEASY-T1.
Preferably, in step S3, the enzymes used for the cleavage are NotI restriction enzyme, BcuI (SpeI) restriction enzyme and BstXI restriction enzyme.
Preferably, in step S4, the volume is determined by using Low TE buffer.
Preferably, in step S4, the final concentration is made to be 0.3-0.8 ng/. mu.L.
More preferably, the volume is made to a final concentration of 0.4 ng/. mu.L.
The invention also claims the following:
the application of any one of the DNA molecular weight standards in fragile X syndrome southern blot hybridization detection;
the application of any one of the DNA molecular weight standards in the preparation of a fragile X syndrome southern blot hybridization detection kit.
Compared with the prior art, the invention has the following beneficial effects:
the invention constructs a long fragment plasmid containing a probe sequence in vitro, and performs enzyme digestion according to a specific enzyme digestion site on a carrier to obtain a fragile X syndrome wild type and fragments with sizes corresponding to the critical values of the pre-mutation and the full mutation. Provides a specific DNA molecular weight standard for diagnosing the fragile X syndrome by the southern blot hybridization technology, and realizes accurate and rapid judgment of the type of a clinical detection sample.
Can be normally used after being stored for 3 years at the temperature of minus 20 +/-5 ℃, and does not influence the detection result. The preparation is easy, and the stability and the repeatability are good in the storage and use processes; no biological infectivity.
Drawings
FIG. 1 is a sequence diagram of the DNA fragment 2.8kb corresponding to the synthesis.
FIG. 2 is a sequence diagram of the DNA fragment 2.9kb corresponding to the synthesis.
FIG. 3 is a sequence diagram of the 3.3kb DNA fragment synthesized correspondingly.
FIG. 4 is a sequence diagram of the DNA fragment 5.2kb corresponding to the synthesis.
FIG. 5 is a sequence diagram of the DNA fragment of 5.3kb corresponding to the synthesis.
FIG. 6 is a sequence diagram showing the synthesis of 5.7kb DNA fragment.
FIG. 7 shows the results of standard electrophoresis of fragile X syndrome southern blot DNA molecular weight.
FIG. 8 shows the results of the molecular weight standard color development of fragile X syndrome southern blot DNA.
FIG. 9 shows the result of color development of fragile X syndrome southern blot DNA molecular weight standard detection sample.
FIG. 10 shows the results of standard color development of DNA molecular weight without probe sequence.
FIG. 11 shows a probe southern blot hybridization probe sequence of FMR1 gene.
Detailed Description
The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
EXAMPLE 1 preparation of DNA molecular weight standards
1. Obtaining recombinant plasmid of DNA fragment
6 DNA sequences including a probe sequence were designed and synthesized by Biotechnology engineering (Shanghai) Ltd. The sequence nucleotide is shown as SEQ ID NO: 1-6 (does not contain an enzyme cutting site of EagI or EcoRI), each fragment contains a probe sequence (the sequence nucleotide is shown as SEQ ID NO: 13) of a southern blot hybridization combined FMR1 gene, and the bold shown in figures 1-6 is the probe sequence.
The synthetic sequence was inserted and ligated into the LacZ α region of the pEASY-T1 vector.
6 plasmids are respectively transformed into an escherichia coli strain to obtain six recombinant escherichia coli strains, namely B28, B29, B33, B52, B53 and B57. Escherichia coli was cultured and recombinant plasmids ZM28, ZM29, ZM33, ZM52, ZM53 and ZM57 were extracted, respectively.
2. 6 DNA fragments of fixed size were obtained
(1) Subjecting the above plasmid to enzyme digestion
Three fragments of 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb were obtained, and the restriction enzymes used above were NotI restriction enzyme (cat # ER0591), BcuI (SpeI) restriction enzyme (cat # ER1251) and BstXI restriction enzyme (cat # ER1021), all purchased from Saimer fly.
(2) Cutting the enzyme digestion fragment for recovery
And cutting and recovering 6 corresponding DNA fragments, wherein the used kit is a common agarose gel DNA recovery kit of Beijing Tiangen Biotechnology company.
3. Determining the proportion of the mixed sample
Mixing the 6 fragments to prepare a DNA molecular weight standard, measuring the concentration of the gel-cutting recovery product by using an ultraviolet spectrophotometer, mixing the 6 fragments according to the copy number ratio of 2:3:2:2:3:2, adding Low TE buffer for constant volume, and obtaining the final concentration of 0.4 ng/microliter. The configuration ratio is, for example, table 1.
Table 1:
4. use of DNA molecular weight standards
Southern blot experiment is carried out by using the prepared DNA molecular weight standard, and the fragile X type is judged. The southern blot experiment comprises the following specific steps:
1. and (3) sample enzyme digestion: and respectively carrying out enzyme digestion on the sample to be detected by utilizing two restriction enzymes EagI and EcoRI, wherein the restriction enzymes used in the enzyme digestion are purchased from Saimer Fei company. The reaction system is as follows:
| components | Volume (μ L) |
| 10×EcoRI buffer | 5 |
| EcoRI | 2.5 |
| EagI | 2.5 |
| DNA | x(10μg) |
| Sterile water | 40-x |
| Total | 50 |
The reaction conditions are as follows: digesting at 37 ℃ overnight
2. Preparing a southern blot hybridization probe: synthesizing southern blot by using PCR DIG Probe Synthesis Kit as a required hybridization Probe, wherein the reagent is purchased from Roche company; the probe upstream primer 018F (the sequence nucleotide of which is shown in SEQ ID NO: 14) and the probe downstream primer 018R (the sequence nucleotide of which is shown in SEQ ID NO: 15) react as follows:
| components | Volume (μ L) |
| PCR buffer with MgCl2,10×conc | 5 |
| PCR DIG Probe Synthesis Mix,10×conc | 5 |
| 018F | 1 |
| 018R | 1 |
| Taq enzyme | 1 |
| DNA | 1 |
| Sterile water | 36 |
| Total | 50 |
Reaction conditions are as follows: denaturation at 95 ℃ for 10 min, 35 cycles at 95 ℃ for 30 sec, 51 ℃ for 30 sec, and 72 ℃ for 40 sec, and final extension at 72 ℃ for 10 min.
Obtaining a probe sequence, wherein the nucleotide sequence of the probe sequence is shown as SEQ ID NO: 16 (fig. 11).
3. Southern blot hybridization detection: preparing 1% agarose gel, respectively adding 5 μ L of 1kb DNA ladder, 15 μ L of DNA molecular weight standard for southern blot hybridization preparation in example 1, 50 μ L of enzyme digestion sample, and running for 27h at 40V voltage and 2-8 deg.C; performing denaturation and membrane conversion for 16-20 hours after electrophoresis is finished; then adding a southern blot hybridization probe for overnight hybridization, and finally carrying out overnight chemical color development.
The criteria for genotype determination for specific fragment sizes are shown in Table 2.
Table 2:
EXAMPLE 2 agarose gel electrophoresis of DNA molecular weight standards
First, experiment method
Using the DNA molecular weight standards for southern blot hybridization preparation of example 1, 1% agarose gel electrophoresis was carried out, along with the following samples 15000bp DNA ladder (cat # 3582A), 2000bp DNA ladder (cat # 3427A), 200bp DNA ladder (cat # 3423A), 1kb DNA ladder (cat # 3426A), 5. mu.L each of 4 ladders purchased from Takara Shuzo Co., Ltd; the molecular weight standard of southern blot hybridization DNA is 50 mu L. Run for 26h under the conditions of 40V voltage and 2-8 ℃.
Second, experimental results
The results of the electrophoresis were observed under gel imaging, and 6 pieces of the prepared southern blot hybridization DNA molecular weight standard were compared with the above 4 ladders, and as a result, as shown in FIG. 7, the 6 pieces of the prepared DNA molecular weight standard of example 1 were 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb, and 5.7kb, and the pieces of 2.8kb and 2.9kb, and 5.2kb and 5.3kb were clearly distinguished, demonstrating that the 6 pieces of the prepared DNA molecular weight standard were of the desired size.
Example 3 southern blot hybridization validation of DNA molecular weight standards
First, experiment method
The southern blot hybridization detection is carried out by using the DNA molecular weight standard for preparing the southern blot hybridization of the example 1, and the concrete steps are as follows: preparing 1% agarose gel, adding 5 μ L of 1kb DNA ladder and 15 μ L of the DNA molecular weight standard prepared in example 1, respectively, and performing electrophoresis at 40V voltage and 2-8 deg.C for 27 h; after the electrophoresis is finished, performing denaturation and membrane transformation for 16-20 h, adding a southern blot hybridization probe (the preparation method is the same as that of example 1, and the nucleotide sequence of the southern blot is shown in SEQ ID NO: 16) for overnight hybridization, and finally performing chemical color development.
Second, experimental results
As shown in FIG. 8, the bands of 6 fragments of the prepared southern blot DNA molecular weight standard were visualized normally, and the above fragments were compared with 1kb DNA ladder to obtain bands of 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb, respectively; the fragments 2.8kb and 2.9kb and 5.2kb and 5.3kb can be distinguished obviously, which proves that the prepared DNA molecular weight standard can be used in southern blot hybridization experiments.
EXAMPLE 4 DNA molecular weight Standard test samples
First, experiment method
The DNA molecular weight standard for preparing southern blot hybridization of example 1 was used as a marker for the examination of samples of female healthy subjects.
1. And (3) sample enzyme digestion: samples of female healthy subjects and the DNA molecular weight standards prepared in example 1 were digested with restriction enzymes EagI and EcoRI, respectively, and the restriction enzymes used above were purchased from Saimer Fei. The reaction system is as follows:
the reaction conditions are as follows: digesting at 37 ℃ overnight
2. Preparing a southern blot hybridization probe: southern blot was synthesized using PCR DIG Probe Synthesis Kit as the hybridization Probe as required, and the reagents were purchased from Roche. The probe upstream primer 018F (the sequence nucleotide of which is shown in SEQ ID NO: 14) and the probe downstream primer 018R (the sequence nucleotide of which is shown in SEQ ID NO: 15) react as follows:
| components | Volume (μ L) |
| PCR buffer with MgCl2,10×conc | 5 |
| PCR DIG Probe Synthesis Mix,10×conc | 5 |
| 018F | 1 |
| 018R | 1 |
| Taq enzyme | 1 |
| DNA | 1 |
| Sterile water | 36 |
| Total | 50 |
Reaction conditions are as follows: denaturation at 95 ℃ for 10 min, 35 cycles at 95 ℃ for 30 sec, 51 ℃ for 30 sec, and 72 ℃ for 40 sec, and final extension at 72 ℃ for 10 min.
3. Southern blot hybridization detection: preparing 1% agarose gel, respectively adding 5 μ L of 1kb DNA ladder, 15 μ L of DNA molecular weight standard for southern blot hybridization preparation in example 1, 50 μ L of enzyme digestion sample, and running for 27h at 40V voltage and 2-8 deg.C; performing denaturation and membrane conversion for 16-20 hours after electrophoresis is finished; then adding a southern blot hybridization probe for overnight hybridization, and finally carrying out overnight chemical color development.
Second, experimental results
The results are shown in FIG. 9: the 6 fragment bands in the prepared southern blot hybridization DNA molecular weight standard are normally developed, the female wild type sample color development result has two bands, namely 2.8kb and 5.2kb, which are completely consistent with the 2.8kb and 5.2kb bands in the DNA molecular weight standard, and the prepared DNA molecular weight standard is proved to be applicable to the southern blot hybridization detection of fragile X syndrome.
Comparative example 1 DNA molecular weight Standard southern blot hybridization verification without Probe sequence
First, experiment method
A DNA molecular weight standard free of probe sequences was prepared according to the method of example 1, each fragment not having added thereto a probe sequence having a nucleotide sequence shown in SEQ ID NO: 7-12 the rest steps are the same as in example 1.
The prepared DNA molecular weight standard without probe sequences is used for Southern blot hybridization detection, and the specific steps are as follows: preparing 1% agarose gel, adding 5 μ L1 kb DNA ladder and 15 μ L southern blot blotting hybridization DNA molecular weight standard, respectively, running for 27h at 2-8 deg.C under 40V voltage; and (3) after electrophoresis, performing denaturation and membrane conversion for 16-20 h, performing probe overnight hybridization, and finally performing chemical color development.
Second, experimental results
As shown in FIG. 10, the 6-segment bands of the prepared southern blot hybridization DNA molecular weight standard without the probe sequence cannot be normally developed, which proves that the prepared DNA molecular weight standard can be used in the southern blot hybridization experiment only if the prepared DNA molecular weight standard contains the probe sequence.
Sequence listing
<110> Darriy Biotechnology Ltd, Guangzhou City
<120> DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection
<160>16
<170>SIPOSequenceListing 1.0
<210>1
<211>2784
<212>DNA
<213>Homo sapiens
<400>1
ctccgaccag tgtttgcctt ttatggtaat aacgcggccg gcccggcttc ctttgtcccc 60
aatctgggcg cgcgccggcg ccccctggcg gcctaaggac tcggcgcgcc ggaagtggcc 120
agggcggggg cgacctcggc tcacagcgcg cccggctatt ctcgcagctc accatggatg 180
atgatatcgc cgcgctcgtc gtcgacaacg gctccggcat gtgcaaggcc ggcttcgcgg 240
gcgacgatgc cccccgggcc gtcttcccct ccatcgtggg gcgccccagg caccaggtag 300
gggagctggc tgggtggggc agccccggga gcgggcggga ggcaagggcg ctttctctgc 360
acaggagcct cccggtttcc ggggtggggg ctgcgcccgt gctcagggct tcttgtcctt 420
tccttcccag ggcgtgatgg tgggcatggg tcagaaggat tcctatgtgg gcgacgaggc 480
ccagagcaag agaggcatcc tcaccctgaa gtaccccatc gagcacggca tcgtcaccaa 540
ctgggacgac atggagaaaa tctggcacca caccttctac aatgagctgc gtgtggctcc 600
cgaggagcac cccgtgctgc tgaccgaggc ccccctgaac cccaaggcca accgcgagaa 660
gatgacccag gtgagtggcc cgctacctct tctggtggcc gcctccctcc ttcctggcct 720
cccggagctg cgccctttct cactggttct ctcttctgcc gttttccgta ggactctctt 780
ctctgacctg agtctccttt ggaactctgc aggttctatt tgctttttcc cagatgagct 840
ctttttctgg tgtttgtctc tctgactagg tgtctaagac agtgttgtgg gtgtaggtac 900
taacactggc tcgtgtgaca aggccatgag gctggtgtaa agcggccttg gagtgtgtat 960
taagtaggtg cacagtaggt ctgaacagac tccccatccc aagaccccag cacacttagc 1020
cgtgttcttt gcactttctg catgtccccc gtctggcctg gctgtcccca gtggcttccc 1080
cagtgtgaca tggtgtatct ctgccttaca gatcatgttt gagaccttca acaccccagc 1140
catgtacgtt gctatccagg ctgtgctatc cctgtacgcc tctggccgta ccactggcat 1200
cgtgatggac tccggtgacg gggtcaccca cactgtgccc atctacgagg ggtatgccct 1260
cccccatgcc atcctgcgtc tggacctggc tggccgggac ctgactgact acctcatgaa 1320
gatcctcacc gagcgcggct acagcttcac caccacggcc gagcgggaaa tcgtgcgtga 1380
cattaaggag aagctgtgct acgtcgccct ggacttcgagcaagagatgg ccacggctgc 1440
ttccagctcc tccctggaga agagctacga gctgcctgac ggccaggtca tcaccattgg 1500
caatgagcgg ttccgctgcc ctgaggcact cttccagcct tccttcctgg gtgagtggag 1560
actgtctccc ggctctgcct gacatgaggg ttacccctcg gggctgtgct gtggaagcta 1620
agtcctgccc tcatttccct ctcaggcatg gagtcctgtg gcatccacga aactaccttc 1680
aactccatca tgaagtgtga cgtggacatc cgcaaagacc tgtacgccaa cacagtgctg 1740
tctggcggca ccaccatgta ccctggcatt gccgacagga tgcagaagga gatcactgcc 1800
ctggcaccca gcacaatgaa gatcaaggtg ggtgtctttc ctgcctgagc tgacctgggc 1860
aggtcggctg tggggtcctg tggtgtgtgg ggagctgtca catccagggt cctcactgcc 1920
tgtccccttc cctcctcaga tcattgctcc tcctgagcgc aagtactccg tgtggatcgg 1980
cggctccatc ctggcctcgc tgtccacctt ccagcagatg tggatcagca agcaggagta 2040
tgacgagtcc ggcccctcca tcgtccaccg caaatgcttc taggcggact atgacttagt 2100
tgcgttacac cctttcttga caaaacctaa cttgcgcaga aaacaagatg agattggcat 2160
ggctttattt gttttttttg ttttgttttg gttttttttt tttttttggc ttgactcagg 2220
atttaaaaac tggaacggtg aaggtgacag caggagctcc actgttctgg gcgagggctg 2280
tgaagaaaga gtagtaagaa gcggtagtcg gcaccaaatc acaatggcaa ctgattttta 2340
gtggcttctc tttgtggatt tcggaggaga ttttagatcc aaaagtttca ggaagaccct 2400
aacatggccc agcagtgcat tgaagaagtt gatcatcgtg aatattcgcg tccccctttt 2460
tgttaaacgg ggtaaattca ggaatgcaca tgcttcagcg tctaaaacca ttagcagcgc 2520
tgctacttaa aaattgtgtg tgtgtgttta agtttccaaa gacctaaata tatgccatga 2580
aacttcaggt aattaactga gagtatatta ttactagggc attttttttt taactgagcg 2640
aaaatatttt tgtgccccta agaacttgac cacatttcct ttgaatttgt ggtgttgcag 2700
tggactgaat tgttgaggct ttatataggc attcatgggt ttactgtgct ttttaaagtt 2760
acaccattgc agatcaacta acac 2784
<210>2
<211>2884
<212>DNA
<213>Homo sapiens
<400>2
ctccgaccag tgtttgcctt ttatggtaat aacgcggccg gcccggcttc ctttgtcccc 60
aatctgggcg cgcgccggcg ccccctggcg gcctaaggac tcggcgcgcc ggaagtggcc 120
agggcggggg cgacctcggc tcacagcgcg cccggctatt ctcgcagctc accatggatg 180
atgatatcgc cgcgctcgtc gtcgacaacg gctccggcat gtgcaaggcc ggcttcgcgg 240
gcgacgatgc cccccgggcc gtcttcccct ccatcgtggg gcgccccagg caccaggtag 300
gggagctggc tgggtggggc agccccggga gcgggcggga ggcaagggcg ctttctctgc 360
acaggagcct cccggtttcc ggggtggggg ctgcgcccgt gctcagggct tcttgtcctt 420
tccttcccag ggcgtgatgg tgggcatggg tcagaaggat tcctatgtgg gcgacgaggc 480
ccagagcaag agaggcatcc tcaccctgaa gtaccccatc gagcacggca tcgtcaccaa 540
ctgggacgac atggagaaaa tctggcacca caccttctac aatgagctgc gtgtggctcc 600
cgaggagcac cccgtgctgc tgaccgaggc ccccctgaac cccaaggcca accgcgagaa 660
gatgacccag gtgagtggcc cgctacctct tctggtggcc gcctccctcc ttcctggcct 720
cccggagctg cgccctttct cactggttct ctcttctgcc gttttccgta ggactctctt 780
ctctgacctg agtctccttt ggaactctgc aggttctatt tgctttttcc cagatgagct 840
ctttttctgg tgtttgtctc tctgactagg tgtctaagac agtgttgtgg gtgtaggtac 900
taacactggc tcgtgtgaca aggccatgag gctggtgtaa agcggccttg gagtgtgtat 960
taagtaggtg cacagtaggt ctgaacagac tccccatccc aagaccccag cacacttagc 1020
cgtgttcttt gcactttctg catgtccccc gtctggcctg gctgtcccca gtggcttccc 1080
cagtgtgaca tggtgtatct ctgccttaca gatcatgttt gagaccttca acaccccagc 1140
catgtacgtt gctatccagg ctgtgctatc cctgtacgcc tctggccgta ccactggcat 1200
cgtgatggac tccggtgacg gggtcaccca cactgtgccc atctacgagg ggtatgccct 1260
cccccatgcc atcctgcgtc tggacctggc tggccgggac ctgactgact acctcatgaa 1320
gatcctcacc gagcgcggct acagcttcac caccacggcc gagcgggaaa tcgtgcgtga 1380
cattaaggag aagctgtgct acgtcgccct ggacttcgag caagagatgg ccacggctgc 1440
ttccagctcc tccctggaga agagctacga gctgcctgac ggccaggtca tcaccattgg 1500
caatgagcgg ttccgctgcc ctgaggcact cttccagcct tccttcctgg gtgagtggag 1560
actgtctccc ggctctgcct gacatgaggg ttacccctcg gggctgtgct gtggaagcta 1620
agtcctgccc tcatttccct ctcaggcatg gagtcctgtg gcatccacga aactaccttc 1680
aactccatca tgaagtgtga cgtggacatc cgcaaagacc tgtacgccaa cacagtgctg 1740
tctggcggca ccaccatgta ccctggcatt gccgacagga tgcagaagga gatcactgcc 1800
ctggcaccca gcacaatgaa gatcaaggtg ggtgtctttc ctgcctgagc tgacctgggc 1860
aggtcggctg tggggtcctg tggtgtgtgg ggagctgtca catccagggt cctcactgcc 1920
tgtccccttc cctcctcaga tcattgctcc tcctgagcgc aagtactccg tgtggatcgg 1980
cggctccatc ctggcctcgc tgtccacctt ccagcagatg tggatcagca agcaggagta 2040
tgacgagtcc ggcccctcca tcgtccaccg caaatgcttc taggcggact atgacttagt 2100
tgcgttacac cctttcttga caaaacctaa cttgcgcaga aaacaagatg agattggcat 2160
ggctttattt gttttttttg ttttgttttg gttttttttt tttttttggc ttgactcagg 2220
atttaaaaac tggaacggtg aaggtgacag cagtcggttg gagcgagcat cccccaaagt 2280
tcacaatgtg gccgaggact ttgattgcac attgttgttt ttttaatagt cattccaaat 2340
atgagatgcg ttggagctcc actgttctgg gcgagggctg tgaagaaaga gtagtaagaa 2400
gcggtagtcg gcaccaaatc acaatggcaa ctgattttta gtggcttctc tttgtggatt 2460
tcggaggaga ttttagatcc aaaagtttca ggaagaccct aacatggccc agcagtgcat 2520
tgaagaagtt gatcatcgtg aatattcgcg tccccctttt tgttaaacgg ggtaaattca 2580
ggaatgcaca tgcttcagcg tctaaaacca ttagcagcgc tgctacttaa aaattgtgtg 2640
tgtgtgttta agtttccaaa gacctaaata tatgccatga aacttcaggt aattaactga 2700
gagtatatta ttactagggc attttttttt taactgagcg aaaatatttt tgtgccccta 2760
agaacttgac cacatttcct ttgaatttgt ggtgttgcag tggactgaat tgttgaggct 2820
ttatataggc attcatgggt ttactgtgct ttttaaagtt acaccattgc agatcaacta 2880
acac 2884
<210>3
<211>3291
<212>DNA
<213>Homo sapiens
<400>3
cgggtctttg cagtcgtatg ggggcagggt agctgttccc cgcaaggaga gctcaaggtc 60
agcgctcgga cctggcggag ccccgcaccc aggctgtggc gccctgtgca gctccgccct 120
tgcggcgcca tctgcccgga gcctccttcc cctagtcccc agaaacagga ggtccctact 180
cccgcccgag atcccgaccc ggacccctag gtgggggacg ctttctttcc tttcgcgctc 240
tgcggggtca cgtgtcgcag aggagcccct cccccacggc ctccggcacc gcaggccccg 300
ggatgctagt gcgcagcggg tgcatccctg tccggatgct gcgcctgcgg tagagcggcc 360
gccatgttgc aaccgggaag gaaatgaatg ggcagccgtt aggaaagcct gccggtgact 420
aaccctgcgc tcctgcctcg atgggtggag tcgcgtgtgg cggggaagtc aggtggagcg 480
aggctagctg gcccgatttc tcctccgggt gatgcttttc ctagattatt ctctggtaaa 540
tcaaagaagt gggtttatgg aggtcctctt gtgtcccctc cccgcagagg tgtggtggct 600
gtggcatggt gccaagccgg gagaagctga gtcatgggta gttggaaaag gacatttcca 660
ccgcaaaatg gcccctctgg tggtggcccc ttcctgcagc gccggctcac ctcacggccc 720
cgcccttccc ctgccagcct agcgttgacc cgaccccaaa ggccaggctg taaatgtcac 780
cgggaggatt gggtgtctgg gcgcctcggg gaacctgccc ttctccccat tccgtcttcc 840
ggaaaccaga tctcccaccg caccctggtc tgaggttaaa tatagctgct gacctttctg 900
tagctggggg cctgggctgg ggctctctcc catcccttct ccccacacac atgcacttac 960
ctgtgctccc actcctgatt tctggaaaag agctaggaag gacaggcaac ttggcaaatc 1020
aaagccctgg gactaggggg ttaaaataca gcttcccctc ttcccacccg ccccagtctc 1080
tgtccctttt gtaggaggga cttagagaag gggtgggctt gccctgtcca gttaatttct 1140
gacctttact cctgcccttt gagtttgatg atgctgagtg tacaagcgtt ttctccctaa 1200
agggtgcagc tgagctaggc agcagcaagc attcctgggg tggcatagtg gggtggtgaa 1260
taccatgtac aaagcttgtg cccagactgt gggtggcagt gccccacatg gccgcttctc 1320
ctggaagggc ttcgtatgac tgggggtgtt gggcagccct ggagccttca gttgcagcca 1380
tgccttaagc caggccagcc tggcagggaa gctcaaggga gataaaattc aacctcttgg 1440
gccctcctgg gggtaaggag atgctgcatt cgccctctta atggggaggt ggcctagggc 1500
tgctcacata ttctggagga gcctcccctc ctcatgcctt cttgcctctt gtctcttaga 1560
tttggtcgta ttgggcgcct ggtcaccagg gctgctttta actctggtaa agtggatatt 1620
gttgccatca atgacccctt cattgacctc aactacatgg tgagtgctac atggtgagcc 1680
ccaaagctgg tgtgggagga gccacctggc tgatgggcag ccccttcata ccctcacgta 1740
ttcccccagg tttacatgtt ccaatatgat tccacccatg gcaaattcca tggcaccgtc 1800
aaggctgaga acgggaagct tgtcatcaat ggaaatccca tcaccatctt ccaggagtga 1860
gtggaagaca gaatggaaga aatgtgcttt ggggaggcaa ctaggatggt gtggctccct 1920
tgggtatatg gtaaccttgt gtccctcaat atggtcctgt ccccatctcc cccccacccc 1980
cataggcgag atccctccaa aatcaagtgg ggcgatgctg gcgctgagta cgtcgtggag 2040
tccactggcg tcttcaccac catggagaag gctggggtga gtgcaggagg gcccgcggga 2100
ggggaagctg actcagccct gcaaaggcag gacccgggtt cataactgtc tgcttctctg 2160
ctgtaggctc atttgcaggg gggagccaaa agggtcatca tctctgcccc ctctgctgat 2220
gcccccatgt tcgtcatggg tgtgaaccat gagaagtatg acaacagcct caagatcatc 2280
aggtgaggaa ggcagggccc gtggagaagc ggccagcctg gcaccctatg gacacgctcc 2340
cctgacttgc gccccgctcc ctctttcttt gcagcaatgc ctcctgcacc accaactgct 2400
tagcacccct ggccaaggtc atccatgaca actttggtat cgtggaagga ctcatggtat 2460
gagagctggg gaatgggact gaggctccca cctttctcat ccaagactgg ctcctccctg 2520
ccggggctgc gtgcaaccct ggggttgggg gttctgggga ctggctttcc cataatttcc 2580
tttcaaggtg gggagggagg tagaggggtg atgtggggag tacgctgcag ggcctcactc 2640
cttttgcaga ccacagtcca tgccatcact gccacccaga agactgtgga tggcccctcc 2700
gggaaactgt ggcgtgatgg ccgcggggct ctccagaaca tcatccctgc ctctactggc 2760
gagctccact gttctgggcg agggctgtga agaaagagta gtaagaagcg gtagtcggca 2820
ccaaatcaca atggcaactg atttttagtg gcttctcttt gtggatttcg gaggagattt 2880
tagatccaaa agtttcagga agaccctaac atggcccagc agtgcattga agaagttgat 2940
catcgtgaat attcgcgtcc ccctttttgt taaacggggt aaattcagga atgcacatgc 3000
ttcagcgtct aaaaccatta gcagcgctgc tacttaaaaa ttgtgtgtgt gtgtttaagt 3060
ttccaaagac ctaaatatat gccatgaaac ttcaggtaat taactgagag tatattatta 3120
ctagggcatt ttttttttaa ctgagcgaaa atatttttgt gcccctaaga acttgaccac 3180
atttcctttg aatttgtggt gttgcagtgg actgaattgt tgaggcttta tataggcatt 3240
catgggttta ctgtgctttt taaagttaca ccattgcaga tcaactaaca c 3291
<210>4
<211>1287
<212>DNA
<213>Homo sapiens
<400>4
tgtctttcct gcctgagctg acctgggcag gtcggctgtg gggtcctgtg gtgtgtgggg 60
agctgtcaca tccagggtcc tcactgcctg tccccttccc tcctcagatc attgctcctc 120
ctgagcgcaa gtactccgtg tggatcggcg gctccatcct ggcctcgctg tccaccttcc 180
agcagatgtg gatcagcaag caggagtatg acgagtccgg cccctccatc gtccaccgca 240
aatgcttcta ggcggactat gacttagttg cgttacaccc tttcttgaca aaacctaact 300
tgcgcagaaa acaagatgag attggcatgg ctttatttgt tttttttgtt ttgttttggt 360
tttttttttt tttttggctt gactcaggat ttaaaaactg gaacggtgaa ggtgacagca 420
gtcggttgga gcgagcatcc cccaaagttc acaatgtggc cgaggacttt gattgcacat 480
tgttgttttt ttaatagtca ttccaaatat gagatgcgtt gttacaggaa gtcccttgcc 540
atcctaaaag ccaccccact tctctctaag gagaatggcc cagtcctctc ccaagtccac 600
acaggggagg tgatagcatt gctttcgtgt aaattatgta atgcaaaatt tttttaatct 660
tcgccttaat acttttttat tttgttttat tttgaatgat gagccttcgt gccccccctt 720
cccccttttt tgtcccccaa cttgagatgt atgaaggagc tccactgttc tgggcgaggg 780
ctgtgaagaa agagtagtaa gaagcggtag tcggcaccaa atcacaatgg caactgattt 840
ttagtggctt ctctttgtgg atttcggagg agattttaga tccaaaagtt tcaggaagac 900
cctaacatgg cccagcagtg cattgaagaa gttgatcatc gtgaatattc gcgtccccct 960
ttttgttaaa cggggtaaat tcaggaatgc acatgcttca gcgtctaaaa ccattagcag 1020
cgctgctact taaaaattgt gtgtgtgtgt ttaagtttcc aaagacctaa atatatgcca 1080
tgaaacttca ggtaattaac tgagagtata ttattactag ggcatttttt ttttaactga 1140
gcgaaaatat ttttgtgccc ctaagaactt gaccacattt cctttgaatt tgtggtgttg 1200
cagtggactg aattgttgag gctttatata ggcattcatg ggtttactgt gctttttaaa 1260
gttacaccat tgcagatcaa ctaacac 1287
<210>5
<211>1387
<212>DNA
<213>Homo sapiens
<400>5
tgaacagact ccccatccca agaccccagc acacttagcc gtgttctttg cactttctgc 60
atgtcccccg tctggcctgg ctgtccccag tggcttcccc agtgtgacat ggtgtatctc 120
tgccttacag atcatgtttg agaccttcaa caccccagcc atgtacgttg ctatccaggc 180
tgtgctatcc ctgtacgcct ctggccgtac cactggcatc gtgatggact ccggtgacgg 240
ggtcacccac actgtgccca tctacgaggg gtatgccctc ccccatgcca tcctgcgtct 300
ggacctggct ggccgggacc tgactgacta cctcatgaag atcctcaccg agcgcggcta 360
cagcttcacc accacggccg agcgggaaat cgtgcgtgac attaaggaga agctgtgcta 420
cgtcgccctg gacttcgagc aagagatggc cacggctgct tccagctcct ccctggagaa 480
gagctacgag ctgcctgacg gccaggtcat caccattggc aatgagcggt tccgctgccc 540
tgaggcactc ttccagcctt ccttcctggg tgagtggaga ctgtctcccg gctctgcctg 600
acatgagggt tacccctcgg ggctgtgctg tggaagctaa gtcctgccct catttccctc 660
tcaggcatgg agtcctgtgg catccacgaa actaccttca actccatcat gaagtgtgac 720
gtggacatcc gcaaagacct gtacgccaac acagtgctgt ctggcggcac caccatgtac 780
cctggcattg ccgacaggat gcagaaggag atcactgccc tggcacccag cacaatgaag 840
atcaaggtgg gtgtctgagc tccactgttc tgggcgaggg ctgtgaagaa agagtagtaa 900
gaagcggtag tcggcaccaa atcacaatgg caactgattt ttagtggctt ctctttgtgg 960
atttcggagg agattttaga tccaaaagtt tcaggaagac cctaacatgg cccagcagtg 1020
cattgaagaa gttgatcatc gtgaatattc gcgtccccct ttttgttaaa cggggtaaat 1080
tcaggaatgc acatgcttca gcgtctaaaa ccattagcag cgctgctact taaaaattgt 1140
gtgtgtgtgt ttaagtttcc aaagacctaa atatatgcca tgaaacttca ggtaattaac 1200
tgagagtata ttattactag ggcatttttt ttttaactga gcgaaaatat ttttgtgccc 1260
ctaagaactt gaccacattt cctttgaatt tgtggtgttg cagtggactg aattgttgag 1320
gctttatata ggcattcatg ggtttactgt gctttttaaa gttacaccat tgcagatcaa 1380
ctaacac 1387
<210>6
<211>1803
<212>DNA
<213>Homo sapiens
<400>6
aacagactcc ccatcccaag accccagcac acttagccgt gttctttgca ctttctgcat 60
gtcccccgtc tggcctggct gtccccagtg gcttccccag tgtgacatgg tgtatctctg 120
ccttacagat catgtttgag accttcaaca ccccagccat gtacgttgct atccaggctg 180
tgctatccct gtacgcctct ggccgtacca ctggcatcgt gatggactcc ggtgacgggg 240
tcacccacac tgtgcccatc tacgaggggt atgccctccc ccatgccatc ctgcgtctgg 300
acctggctgg ccgggacctg actgactacc tcatgaagat cctcaccgag cgcggctaca 360
gcttcaccac cacggccgag cgggaaatcg tgcgtgacat taaggagaag ctgtgctacg 420
tcgccctgga cttcgagcaa gagatggcca cggctgcttc cagctcctcc ctggagaaga 480
gctacgagct gcctgacggc caggtcatca ccattggcaa tgagcggttc cgctgccctg 540
aggcactctt ccagccttcc ttcctgggtg agtggagact gtctcccggc tctgcctgac 600
atgagggtta cccctcgggg ctgtgctgtg gaagctaagt cctgccctca tttccctctc 660
aggcatggag tcctgtggca tccacgaaac taccttcaac tccatcatga agtgtgacgt 720
ggacatccgc aaagacctgt acgccaacac agtgctgtct ggcggcacca ccatgtaccc 780
tggcattgcc gacaggatgc agaaggagat cactgccctg gcacccagca caatgaagat 840
caaggtgggt gtctttcctg cctgagctga cctgggcagg tcggctgtgg ggtcctgtgg 900
tgtgtgggga gctgtcacat ccagggtcct cactgcctgt ccccttccct cctcagatca 960
ttgctcctcc tgagcgcaag tactccgtgt ggatcggcgg ctccatcctg gcctcgctgt 1020
ccaccttcca gcagatgtgg atcagcaagc aggagtatga cgagtccggc ccctccatcg 1080
tccaccgcaa atgcttctag gcggactatg acttagttgc gttacaccct ttcttgacaa 1140
aacctaactt gcgcagaaaa caagatgaga ttggcatggc tttatttgtt ttttttgttt 1200
tgttttggtt tttttttttt ttttggcttg actcaggatt taaaaactgg aacggtgaag 1260
gtgacagcag tcgagctcca ctgttctggg cgagggctgt gaagaaagag tagtaagaag 1320
cggtagtcgg caccaaatca caatggcaac tgatttttag tggcttctct ttgtggattt 1380
cggaggagat tttagatcca aaagtttcag gaagacccta acatggccca gcagtgcatt 1440
gaagaagttg atcatcgtga atattcgcgt cccccttttt gttaaacggg gtaaattcag 1500
gaatgcacat gcttcagcgt ctaaaaccat tagcagcgct gctacttaaa aattgtgtgt 1560
gtgtgtttaa gtttccaaag acctaaatat atgccatgaa acttcaggta attaactgag 1620
agtatattat tactagggca tttttttttt aactgagcga aaatattttt gtgcccctaa 1680
gaacttgacc acatttcctt tgaatttgtg gtgttgcagt ggactgaatt gttgaggctt 1740
tatataggca ttcatgggtt tactgtgctt tttaaagtta caccattgca gatcaactaa 1800
cac 1803
<210>7
<211>2253
<212>DNA
<213>Homo sapiens
<400>7
ctccgaccag tgtttgcctt ttatggtaat aacgcggccg gcccggcttc ctttgtcccc 60
aatctgggcg cgcgccggcg ccccctggcg gcctaaggac tcggcgcgcc ggaagtggcc 120
agggcggggg cgacctcggc tcacagcgcg cccggctatt ctcgcagctc accatggatg 180
atgatatcgc cgcgctcgtc gtcgacaacg gctccggcat gtgcaaggcc ggcttcgcgg 240
gcgacgatgc cccccgggcc gtcttcccct ccatcgtggg gcgccccagg caccaggtag 300
gggagctggc tgggtggggc agccccggga gcgggcggga ggcaagggcg ctttctctgc 360
acaggagcct cccggtttcc ggggtggggg ctgcgcccgt gctcagggct tcttgtcctt 420
tccttcccag ggcgtgatgg tgggcatggg tcagaaggat tcctatgtgg gcgacgaggc 480
ccagagcaag agaggcatcc tcaccctgaa gtaccccatc gagcacggca tcgtcaccaa 540
ctgggacgac atggagaaaa tctggcacca caccttctac aatgagctgc gtgtggctcc 600
cgaggagcac cccgtgctgc tgaccgaggc ccccctgaac cccaaggcca accgcgagaa 660
gatgacccag gtgagtggcc cgctacctct tctggtggcc gcctccctcc ttcctggcct 720
cccggagctg cgccctttct cactggttct ctcttctgcc gttttccgta ggactctctt 780
ctctgacctg agtctccttt ggaactctgc aggttctatt tgctttttcc cagatgagct 840
ctttttctgg tgtttgtctc tctgactagg tgtctaagac agtgttgtgg gtgtaggtac 900
taacactggc tcgtgtgaca aggccatgag gctggtgtaa agcggccttg gagtgtgtat 960
taagtaggtg cacagtaggt ctgaacagac tccccatccc aagaccccag cacacttagc 1020
cgtgttcttt gcactttctg catgtccccc gtctggcctg gctgtcccca gtggcttccc 1080
cagtgtgaca tggtgtatct ctgccttaca gatcatgttt gagaccttca acaccccagc 1140
catgtacgtt gctatccagg ctgtgctatc cctgtacgcc tctggccgta ccactggcat 1200
cgtgatggac tccggtgacg gggtcaccca cactgtgccc atctacgagg ggtatgccct 1260
cccccatgcc atcctgcgtc tggacctggc tggccgggac ctgactgact acctcatgaa 1320
gatcctcacc gagcgcggct acagcttcac caccacggcc gagcgggaaa tcgtgcgtga 1380
cattaaggag aagctgtgct acgtcgccct ggacttcgag caagagatgg ccacggctgc 1440
ttccagctcc tccctggaga agagctacga gctgcctgac ggccaggtca tcaccattgg 1500
caatgagcgg ttccgctgcc ctgaggcact cttccagcct tccttcctgg gtgagtggag 1560
actgtctccc ggctctgcct gacatgaggg ttacccctcg gggctgtgct gtggaagcta 1620
agtcctgccc tcatttccct ctcaggcatg gagtcctgtg gcatccacga aactaccttc 1680
aactccatca tgaagtgtga cgtggacatc cgcaaagacc tgtacgccaa cacagtgctg 1740
tctggcggca ccaccatgta ccctggcatt gccgacagga tgcagaagga gatcactgcc 1800
ctggcaccca gcacaatgaa gatcaaggtg ggtgtctttc ctgcctgagc tgacctgggc 1860
aggtcggctg tggggtcctg tggtgtgtgg ggagctgtca catccagggt cctcactgcc 1920
tgtccccttc cctcctcaga tcattgctcc tcctgagcgc aagtactccg tgtggatcgg 1980
cggctccatc ctggcctcgc tgtccacctt ccagcagatg tggatcagca agcaggagta 2040
tgacgagtcc ggcccctcca tcgtccaccg caaatgcttc taggcggact atgacttagt 2100
tgcgttacac cctttcttga caaaacctaa cttgcgcaga aaacaagatg agattggcat 2160
ggctttattt gttttttttg ttttgttttg gttttttttt tttttttggc ttgactcagg 2220
atttaaaaac tggaacggtg aaggtgacag cag 2253
<210>8
<211>2353
<212>DNA
<213>Homo sapiens
<400>8
ctccgaccag tgtttgcctt ttatggtaat aacgcggccg gcccggcttc ctttgtcccc 60
aatctgggcg cgcgccggcg ccccctggcg gcctaaggac tcggcgcgcc ggaagtggcc 120
agggcggggg cgacctcggc tcacagcgcg cccggctatt ctcgcagctc accatggatg 180
atgatatcgc cgcgctcgtc gtcgacaacg gctccggcat gtgcaaggcc ggcttcgcgg 240
gcgacgatgc cccccgggcc gtcttcccct ccatcgtggg gcgccccagg caccaggtag 300
gggagctggc tgggtggggc agccccggga gcgggcggga ggcaagggcg ctttctctgc 360
acaggagcct cccggtttcc ggggtggggg ctgcgcccgt gctcagggct tcttgtcctt 420
tccttcccag ggcgtgatgg tgggcatggg tcagaaggat tcctatgtgg gcgacgaggc 480
ccagagcaag agaggcatcc tcaccctgaa gtaccccatc gagcacggca tcgtcaccaa 540
ctgggacgac atggagaaaa tctggcacca caccttctac aatgagctgc gtgtggctcc 600
cgaggagcac cccgtgctgc tgaccgaggc ccccctgaac cccaaggcca accgcgagaa 660
gatgacccag gtgagtggcc cgctacctct tctggtggcc gcctccctcc ttcctggcct 720
cccggagctg cgccctttct cactggttct ctcttctgcc gttttccgta ggactctctt 780
ctctgacctg agtctccttt ggaactctgc aggttctatt tgctttttcc cagatgagct 840
ctttttctgg tgtttgtctc tctgactagg tgtctaagac agtgttgtgg gtgtaggtac 900
taacactggc tcgtgtgaca aggccatgag gctggtgtaa agcggccttg gagtgtgtat 960
taagtaggtg cacagtaggt ctgaacagac tccccatccc aagaccccag cacacttagc 1020
cgtgttcttt gcactttctg catgtccccc gtctggcctg gctgtcccca gtggcttccc 1080
cagtgtgaca tggtgtatct ctgccttaca gatcatgttt gagaccttca acaccccagc 1140
catgtacgtt gctatccagg ctgtgctatc cctgtacgcc tctggccgta ccactggcat 1200
cgtgatggac tccggtgacg gggtcaccca cactgtgccc atctacgagg ggtatgccct 1260
cccccatgcc atcctgcgtc tggacctggc tggccgggac ctgactgact acctcatgaa 1320
gatcctcacc gagcgcggct acagcttcac caccacggcc gagcgggaaa tcgtgcgtga 1380
cattaaggag aagctgtgct acgtcgccct ggacttcgag caagagatgg ccacggctgc 1440
ttccagctcc tccctggaga agagctacga gctgcctgac ggccaggtca tcaccattgg 1500
caatgagcgg ttccgctgcc ctgaggcact cttccagcct tccttcctgg gtgagtggag 1560
actgtctccc ggctctgcct gacatgaggg ttacccctcg gggctgtgct gtggaagcta 1620
agtcctgccc tcatttccct ctcaggcatg gagtcctgtg gcatccacga aactaccttc 1680
aactccatca tgaagtgtga cgtggacatc cgcaaagacc tgtacgccaa cacagtgctg 1740
tctggcggca ccaccatgta ccctggcatt gccgacagga tgcagaagga gatcactgcc 1800
ctggcaccca gcacaatgaa gatcaaggtg ggtgtctttc ctgcctgagc tgacctgggc 1860
aggtcggctg tggggtcctg tggtgtgtgg ggagctgtca catccagggt cctcactgcc 1920
tgtccccttc cctcctcaga tcattgctcc tcctgagcgc aagtactccg tgtggatcgg 1980
cggctccatc ctggcctcgc tgtccacctt ccagcagatg tggatcagca agcaggagta 2040
tgacgagtcc ggcccctcca tcgtccaccg caaatgcttc taggcggact atgacttagt 2100
tgcgttacac cctttcttga caaaacctaa cttgcgcaga aaacaagatg agattggcat 2160
ggctttattt gttttttttg ttttgttttg gttttttttt tttttttggc ttgactcagg 2220
atttaaaaac tggaacggtg aaggtgacag cagtcggttg gagcgagcat cccccaaagt 2280
tcacaatgtg gccgaggact ttgattgcac attgttgttt ttttaatagt cattccaaat 2340
atgagatgcg ttg 2353
<210>9
<211>2760
<212>DNA
<213>Homo sapiens
<400>9
cgggtctttg cagtcgtatg ggggcagggt agctgttccc cgcaaggaga gctcaaggtc 60
agcgctcgga cctggcggag ccccgcaccc aggctgtggc gccctgtgca gctccgccct 120
tgcggcgcca tctgcccgga gcctccttcc cctagtcccc agaaacagga ggtccctact 180
cccgcccgag atcccgaccc ggacccctag gtgggggacg ctttctttcc tttcgcgctc 240
tgcggggtca cgtgtcgcag aggagcccct cccccacggc ctccggcacc gcaggccccg 300
ggatgctagt gcgcagcggg tgcatccctg tccggatgct gcgcctgcgg tagagcggcc 360
gccatgttgc aaccgggaag gaaatgaatg ggcagccgtt aggaaagcct gccggtgact 420
aaccctgcgc tcctgcctcg atgggtggag tcgcgtgtgg cggggaagtc aggtggagcg 480
aggctagctg gcccgatttc tcctccgggt gatgcttttc ctagattatt ctctggtaaa 540
tcaaagaagt gggtttatgg aggtcctctt gtgtcccctc cccgcagagg tgtggtggct 600
gtggcatggt gccaagccgg gagaagctga gtcatgggta gttggaaaag gacatttcca 660
ccgcaaaatg gcccctctgg tggtggcccc ttcctgcagc gccggctcac ctcacggccc 720
cgcccttccc ctgccagcct agcgttgacc cgaccccaaa ggccaggctg taaatgtcac 780
cgggaggatt gggtgtctgg gcgcctcggg gaacctgccc ttctccccat tccgtcttcc 840
ggaaaccaga tctcccaccg caccctggtc tgaggttaaa tatagctgct gacctttctg 900
tagctggggg cctgggctgg ggctctctcc catcccttct ccccacacac atgcacttac 960
ctgtgctccc actcctgatt tctggaaaag agctaggaag gacaggcaac ttggcaaatc 1020
aaagccctgg gactaggggg ttaaaataca gcttcccctc ttcccacccg ccccagtctc 1080
tgtccctttt gtaggaggga cttagagaag gggtgggctt gccctgtcca gttaatttct 1140
gacctttact cctgcccttt gagtttgatg atgctgagtg tacaagcgtt ttctccctaa 1200
agggtgcagc tgagctaggc agcagcaagc attcctgggg tggcatagtg gggtggtgaa 1260
taccatgtac aaagcttgtg cccagactgt gggtggcagt gccccacatg gccgcttctc 1320
ctggaagggc ttcgtatgac tgggggtgtt gggcagccct ggagccttca gttgcagcca 1380
tgccttaagc caggccagcc tggcagggaa gctcaaggga gataaaattc aacctcttgg 1440
gccctcctgg gggtaaggag atgctgcatt cgccctctta atggggaggt ggcctagggc 1500
tgctcacata ttctggagga gcctcccctc ctcatgcctt cttgcctctt gtctcttaga 1560
tttggtcgta ttgggcgcct ggtcaccagg gctgctttta actctggtaa agtggatatt 1620
gttgccatca atgacccctt cattgacctc aactacatgg tgagtgctac atggtgagcc 1680
ccaaagctgg tgtgggagga gccacctggc tgatgggcag ccccttcata ccctcacgta 1740
ttcccccagg tttacatgtt ccaatatgat tccacccatg gcaaattcca tggcaccgtc 1800
aaggctgaga acgggaagct tgtcatcaat ggaaatccca tcaccatctt ccaggagtga 1860
gtggaagaca gaatggaaga aatgtgcttt ggggaggcaa ctaggatggt gtggctccct 1920
tgggtatatg gtaaccttgt gtccctcaat atggtcctgt ccccatctcc cccccacccc 1980
cataggcgag atccctccaa aatcaagtgg ggcgatgctg gcgctgagta cgtcgtggag 2040
tccactggcg tcttcaccac catggagaag gctggggtga gtgcaggagg gcccgcggga 2100
ggggaagctg actcagccct gcaaaggcag gacccgggtt cataactgtc tgcttctctg 2160
ctgtaggctc atttgcaggg gggagccaaa agggtcatca tctctgcccc ctctgctgat 2220
gcccccatgt tcgtcatggg tgtgaaccat gagaagtatg acaacagcct caagatcatc 2280
aggtgaggaa ggcagggccc gtggagaagc ggccagcctg gcaccctatg gacacgctcc 2340
cctgacttgc gccccgctcc ctctttcttt gcagcaatgc ctcctgcacc accaactgct 2400
tagcacccct ggccaaggtc atccatgaca actttggtat cgtggaagga ctcatggtat 2460
gagagctggg gaatgggact gaggctccca cctttctcat ccaagactgg ctcctccctg 2520
ccggggctgc gtgcaaccct ggggttgggg gttctgggga ctggctttcc cataatttcc 2580
tttcaaggtg gggagggagg tagaggggtg atgtggggag tacgctgcag ggcctcactc 2640
cttttgcaga ccacagtcca tgccatcact gccacccaga agactgtgga tggcccctcc 2700
gggaaactgt ggcgtgatgg ccgcggggct ctccagaaca tcatccctgc ctctactggc 2760
<210>10
<211>756
<212>DNA
<213>Homo sapiens
<400>10
tgtctttcct gcctgagctg acctgggcag gtcggctgtg gggtcctgtg gtgtgtgggg 60
agctgtcaca tccagggtcc tcactgcctg tccccttccc tcctcagatc attgctcctc 120
ctgagcgcaa gtactccgtg tggatcggcg gctccatcct ggcctcgctg tccaccttcc 180
agcagatgtg gatcagcaag caggagtatg acgagtccgg cccctccatc gtccaccgca 240
aatgcttcta ggcggactat gacttagttg cgttacaccc tttcttgaca aaacctaact 300
tgcgcagaaa acaagatgag attggcatgg ctttatttgt tttttttgtt ttgttttggt 360
tttttttttt tttttggctt gactcaggat ttaaaaactg gaacggtgaa ggtgacagca 420
gtcggttgga gcgagcatcc cccaaagttc acaatgtggc cgaggacttt gattgcacat 480
tgttgttttt ttaatagtca ttccaaatat gagatgcgtt gttacaggaa gtcccttgcc 540
atcctaaaag ccaccccact tctctctaag gagaatggcc cagtcctctc ccaagtccac 600
acaggggagg tgatagcatt gctttcgtgt aaattatgta atgcaaaatt tttttaatct 660
tcgccttaat acttttttat tttgttttat tttgaatgat gagccttcgt gccccccctt 720
cccccttttt tgtcccccaa cttgagatgt atgaag 756
<210>11
<211>856
<212>DNA
<213>Homo sapiens
<400>11
tgaacagact ccccatccca agaccccagc acacttagcc gtgttctttg cactttctgc 60
atgtcccccg tctggcctgg ctgtccccag tggcttcccc agtgtgacat ggtgtatctc 120
tgccttacag atcatgtttg agaccttcaa caccccagcc atgtacgttg ctatccaggc 180
tgtgctatcc ctgtacgcct ctggccgtac cactggcatc gtgatggact ccggtgacgg 240
ggtcacccac actgtgccca tctacgaggg gtatgccctc ccccatgcca tcctgcgtct 300
ggacctggct ggccgggacc tgactgacta cctcatgaag atcctcaccg agcgcggcta 360
cagcttcacc accacggccg agcgggaaat cgtgcgtgac attaaggaga agctgtgcta 420
cgtcgccctg gacttcgagc aagagatggc cacggctgct tccagctcct ccctggagaa 480
gagctacgag ctgcctgacg gccaggtcat caccattggc aatgagcggt tccgctgccc 540
tgaggcactc ttccagcctt ccttcctggg tgagtggaga ctgtctcccg gctctgcctg 600
acatgagggt tacccctcgg ggctgtgctg tggaagctaa gtcctgccct catttccctc 660
tcaggcatgg agtcctgtgg catccacgaa actaccttca actccatcat gaagtgtgac 720
gtggacatcc gcaaagacct gtacgccaac acagtgctgt ctggcggcac caccatgtac 780
cctggcattg ccgacaggat gcagaaggag atcactgccc tggcacccag cacaatgaag 840
atcaaggtgg gtgtct 856
<210>12
<211>1272
<212>DNA
<213>Homo sapiens
<400>12
aacagactcc ccatcccaag accccagcac acttagccgt gttctttgca ctttctgcat 60
gtcccccgtc tggcctggct gtccccagtg gcttccccag tgtgacatgg tgtatctctg 120
ccttacagat catgtttgag accttcaaca ccccagccat gtacgttgct atccaggctg 180
tgctatccct gtacgcctct ggccgtacca ctggcatcgt gatggactcc ggtgacgggg 240
tcacccacac tgtgcccatc tacgaggggt atgccctccc ccatgccatc ctgcgtctgg 300
acctggctgg ccgggacctg actgactacc tcatgaagat cctcaccgag cgcggctaca 360
gcttcaccac cacggccgag cgggaaatcg tgcgtgacat taaggagaag ctgtgctacg 420
tcgccctgga cttcgagcaa gagatggcca cggctgcttc cagctcctcc ctggagaaga 480
gctacgagct gcctgacggc caggtcatca ccattggcaa tgagcggttc cgctgccctg 540
aggcactctt ccagccttcc ttcctgggtg agtggagact gtctcccggc tctgcctgac 600
atgagggtta cccctcgggg ctgtgctgtg gaagctaagt cctgccctca tttccctctc 660
aggcatggag tcctgtggca tccacgaaac taccttcaac tccatcatga agtgtgacgt 720
ggacatccgc aaagacctgt acgccaacac agtgctgtct ggcggcacca ccatgtaccc 780
tggcattgcc gacaggatgc agaaggagat cactgccctg gcacccagca caatgaagat 840
caaggtgggt gtctttcctg cctgagctga cctgggcagg tcggctgtgg ggtcctgtgg 900
tgtgtgggga gctgtcacat ccagggtcct cactgcctgt ccccttccct cctcagatca 960
ttgctcctcc tgagcgcaag tactccgtgt ggatcggcgg ctccatcctg gcctcgctgt 1020
ccaccttcca gcagatgtgg atcagcaagc aggagtatga cgagtccggc ccctccatcg 1080
tccaccgcaa atgcttctag gcggactatg acttagttgc gttacaccct ttcttgacaa 1140
aacctaactt gcgcagaaaa caagatgaga ttggcatggc tttatttgtt ttttttgttt 1200
tgttttggtt tttttttttt ttttggcttg actcaggatt taaaaactgg aacggtgaag 1260
gtgacagcag tc 1272
<210>13
<211>531
<212>DNA
<213>Homo sapiens
<400>13
gagctccact gttctgggcg agggctgtga agaaagagta gtaagaagcg gtagtcggca 60
ccaaatcaca atggcaactg atttttagtg gcttctcttt gtggatttcg gaggagattt 120
tagatccaaa agtttcagga agaccctaac atggcccagc agtgcattga agaagttgat 180
catcgtgaat attcgcgtcc ccctttttgt taaacggggt aaattcagga atgcacatgc 240
ttcagcgtct aaaaccatta gcagcgctgc tacttaaaaa ttgtgtgtgt gtgtttaagt 300
ttccaaagac ctaaatatat gccatgaaac ttcaggtaat taactgagag tatattatta 360
ctagggcatt ttttttttaa ctgagcgaaa atatttttgt gcccctaaga acttgaccac 420
atttcctttg aatttgtggt gttgcagtgg actgaattgt tgaggcttta tataggcatt 480
catgggttta ctgtgctttt taaagttaca ccattgcaga tcaactaaca c 531
<210>14
<211>23
<212>DNA
<213>Homo sapiens
<400>14
gagctccact gttctgggcg agg 23
<210>15
<211>24
<212>DNA
<213>Homo sapiens
<400>15
gtgttagttg atctgcaatg gtgt 24
<210>16
<211>531
<212>DNA
<213>Homo sapiens
<400>16
gtgttagttg atctgcaatg gtgtaacttt aaaaagcaca gtaaacccat gaatgcctat 60
ataaagcctc aacaattcag tccactgcaa caccacaaat tcaaaggaaa tgtggtcaag 120
ttcttagggg cacaaaaata ttttcgctca gttaaaaaaa aaatgcccta gtaataatat 180
actctcagtt aattacctga agtttcatgg catatattta ggtctttgga aacttaaaca 240
cacacacaca atttttaagt agcagcgctg ctaatggttt tagacgctga agcatgtgca 300
ttcctgaatt taccccgttt aacaaaaagg gggacgcgaa tattcacgat gatcaacttc 360
ttcaatgcac tgctgggcca tgttagggtc ttcctgaaac ttttggatct aaaatctcct 420
ccgaaatcca caaagagaag ccactaaaaa tcagttgcca ttgtgatttg gtgccgacta 480
ccgcttctta ctactctttc ttcacagccc tcgcccagaa cagtggagct c 531
Claims (8)
1. A DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection is characterized in that the DNA molecular weight standard contains 6 DNA fragments, and the lengths of the 6 DNA fragments are respectively as follows: 2.8kb, 2.9kb, 3.3kb, 5.2kb, 5.3kb and 5.7kb, each of which comprises a fragment capable of binding to a probe directed against FMR1 gene, wherein none of the 6 DNA fragments contains an cleavage site for EagI or EcoRI.
2. The DNA molecular weight standard according to claim 1, wherein the fragment to which the probe binds is located at the 3' end of each fragment.
3. The DNA molecular weight standard of claim 1, wherein the probe for FMR1 gene has a nucleotide sequence as set forth in SEQ ID NO: shown at 16.
4. The DNA molecular weight standard according to claim 3, wherein the sequence of the probe-binding fragment is as set forth in SEQ ID NO: shown at 13.
5. The DNA molecular weight standard of any one of claims 1 to 4, wherein the DNA molecular weight standard comprises 6 DNA fragments having a nucleotide sequence as set forth in SEQ ID NO: 1 to 6.
6. The method for preparing a DNA molecular weight standard according to claim 5, comprising the steps of:
s1, synthesizing a nucleotide sequence shown as SEQ ID NO: 1 to 6;
s2, respectively connecting the DNA fragments of S1 into cloning vectors to obtain recombinant plasmids;
s3, carrying out enzyme digestion on the recombinant plasmid to obtain a DNA fragment containing the DNA fragment of S1;
and S4, mixing the DNA fragments obtained in the step S3 according to copy ratio and fixing the volume.
7. Use of a DNA molecular weight standard according to any one of claims 1 to 4 in the detection of southern blot hybridization of Fragile X syndrome.
8. Use of the DNA molecular weight standard of any one of claims 1 to 4 in the preparation of a fragile X syndrome southern blot hybridization assay kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911167650.4A CN110923305B (en) | 2019-11-25 | 2019-11-25 | DNA molecular weight standard suitable for southern blot hybridization detection of fragile X syndrome |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911167650.4A CN110923305B (en) | 2019-11-25 | 2019-11-25 | DNA molecular weight standard suitable for southern blot hybridization detection of fragile X syndrome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110923305A true CN110923305A (en) | 2020-03-27 |
| CN110923305B CN110923305B (en) | 2023-12-29 |
Family
ID=69850984
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911167650.4A Active CN110923305B (en) | 2019-11-25 | 2019-11-25 | DNA molecular weight standard suitable for southern blot hybridization detection of fragile X syndrome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923305B (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2672618A1 (en) * | 1991-02-13 | 1992-08-14 | Centre Nat Rech Scient | Nucleic acid fragment of X chromosome region |
| WO1992014840A1 (en) * | 1991-02-13 | 1992-09-03 | Institut National De La Sante Et De La Recherche Medicale | Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x |
| US5316908A (en) * | 1990-07-13 | 1994-05-31 | Life Technologies, Inc. | Size markers for electrophoretic analysis of DNA |
| AU2007307320A1 (en) * | 2006-10-05 | 2008-04-17 | Quest Diagnostics Investments Incorporated | Nucleic acid size detection method |
| CN102304508A (en) * | 2011-07-29 | 2012-01-04 | 上海捷瑞生物工程有限公司 | Method for preparing DL2000 DNA molecular weight marker as well as product and applications thereof |
| CN103981253A (en) * | 2014-03-27 | 2014-08-13 | 江苏佰龄全基因生物医学技术有限公司 | PCR kit used for detecting CGC replication number and AGG insert information of fragile X syndrome |
| CN106399296A (en) * | 2016-09-05 | 2017-02-15 | 公安部物证鉴定中心 | Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method |
| CN106906231A (en) * | 2017-04-10 | 2017-06-30 | 济南大学 | A kind of even number DNA molecular amount standard and preparation method thereof |
| CN108546755A (en) * | 2018-05-09 | 2018-09-18 | 广州市达瑞生物技术股份有限公司 | Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application |
-
2019
- 2019-11-25 CN CN201911167650.4A patent/CN110923305B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5316908A (en) * | 1990-07-13 | 1994-05-31 | Life Technologies, Inc. | Size markers for electrophoretic analysis of DNA |
| FR2672618A1 (en) * | 1991-02-13 | 1992-08-14 | Centre Nat Rech Scient | Nucleic acid fragment of X chromosome region |
| WO1992014840A1 (en) * | 1991-02-13 | 1992-09-03 | Institut National De La Sante Et De La Recherche Medicale | Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x |
| AU2007307320A1 (en) * | 2006-10-05 | 2008-04-17 | Quest Diagnostics Investments Incorporated | Nucleic acid size detection method |
| CN102304508A (en) * | 2011-07-29 | 2012-01-04 | 上海捷瑞生物工程有限公司 | Method for preparing DL2000 DNA molecular weight marker as well as product and applications thereof |
| CN103981253A (en) * | 2014-03-27 | 2014-08-13 | 江苏佰龄全基因生物医学技术有限公司 | PCR kit used for detecting CGC replication number and AGG insert information of fragile X syndrome |
| CN106399296A (en) * | 2016-09-05 | 2017-02-15 | 公安部物证鉴定中心 | Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method |
| CN106906231A (en) * | 2017-04-10 | 2017-06-30 | 济南大学 | A kind of even number DNA molecular amount standard and preparation method thereof |
| CN108546755A (en) * | 2018-05-09 | 2018-09-18 | 广州市达瑞生物技术股份有限公司 | Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application |
Non-Patent Citations (4)
| Title |
|---|
| BRUCE E HAYWARD ET AL.: "Recent advances in assays for the fragile X-related disorders", vol. 36, no. 10, pages 1313 - 1327, XP036324361, DOI: 10.1007/s00439-017-1840-5 * |
| JEAN AMOS WILSON EL AL.: "Consensus Characterization of 16 FMR1 Reference Materials: A Consortium Study", vol. 10, no. 1, pages 2 - 12, XP008162999, DOI: 10.2353/jmoldx.2008.070105 * |
| 常东 等: "Southern印迹检测智力低下患者的脆性Ｘ基因", vol. 23, no. 5, pages 332 * |
| 王文华 等: "一种简便的DNA定量分子量标准的制备", vol. 20, no. 20, pages 62 - 64 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110923305B (en) | 2023-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5582979A (en) | Length polymorphisms in (dC-dA)n.(dG-dT)n sequences and method of using the same | |
| US5652128A (en) | Method for producing tagged genes, transcripts, and proteins | |
| CN114381455A (en) | Sequencing control | |
| KR20110004860A (en) | Aberrant mitochondrial dna, associated fusion transcripts and hybridization probes therefor | |
| CN110628894A (en) | Targeted capture sequencing kit for Parkinson's disease gene mutation detection and application thereof | |
| CN113355332B (en) | HEG1 gene mutant and application thereof | |
| CN110387400B (en) | Parallel liquid phase hybridization capture method for simultaneously capturing positive and negative sense double chains of genome target region | |
| CN104726604B (en) | Decayed-sample degradation DNA (deoxyribonucleic acid) detection method and application thereof | |
| CN110923305B (en) | DNA molecular weight standard suitable for southern blot hybridization detection of fragile X syndrome | |
| JPH05211897A (en) | Nucleotide sequence | |
| US20040091881A1 (en) | Diagnosis of diseases which are associated with cd24 | |
| US20040197786A1 (en) | Method of examining steroid resnponsiveness | |
| CN111378738B (en) | Primer, kit and method for detecting HTT and JPH3 genes | |
| CN109750098B (en) | ATP7B gene large fragment deletion detection kit and detection method | |
| CN108913761B (en) | Kit for screening hereditary liver diseases | |
| Hess et al. | Chromosomal locations of the genes for the beaded filament proteins CP 115 and CP 47 | |
| US7148011B2 (en) | Method of testing for allergic diseases | |
| CN112899364B (en) | Primer probe composition for detecting LMNA gene mutation and application thereof | |
| CN117487907B (en) | KCNH2 gene mutant, mutant protein, reagent, kit and application | |
| CN114381513B (en) | Biomarker related to X-linked lymphoproliferative disorder and application thereof | |
| CN112940099B (en) | RhD-T163P mutant and detection thereof | |
| WO2002066639A1 (en) | Brain aneurysm-sensitive gene | |
| CN114410771B (en) | Primer library combination, kit and method for detecting neonatal genetic disease genes based on first-generation sequencing platform | |
| US20040023263A1 (en) | Method of testing for allergic diseases | |
| US20040058351A1 (en) | Method of examining for allergic disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |