WO1992014840A1 - Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x - Google Patents

Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x Download PDF

Info

Publication number
WO1992014840A1
WO1992014840A1 PCT/FR1992/000145 FR9200145W WO9214840A1 WO 1992014840 A1 WO1992014840 A1 WO 1992014840A1 FR 9200145 W FR9200145 W FR 9200145W WO 9214840 A1 WO9214840 A1 WO 9214840A1
Authority
WO
WIPO (PCT)
Prior art keywords
fragile
fragments
dna
nucleic acid
fragment
Prior art date
Application number
PCT/FR1992/000145
Other languages
French (fr)
Inventor
Jean-Louis Mandel
François Rousseau
Anne Vincent
Dominique Heitz
Isabelle +Di Oberle
Original Assignee
Institut National De La Sante Et De La Recherche Medicale
HEIDET, Stéphane +hm
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from FR9101684A external-priority patent/FR2672618B1/en
Application filed by Institut National De La Sante Et De La Recherche Medicale, HEIDET, Stéphane +hm filed Critical Institut National De La Sante Et De La Recherche Medicale
Priority to DE69225797T priority Critical patent/DE69225797T2/en
Priority to AU14136/92A priority patent/AU671418B2/en
Priority to CA002104110A priority patent/CA2104110C/en
Priority to JP4506537A priority patent/JPH06507310A/en
Priority to EP92907135A priority patent/EP0580621B1/en
Publication of WO1992014840A1 publication Critical patent/WO1992014840A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • Mental retardation syndrome with fragile X is an X chromosome-related disease that affects approximately one in every 1,500 boys. Women vectors, about one in seven hundred and fifty, have a 30% risk of having mild or even moderate debility. Mental retardation syndrome with fragile X is the most common cause of inherited mental retardation.
  • the diagnosis of the disease is established by a delicate cytogenetic analysis which requires particular culture conditions and the analysis of 50 to 100 mitoses, because the fragile site detectable cytogenetically is only present in 5 to 50% of mitoses.
  • the diagnosis of vector women is even more difficult since only 50 to 60% of these women express the fragile site, in a generally low proportion of mitoses.
  • the difficulty of the cytogenetic test means that it is not reliably performed except in a limited number of laboratories; moreover, the diagnosis of the disease is often only made after the birth of a second affected child in the same family; however, the early establishment of such a diagnosis is essential for implementing investigations allowing prenatal diagnosis and screening of vector women who transmit the disease to 50% of their male children, in families at risk.
  • the high frequency of the disease and the early genetic importance justify systematic neonatal screening for the disease.
  • the present invention specifically aims to provide new means of investigation and diagnosis, based on the direct study of DNA, allowing rapid diagnosis of the disease and applicable to a large number of patients.
  • hereditary transmission of the disease is unusual compared to other diseases linked to the X chromosome. It has been found that phenotypically normal men transmit the mutation to their daughters, who rarely exhibit the symptoms of the disease, on the other hand. sons and daughters of these women have a high rate of onset of the disease (Sherman et al, Hum. Genêt. (1985)). Several hypotheses have been proposed to explain this phenomenon.
  • the invention also provides means for the detection, in non-sick persons, of anomalies and in particular of mutations at the level of the fragile X site.
  • the genetic markers proposed in the prior art can only be used to monitor the transmission of the mutation in families where the disease has already been diagnosed by a cytogenetic study, it this is an indirect diagnosis by link study; it is generally necessary to use several markers on either side of the disease locus, and these markers are only informative in varying proportions of families.
  • F. Rousseau et al (Am. J. Hum. Genêt. (1991) 48: 108-116) report the detection of seven regions close to the fragile X locus (FRAXA). Two of these regions between DXS369 and DXS296 contain the genetic markers closest to FRAXA known to date, one of these regions contains two probes detecting a polymorphism.
  • the inventors cloned as an artificial yeast chromosome (YAC), the approximately 225 kb DNA segment defined between probes St677 and Do33, and located in the Xq27-q28 region of the human X chromosome. Probes from this segment have been prepared for the analysis of mutations, DNA methylations and genes involved in fragile X syndrome.
  • YAC yeast chromosome
  • CpG sites these are for example sites containing the CpG dinucleotide, such as Hpall, CCGG or Hhal, GCGC, or sites capable of partially covering a CpG dinucleotide such as Avall GG (A or T) CC, in a CGG (A or T) CC or GG (A or T) CGG or even BanI (GG Py Pu CC) sequence; the inventors have demonstrated a surprising correlation between the clinical expression of the disease and the inhibition of the digestibility of CpG sites in the region of approximately 20 kb around the 125 kb position defined on the cloned DNA segment through the inventors, approximately 100 kb from the Do33 probe
  • probes are also suitable for the detection of the fragile X locus, without clinical manifestation of the disease, which results from the mutation of the nucleic acid of the X chromosome region described above, by extension of the DNA.
  • the lengthening can indeed be more or less significant depending on whether the subject is only a carrier of the anomaly or whether he has clinical signs of mental retardation associated with the fragile X anomaly.
  • the probes of the invention advantageously allow the detection of premutations corresponding to an elongation of the nucleic acid from approximately 100 bp (base pairs) to approximately 500 bp and the detection of complete mutations corresponding to an elongation of the nucleic acid at least around 500bp, up to over 3000bp.
  • Premutations generally correspond to a subject carrying the anomaly without clinical manifestation, whereas mutations by extension greater than 500 bp are normally associated with the presence of clinical signs.
  • mutation will be used to designate the two situations mentioned above and the distinction between mutations associated or not with clinical signs will be made if necessary.
  • Probes of interest in the search for a mutation in the fragile X region without clinical expression of mental retardation are, for example the so-called probes adjacent to the CpG site.
  • Figure 1 is a schematic representation of the X chromosome region around the 125 kb position located about 100 kb from the Do33 probe in direction of the centromere. On the scale, the location of the probes St677, 2-34, and Do33 is shown. In accordance with the scale, the clones YAC 141 H5 and 209G4 corresponding to the above-mentioned DNA segments have been shown, and the location of restriction sites Eaql, BssII etc., has been represented on the line of clone 141 H5. The indication CpG on the line of clone 141 H5 corresponds to the region whose methylation is abnormal in patients with mental retardation with fragile X.
  • This phenomenon of inhibition of digestibility of CpG sites can be detected by the Southern Blot method, using probes originating from the 20 kb region around the 125 kb position defined in FIG. 1, probes close to or containing the sites to CpG.
  • the inventors have also demonstrated, by the same method, anomalies in the migration of DNA fragments, not necessarily linked to the phenomenon of methylation, anomalies which are characteristic of subjects carrying a fragile X mutation.
  • the germinal mutations responsible for fragile X syndrome and capable of being transmitted to the offspring are located in the region of the X chromosome defined between the probes St677 and Do33, and the methylation of the CpG sites in this region is a consequence not obligatory of these mutations, consequence which is linked to the clinical expression of the disease.
  • the invention therefore relates to any nucleic acid fragment originating from the Xq27-q28 region of the X chromosome, adjacent to or containing the CpG sites, located in the region of 10 to 20 kb around the position 125 kb.
  • the invention relates to any nucleic acid fragment included in the DNA segment of approximately 225 kb, defined between the probes St677 and Do33.
  • nucleic acid fragments comprise at least 15 bp or nucleotides.
  • the nucleic acid sequences of the invention are DNA, cDNA or even mRNA sequences.
  • nucleic acid sequences of the invention are individualized sequences and therefore they are not in their natural environment.
  • the cDNA corresponding to the nucleic acid sequences of the invention can be obtained according to conventional techniques by screening a library of available human cDNA, with a nucleic acid fragment of the invention, the screening making it possible to detect cDNA fragments which selectively hybridize with the nucleic acid fragment of the invention.
  • This region of the X chromosome is involved in fragile X syndrome and the probes specific for this region are advantageously used to detect the presence of methylation abnormalities related to the clinical expression of the disease, or to detect the presence of mutations responsible for the fragile X syndrome and its transmission, or to locate, identify and analyze the expression of the gene (s) involved in fragile X syndrome.
  • These probes can generally be used to detect DNA abnormalities that are the direct or indirect consequence of mutations associated with fragile X syndrome.
  • the invention therefore relates to any nucleotide probe capable of hybridizing selectively with a nucleic acid fragment included in the DNA segment defined between the St677 and Do33 probes and more particularly with a nucleic acid fragment adjacent to or containing the sites at CpG in the region of about 20 kb around the 125 kb position.
  • the probes of the invention specifically hybridize under appropriate stringency conditions with the abovementioned nucleic acid fragments but do not hybridize with other regions of the human genome under the same hybridization conditions.
  • a support such as a nitrocellulose filter or a nylon membrane
  • a pre-hybridization solution having the following composition: 40% formamide, * 0.9 M NaCl; 200 ⁇ g / ml of salmon sperm DNA; 50 mM sodium phosphate pH 6.5; 4% dextran sulfate; 0.08% (weight / volume) of ficoll and of polyvinyl pyrrolidone, hybridization in a solution identical to the pre-hybridization solution, further comprising at least one nucleotide probe according to the invention advantageously labeled, at a temperature at 42 ° C and for 18 hours, 4 successive washes, revealing the hybrid possibly formed by any method suitable for labeling the probe.
  • the hybridization conditions defined above constitute preferred conditions, but are in no way limiting and can be
  • the probes of the invention are advantageously marked with any marker conventionally used. They can be marked using a radioactive tracer such as 32 P, 35 S, 125 I ,, 14 C and the radioactive marking can be carried out according to any method known to those skilled in the art.
  • a radioactive tracer such as 32 P, 35 S, 125 I ,, 14 C and the radioactive marking can be carried out according to any method known to those skilled in the art.
  • the probes can be labeled in 3 ′ by addition of one or more deoxynucleotides or ribonucleotides or of a dideoxynucleotide, marked in alpha by 32 P, in the presence of the Terminal Deoxynucleotidyl Transferase, or in 5 ′ by transfer of a group radioactive phosphate of a deoxynucleotide or free dideoxynucleotide labeled in the gamma position, in the presence of T4 DNA ligase. Probes can still be labeled using DNA polymerase by "Nick Translation "or” Random Priming "or” Polymerase Chain Reaction ".
  • the method of detection of hybridization will depend on the radioactive marker used and may be based on autoradiography, liquid scintillation, gamma counting or any other technique making it possible to detect the emission of the radiation emitted by the radioactive marker.
  • non-radioactive labeling can also be used, by combining with the probes groups having immunological properties such as an antigen, a specific affinity for certain reagents such as a ligand, physical properties such as fluorescence or luminescence, properties allowing the completion of the reactions enzymes like an enzyme or an enzyme substrate.
  • Non-radioactive labeling can also be done directly by chemical modification of DNA, such as photobiotinylation or sulfonation.
  • the probes of the invention are used for the in vitro detection, mutations responsible for fragile X syndrome, as well as anomalies in methylation of CpG sites or other DNA anomalies resulting from the presence of these mutations and associated to the syndrome.
  • the mutation detection aims to follow the family transmission and allows in particular a diagnosis of the non affected people likely to transmit the disease, such as women vectors or normal men transmitters of the mutation.
  • methylation abnormalities allows a diagnosis of the disease, expressed clinically or likely to be expressed in the context of an antenatal or birth diagnosis.
  • the methods for detecting mutations responsible for fragile X syndrome, as well as abnormal methylation of CpG sites, or other DNA abnormalities associated with the syndrome rely on the use of at least one probe according to the invention and at least one suitable restriction enzyme so that the fragment detected by the probe is different depending on whether or not it contains the methylation mutation or anomaly or any other anomaly DNA.
  • Such a process can be carried out according to the so-called "Southern Blot” method (Sa brook, Fritsh and Maniatis; Molecular cloning: A laboratory manual (1989), Cold Spring Harbor Laboratory Press), comprising the following steps: treatment of genomic DNA extracted for example from leukocytes or chorionic villi or from any other source of genomic DNA, by at least one specific restriction enzyme, under conditions allowing the obtaining of restriction fragments resulting from the cleavage of DNA at its level restriction sites recognized by said enzyme; separation of the fragments by electrophoresis; bringing into contact a nucleic probe according to the invention capable of hybridizing specifically with the preceding fragments under conditions allowing the formation of hybridization complexes; detection of hybridization complexes; measurement of the size of the restriction fragments engaged in the hybridization complexes.
  • the search for methylation anomalies for the in vitro diagnosis of fragile X syndrome in patients patients suffering from mental retardation is advantageously carried out according to the preceding method using at least one restriction enzyme with a site sensitive to methylation, with at least one probe according to the invention advantageously labeled.
  • the above-mentioned method can be carried out with a single methylation-sensitive restriction site enzyme such as BssHII, Eaql, Avall, BanI; or again with two enzymes, one with a restriction site sensitive to methylation and the other with a restriction site not sensitive to methylation.
  • the probes of the invention used for hybridization with the fragments obtained are advantageously adjacent to or contain the site for the enzyme with a site sensitive to methylation.
  • the Southern Blot method is also used to detect mutations associated with fragile X syndrome, or mutations existing in vector vectors, without clinical signs. These mutations are, for example, DNA sequence deletions or insertions, or other DNA abnormalities such as conformational or replicative abnormalities, which are consequential to these mutations.
  • the detection of these mutations for the in vitro diagnosis of fragile X syndrome or more generally of the mutation of the fragile X site, in patients with or without mental retardation is carried out according to the Southern Blot method by subjecting the genomic DNA to a digestion with any suitable restriction enzyme not necessarily sensitive to methylation such as EcoRI or HindIII.
  • the restriction fragments are demonstrated by hybridization with a probe of the invention advantageously labeled and the abnormal electrophoretic migration of said fragments is correlated either with the clinical expression of the disease, or with the presence of the mutation even in the very absence of clinical expression of the disease.
  • This abnormal migration of the fragments corresponds to the presence of fragments elongated by the insertional mutation of a nucleotide sequence.
  • the invention also relates to the kits for implementing the above method.
  • nucleic acid fragments of the invention those of 20 to 30 nucleotides can be advantageously used as primers in a method of genetic amplification of a nucleic acid fragment of the 20 kb region around the position 125.
  • the amplification may be intended to reveal the presence of mutations in this region, in particular by lengthening of the DNA, or / and determined for the detection of a fragment containing the CpG sites.
  • This amplification method consists in specifically fixing by hybridization on the genomic DNA extracted for example from leukocytes, two oligonucleotides judiciously chosen from those containing the nucleic acid fragments of 20 to 30 nucleotides of the invention which are adjacent to the fragment to amplify, then implement an enzymatic extension process using DNA polymerase, followed by a denaturation process, and repeat the hybridization-extension-denaturation cycle known as the PCR "Polymerase cycle Chain Reaction ", a sufficient number of times to increase the quantity of the fragment to be amplified in an exponential proportion compared to the number of cycles carried out.
  • the amplification method described can be applied to the detection of DNA abnormalities which are the consequence of the presence of the above mutations.
  • the in vitro diagnosis of fragile X syndrome, in particular in patients with mental retardation, or in vector vectors is advantageously carried out by genetic amplification carried out in parallel on the DNA digested with at least one restriction enzyme chosen from the enzymes not sensitive to methylation or on the contrary sensitive to methylation, and on undigested DNA. Analysis for diagnostic purposes is done by comparing the amplification product of undigested DNA to that of DNA digested with the chosen restriction enzyme (s).
  • This analysis of the amplification products can be carried out by visualization of the fluorescence induced by ethidium bromide, after electrophoresis on agarose or polyacrylamide gel, or by the detection of radioactive or non-radioactive labeling, such as by a system. biotin-avidin, priming oligonucleotides or nucleotides incorporated into the amplified fragment.
  • the number of amplification cycles is limited so as to maintain a linearity of the amplification and therefore a quantitative estimate of the digestibility of the sites of the enzyme or enzymes used.
  • internal markers are used, in particular other fragments of the co-amplified genome also containing a site of the chosen enzyme, as a witness for the action of the restriction enzyme, and as a witness for the efficiency of amplification, a fragment not containing such a site.
  • the quantitative measurement of the characteristic fragments of the mutations, in particular resulting from the elongation, as well as the quantitative measurement of the methylation of the genomic DNA at the site studied can be done by adapting the method. amplification described above, in particular by using in addition to the oligonucleotides according to the invention, so-called “linker” oligonucleotides and DNA Ligase, a method called “Ligation mediated PCR” described by Steigerwald et al (Nucleic ACids Res. (1980 ) 18: 1435-1439).
  • Deletions or any other rearrangement constituting mutations liable to give rise to fragile X syndrome, in particular by lengthening of nucleic acid can also be detected by the so-called multiplex DNA amplification method, using pairs of oligonucleotides which can be mixed in a single reaction to amplify several fragments of the region around the 125 kb position and to detect the disappearance or modification of some of these fragments.
  • the detection of point mutations is advantageously carried out by amplification of the DNA segments, followed by an analysis by SSCP (single strand conformation polymorphism) or DGGE (denaturing gradient gel electrophoresis) methods, or even by detection of heteroduplex.
  • kits for implementing the above method include: oligonucleotides labeled or not labeled for the amplification of nucleic acid fragments exhibiting an anomaly resulting from a mutation, in particular by lengthening of the DNA and / or of nucleic acid fragments containing a site sensitive to methylation according to the invention; oligonucleotides labeled or not for the amplification of the control nucleic acid segments; so-called "linker”oligonucleotides; - buffers, nucleotides and enzymes suitable for amplification.
  • a group of probes which are particularly advantageous for carrying out the invention includes probes, the detailed description of which is given in the experimental part.
  • These probes include the fragments 9B12.3 (now designated StB12.3), 9B12.5 (StB12.5), 9B12.4, 9B12.2 and 9B12.1 located in relation to the DNA located between the probes Do33 and St677 , represented in FIG. 2.
  • Other probes are the stA22 (Avall-Avall) fragments of approximately 1500bp, stX21 of approximately 3800bp and stX21E (centromeric of the Eaql site).
  • the 9B12.3 probe can be used to detect anomalies at the fragile X site of nucleic acid fragments, and more particularly mutations by lengthening of the DNA, after a step of digestion with the enzyme of EcoRI restriction.
  • FIG. 7 A diagram of the results obtained on restriction fragments resulting from digestion with EcoRI, detected by the probe 9B12.3, showing a normal or mutated fragment is given in FIG. 7.
  • probes 9B12.3 (stB12.3) and 9B12.5 (stB12.5) is shown in Figure 8, with its complementary sequence.
  • the probes of the invention also allow access to the region in which the gene or genes involved in the clinical expression of fragile X syndrome are located. Indeed, the identification of CpG sites such as BssHII, EagI, SacII in the region close to the 125 kb position, indicates the presence of adjacent genes, the expression of which is controlled by this region (CpG islet).
  • the probes corresponding to these genes are useful for the detection of the corresponding messenger RNAs, or for the construction of vectors for expression of the corresponding proteins for therapeutic application or for the production of specific antibodies which may also be used in diagnosis .
  • a fragment according to the invention is characterized in that it selectively hybridizes with an mRNA present in human cells, for example leukocytes and in that it corresponds to a gene whose 5 'end is contained or adjacent to the CpG island in position 125 kb on the genetic map shown in Figure 2A.
  • Another particular fragment of the invention is characterized in that it is included in the DNA defined between the Do33 probe and the 125 kb position at approximately 100 kb of the Do33 probe of the Xq27-q28 region of the X chromosome, and that it selectively hybridizes with an mRNA present in human cells, for example leukocytes.
  • the invention relates to any recombinant DNA containing a nucleic acid fragment of the invention associated with any sequence allowing transcription and / or translation in the host cell into which said recombinant DNA is capable of being introduced.
  • the invention therefore also relates to the cloning and expression vectors containing one of the nucleic acid fragments of the invention.
  • the introduction of the recombinant DNA is advantageously carried out using a vector, in particular of the plasmid type, able to replicate in the host cell and to allow the transcription of the corresponding RNA and the expression of the proteins. encoded by the nucleic acid fragment contained in the recombinant DNA.
  • the host cells mentioned above can be prokaryotic cells, in particular E. coli cells, or, more advantageously, eukaryotic cells, which make it possible to obtain glycosylated and mature proteins (yeasts, CHO cells, or insect cells infected with bacculovirus). These proteins can advantageously be used for the preparation of specific antibodies useful for the diagnosis of fragile X syndrome and in therapeutic applications.
  • DNA segments corresponding to probes St677 and Do33 can be obtained from human DNA by genetic amplification using the following oligonucleotides:
  • the amplification conditions in a standard medium are as follows:
  • the probes of the invention were obtained by subcloning the nucleic acid fragments of the invention originating from the digestion of DNA segments contained in the region of approximately 225 kb defined between the probes St677 and Do33, and located in the Xq27-q28 region of the human X chromosome, cloned as an artificial yeast chromosome (YAC) and represented in FIG. 1.
  • YAC yeast chromosome
  • subcloning aims to obtain specific probes for fragments located in the region of 20 kb around the position 125 kb and corresponding therefore specifically to the nucleic acid fragments adjacent to or comprising the CpG sites.
  • a probe is obtained by subcloning of fragments prepared by double digestion Eaql, B ll of the clone 141H5.
  • the probe obtained 9B12 corresponds to an Eagl-Bgll fragment of approximately 7 kb containing the Eaql site at the position 125 kb on the map of FIG. 1.
  • FIG. 2 is a diagrammatic representation of the map of the probe 9B12 and of its subfragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 and 9B12.5, oriented inversely to FIG. 1. This figure has the following 7 lines:
  • line (1) is a scale in kb on which is mentioned in 0 the position 125 kb defined on the map of the clone segment of FIG. 1 between the probes St677 and Do33 at approximately 100 to 125 kb from the probe Do33.
  • line (2) is a representation in agreement with the scale of the probe 9B12 and its subfragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 and 9B12.5.
  • line (3) represents the location, in agreement with the scale, of the BanI sites (GGPyPuCC) and in particular the polymorphic BanI site noted RFLP and the BanI site sensitive to methylation noted Me.
  • line (5) represents the location, in accordance with the scale of line (1), of the BglII sites (AGATCT).
  • - line (6) represents the location, in line with the scale of line (1), of the EcoRI sites (GAATCC).
  • - line (7) represents the location, in accordance with the scale of line (1), of the HindIII sites (AAGCT).
  • the BanI, XmnI and EcoRI site maps correspond to altered fragments in carriers of the fragile X mutation.
  • Genomic DNA extracted from leukocytes from a patient with mental retardation is cut by the enzymes Avall, BanI or XmnI.
  • the DNA fragments obtained are analyzed by electrophoresis on 0.9% agarose gel in TAE buffer, then transferred to a nylon membrane.
  • the membrane on which the DNA fragments are fixed is subjected to a pre-hybridization treatment at 42 "C for 2 hours with a solution having the following composition: 40% formamide; 0.9 M NaCl; 200 ⁇ g / ml d '' Salmon sperm DNA; 50 mM sodium phosphate pH 6.5; 4% dextran sulfate; 0.8% (weight / volume) of ficoll and polyvinyl pyrrolidone; then the pre-hybridization solution is replaced by a hybridization solution identical to the pre-hybridization solution, and further comprising the probe 9B12.3 labeled with dCTP alpha ⁇ P and of specific activity 2 10 B dpm / ⁇ g; after incubation for 18 hours at 42 "C and successive washings with a 0.5 SSC solution at 65 ° C., autoradiography is carried out at -80 ° C.
  • FIG. 3 is a schematic representation of a autoradiography image on 0.9% agarose gel, of DNA of leukocytes or chorionic villi of normal men (1 and 5), of a man with X fragile (3), of a vector woman (4) and of a normal woman, digested by BanI and revealed by the probe 9B12.3.
  • FIG. 4 is a schematic representation of a autoradiography image on 0.9% agarose gel, of chorionic villus DNA from a normal man (2), from a man with fragile X (3) , of a fetus with fragile X, digested with BanI and revealed by the probe 9B12.3.
  • the 9B12.3 probe detects in the genomic DNA of a normal man, after digestion with the enzyme BanI, either a single fragment of 2.9 kb (allele 1) or two fragments of 2.3 and 0.6 kb (allele 2).
  • BanI enzyme-catalyzed kinase
  • the existence of two alleles is due to the presence of a polymorphic BanI site indicated RFLP in FIG. 2.
  • the 2.9 kb fragment is replaced more or less completely by a 3.5 kb fragment.
  • the 0.6 kb fragment is replaced more or less completely by a 1.2 kb fragment.
  • the anomaly was detected not only on DNA from leukocytes, but also on DNA from chorionic villi of fetuses carrying a fragile X mutation. It can therefore be used in postnatal or antenatal diagnosis in males.
  • fragments of 3.5 kb and 1.2 kb can be detected in normal women (methylation of the BanI site on the inactive X chromosome). However, their intensity appears stronger in women vectors with a clinical or cytogenetic expression of fragile X syndrome.
  • FIG. 5 is a schematic representation of a autoradiography image on 0.9% agarose gel, of DNA of leukocytes of normal men (1 and 10), of men with mental retardation linked to fragile X (3, 4, 6, 9), vector women (5, 7, 8) and a normal woman (2), digested with XmnI and revealed by the probe 9B12.3
  • the 9B12.3 probe detects a 9 kb fragment in men and women as well as in carriers of a fragile X mutation not expressing the disease clinically or cytogenetically.
  • the 9 kb fragment is replaced in whole or in part by fragments of apparent size greater than 10 kb. The appearance of such fragments is also characteristic of female vectors with clinical and / or cytogenetic expression.
  • FIG. 6 is a schematic representation of an autoradiography image on 0.9% agarose gel, of DNA of leukocytes of normal women (9, 12, 13) and of vector vectors (1 to 8, 10 and 11) of the fragile X mutation not all expressing clinical or cytogenetic signs, digested with EcoRI and revealed by the probe 9B12.3
  • the 9B12.3 probe detects an EcoRI fragment of approximately 6 kb in a normal man or a normal woman.
  • an additional larger fragment, of variable size according to the individuals (6 to 7 kb) is present. This anomaly appears in vector women without clinical and / or cytogenetic expression, and can therefore be used for the diagnosis of vector women.
  • the normal fragment is replaced by a fragment or series of fragments of larger apparent size. Very similar results are obtained with the enzyme HindIII.
  • FIG. 9 is another representation of the detection of mutations at the level of the fragile X region, by digestion of the DNA with EcoRI using the probe stB12.3.
  • Figure 9 Detection of fragile X mutations in genomic DNA digestion products by EcoRI.
  • the leukocyte DNA was fully digested with EcoRI.
  • the arrows indicate the size of the normal fragment (5.2 kb) and certain mutated fragments.
  • On the left ⁇ refers to the increase in size of the mutated fragment.
  • the symbols describing the subjects and their relationships within the family are presented above. The squares and circles represent men and women respectively. Open symbols that are not cut in half indicate subjects who are apparently normal and have not been tested cytogenetically. For symbols cut in half, the right part represents the sequence of the fragile X site and the left part the degree of mental retardation.
  • the symbols contained in a triangle correspond to samples obtained from a fetus.
  • the dotted symbols show subjects for which EcoRI digestion has been carried out and which do not provide information to clarify the family relationship of the other subjects.
  • the sample on line 22 had a weak cloud at 7.5 kb in the EcoRI digestion product. This cloud is more visible as a band at 3 kb in the BqlII digestion product from the same sample, shown on the right; it is located just above the normal BqlII fragment which is 12 kb in length.
  • the genomic DNA extracted from leukocytes of a patient suffering from mental retardation is subjected to a digesiton by an enzyme with a site sensitive to methylation such as Avall, BanI or XmnI and the amplification is carried out in parallel on the genomic DNA digested with the methylation sensitive restriction enzyme, and on undigested DNA.
  • an enzyme with a site sensitive to methylation such as Avall, BanI or XmnI
  • Two oligonucleotides of 20 to 30 nucleotides adjacent to the genomic DNA fragment to be amplified, containing the site for the enzyme sensitive to methylation, are hybridized with the DNA subjected to digestion and the DNA not subjected to digestion. Then an enzymatic extension process using DNA polyerase, followed by a denaturation process is implemented; the hybridization-extension-denaturation cycle is repeated a number of times sufficient to increase the quantity of the fragment containing the CpG sites in an exponential proportion relative to the number of cycles carried out.
  • the number of amplification cycles is limited so as to maintain a linearity of the amplification and therefore a quantitative estimate of the digestibility of the site of the enzyme sensitive to methylation.
  • internal markers are used, in particular other fragments of the co-amplified genome containing a site of the methylation-sensitive enzyme, not methylated in humans, or of fragments not containing such a site.
  • the analysis of the amplification products is carried out by visualization of the fluorescence induced by ethidium bromide, after electrophoresis on agarose or polyacrylamide gel. If the methylation-sensitive site is methylated, the amplified fragment is present in both reactions, if the methylation-sensitive site is unmethylated, the amplified fragment is present only in the reaction with undigested DNA.
  • the 2.8 kb fragment was absent in men with a fragile X mutation, while women with the mutation had both normal fragments (2.8 and 5.2 kb) and the mutated fragments. Premutations were detected as EcoRI-Eaql fragments of 2.9 to approximately 3.3 kb in men (line 3) and were detected on the active X chromosome of women (lines 8, 24, 26 and the like) whereas EcoRI fragments of 5.3 to 5.7 kb corresponded to a premutation on the inactive X chromosome. The fragments corresponding to complete mutations were not digested by Eaql and therefore appear as simple or heterogeneous bands above 5.7 kb (lines 10, 12, 15 and the like).
  • FIG. 10 represents the detection of the fragile X mutations and of the methylation scheme for the DNA digested with EcoRI and Eaql: the DNA of leukocytes was simultaneously digested completely with the enzymes EcoRI and Eaql. The sizes are indicated on the left for some of the mutated fragments and for the normal fragments on the active and inactive X chromosomes (2.8 and 5.2 kb respectively). ⁇ corresponds to the increase in size of the mutated fragments. Hybridization patterns are identified on the right. The "/" trait denotes a deceased family member. For the other symbols, see Figure 9. The results for lines 6 and 16 are poor. Hybridization of these samples with a control probe showed that these lines contained as much DNA as the others and did not exhibit any migration artifacts.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Nucleic acid fragment containing mutations associated with the fragile X syndrome, or other DNA anomalies resulting from these mutations such as methylations of CpG sites. Nucleotide probe for detecting these mutations and DNA anomalies associated with mental retardation with fragile X and method for diagnosing mental retardation with fragile X.

Description

FRAGMENT D'ACIDE NUCLEIQUE DE LA REGION Du CHROMOSOME X IMPLIQUE DANS LE SYNDROME X FRAGILE, SONDE NUCLEOTIDIQUE ET PROCEDE POUR LE DIAGNOSTIC Du RETARD MENTAL AVEC X FRAGILE NUCLEIC ACID FRAGMENT OF THE X CHROMOSOME REGION INVOLVED IN FRAGILE X SYNDROME, NUCLEOTIDE PROBE AND METHOD FOR DIAGNOSING MENTAL DELAY WITH X FRAGILE
Le syndrome de retard mental avec X fragile est une maladie liée au chromosome X qui atteint environ un garçon sur mille cinq cent. Les femmes vectrices, environ une sur sept cent cinquante, ont un risque de 30% de présenter une débilité légère ou même moyenne. Le syndrome du retard mental avec X fragile constitue la cause la plus fréquente de retard mental héréditaire.Mental retardation syndrome with fragile X is an X chromosome-related disease that affects approximately one in every 1,500 boys. Women vectors, about one in seven hundred and fifty, have a 30% risk of having mild or even moderate debility. Mental retardation syndrome with fragile X is the most common cause of inherited mental retardation.
Le diagnostic de la maladie est établi par une analyse cytogénétique délicate qui nécessite des conditions de culture particulières et l'analyse de 50 à 100 mitoses, car le site fragile détectable cytogénétiquement n'est présent que dans 5 à 50% des mitoses. Le diagnostic des femmes vectrices est encore plus difficle car seules 50 à 60% de ces femmes expriment le site fragile, dans une proportion généralement faible des mitoses.The diagnosis of the disease is established by a delicate cytogenetic analysis which requires particular culture conditions and the analysis of 50 to 100 mitoses, because the fragile site detectable cytogenetically is only present in 5 to 50% of mitoses. The diagnosis of vector women is even more difficult since only 50 to 60% of these women express the fragile site, in a generally low proportion of mitoses.
La difficulté du test cytogénétique fait qu'il n'est pas pratiqué de manière fiable que dans un nombre limité de laboratoires ; en outre, le diagnostic de la maladie n'est souvent pratiqué qu'après la naissance d'un deuxième enfant atteint dans la même famille ; or l'établissement précoce d'un tel diagnostic est capital pour mettre en oeuvre des investigations permettant le diagnostic prénatal et le dépistage des femmes vectrices qui transmettent la maladie à 50% de leurs enfants mâles, dans les familles à risque. La haute fréquence de la maladie et l'importance génétique précoce justifient un dépistage systématique néonatal de la maladie. La présente invention vise précisément à fournir de nouveaux moyens d'investigation et de diagnostic, basés sur l'étude directe de l'ADN, permettant un diagnostic rapide de la maladie et applicables à un nombre important de patients.The difficulty of the cytogenetic test means that it is not reliably performed except in a limited number of laboratories; moreover, the diagnosis of the disease is often only made after the birth of a second affected child in the same family; however, the early establishment of such a diagnosis is essential for implementing investigations allowing prenatal diagnosis and screening of vector women who transmit the disease to 50% of their male children, in families at risk. The high frequency of the disease and the early genetic importance justify systematic neonatal screening for the disease. The present invention specifically aims to provide new means of investigation and diagnosis, based on the direct study of DNA, allowing rapid diagnosis of the disease and applicable to a large number of patients.
Le syndrome du retard mental avec X fragile se caractérise par la présente d'un site fragile dans la région Xq27.3, induit in vitro par une privation en acide folique ou par des inhibiteurs de la synthèse des déoxynucléotides. La cartographie génétique de la région Xq27-q28 a permis de confirmer que le locus de la maladie est localisé au niveau ou à côté du site fragile (Oberle et al, Proc. Natl. Acad. Sci. (1986) ; Suthers et al. Science (1989) ; Rousseau et al. J. Hum. Genêt. (1991)) .Mental retardation syndrome with fragile X is characterized by the presence of a fragile site in the Xq27.3 region, induced in vitro by deprivation of folic acid or by inhibitors of deoxynucleotide synthesis. Genetic mapping of the Xq27-q28 region has confirmed that the disease locus is located at or near the fragile site (Oberle et al, Proc. Natl. Acad. Sci. (1986); Suthers et al. Science (1989); Rousseau et al. J. Hum. Genêt. (1991)).
Il apparaît par ailleurs que la transmission héréditaire de la maladie est inhabituelle par rapport aux autres maladies liées au chromosome X. On a constaté que des hommes phénotypiquement normaux transmettent la mutation à leurs filles, lesquelles présentent rarement les symptômes de la maladie, par contre les fils et filles de ces femmes présentent un fort taux d'apparation de la maladie (Sherman et al, Hum. Genêt. (1985)). Plusieurs hypothèses ont été proposées pour expliquer ce phénomène.It also appears that hereditary transmission of the disease is unusual compared to other diseases linked to the X chromosome. It has been found that phenotypically normal men transmit the mutation to their daughters, who rarely exhibit the symptoms of the disease, on the other hand. sons and daughters of these women have a high rate of onset of the disease (Sherman et al, Hum. Genêt. (1985)). Several hypotheses have been proposed to explain this phenomenon.
L'invention fournit également des moyens pour la détection, chez des personnes non malades, d'anomalies et notamment de mutations au niveau du site X fragile.The invention also provides means for the detection, in non-sick persons, of anomalies and in particular of mutations at the level of the fragile X site.
Ces personnes non malades sont dites porteuses ou vectrices.These non-sick people are said to be carriers or vectors.
Les marqueurs génétiques proposés dans l'art antérieur ne peuvent servir qu'à suivre la transmission de la mutation dans les familles où la maladie a déjà été diagnostiquée par une étude cytogénétique, il s'agit d'un diagnostic indirect par étude de liaison ; il est en général nécessaire d'utiliser plusieurs marqueurs de part et d'autre du locus de la maladie, et ces marqueurs ne sont informatifs que dans des proportions variables de familles.The genetic markers proposed in the prior art can only be used to monitor the transmission of the mutation in families where the disease has already been diagnosed by a cytogenetic study, it this is an indirect diagnosis by link study; it is generally necessary to use several markers on either side of the disease locus, and these markers are only informative in varying proportions of families.
La demande de brevet internationale O90/05194 décrit un nouveau locus intitulé 1A1 distant du site X fragile mais dont le polymorphisme de restriction permet de disposer d'un marqueur génotypique. Les sondes capables de détecter le locus 1A1 permettent le diagnostic de plusieurs maladies liées au chromosome X et notamment le syndrome du X fragile, par hybridation sélective au niveau de la région Xq27. - DXS52 dudit chromosome X.International patent application O90 / 05194 describes a new locus entitled 1A1 distant from the fragile X site but whose restriction polymorphism provides a genotypic marker. The probes capable of detecting the locus 1A1 allow the diagnosis of several diseases linked to the X chromosome and in particular fragile X syndrome, by selective hybridization at the level of the Xq27 region. - DXS52 of said X chromosome.
D'autres sondes proches du locus X fragile ont également été décrites, notamment par les inventeurs. Ainsi F. Rousseau et al (Am. J. Hum. Genêt. (1991) 48:108-116) rapportent la mise en évidence de sept régions proches du locus X fragile (FRAXA) . Deux de ces régions comprises entre DXS369 et DXS296 contiennent les marqueurs génétiques les plus proches de FRAXA connus à ce jour, l'une de ces régions contient deux sondes détectant un polymorphisme. Ces sondes dénommées St677 (DX463) et 2-34 (DXS477) détectent toutes deux les fragments de restriction Taql polymorphes ; une autre sonde détectant également un polymorphisme, et dénommée Do33 (DXS465 : 42% hétérozygocité) est localisée dans la même région que DXS296, proximale au point de clivage du chromosome correspondant au locus du syndrome Hunter (IDS) . L'utilisation de ces sondes a permis de déterminer la disposition physique des régions précédentes : Cen-DXS369-DXS476-(DXS463,DXS477) -(DXS296,DXS465)-IDS-DXS304-tel, et leur position par rapport au locus X fragile. L'analyse par électrophorèse en champ puisé du locus X fragile avec les sondes précédentes et plus particulièrement avec la sonde Do33 (DXS465) a conduit les inventeurs à remarquer que les patients avec X fragile et retard mental se distinguent des sujets normaux ou des sujets porteurs de la mutation X fragile mais sans expression clinique de la maladie, par une inhibition totale ou partielle de la digestion de sites de restriction proches de la sonde Do33, et notamment de sites pour les enzymes BssHII, SacII, Eagl.Other probes close to the fragile X locus have also been described, in particular by the inventors. Thus F. Rousseau et al (Am. J. Hum. Genêt. (1991) 48: 108-116) report the detection of seven regions close to the fragile X locus (FRAXA). Two of these regions between DXS369 and DXS296 contain the genetic markers closest to FRAXA known to date, one of these regions contains two probes detecting a polymorphism. These probes called St677 (DX463) and 2-34 (DXS477) both detect the polymorphic Taql restriction fragments; another probe also detecting a polymorphism, and named Do33 (DXS465: 42% heterozygocity) is located in the same region as DXS296, proximal to the point of cleavage of the chromosome corresponding to the locus of Hunter syndrome (IDS). The use of these probes made it possible to determine the physical arrangement of the preceding regions: Cen-DXS369-DXS476- (DXS463, DXS477) - (DXS296, DXS465) -IDS-DXS304-tel, and their position relative to the fragile X locus . Analysis by pulsed field electrophoresis of the fragile X locus with the previous probes and more particularly with the Do33 probe (DXS465) led the inventors to note that patients with fragile X and mental retardation are distinguished from normal subjects or from carriers of the fragile X mutation but without clinical expression of the disease, by a total or partial inhibition of the digestion of restriction sites close to the Do33 probe, and in particular of sites for the enzymes BssHII, SacII, Eagl.
Les inventeurs ont clone sous forme de chromosome artificiel de levure (YAC) , le segment d'ADN d'environ 225 kb défini entre les sondes St677 et Do33, et situé dans la région Xq27-q28 du chromosome X humain. Des sondes provenant de ce segment ont été préparées pour l'analyse des mutations, des méthylations de l'ADN et des gènes impliqués dans le syndrome X fragile.The inventors cloned as an artificial yeast chromosome (YAC), the approximately 225 kb DNA segment defined between probes St677 and Do33, and located in the Xq27-q28 region of the human X chromosome. Probes from this segment have been prepared for the analysis of mutations, DNA methylations and genes involved in fragile X syndrome.
Ces sondes ont notamment permis l'étude, à partir d'ADN de leucocytes, de la digestibilité des sites de restriction BssHII, Eaql, SacII et de manière générale des sites de restriction dont la digestion par l'enzyme correspondant est inhibée lorsque le site contient une cytosine méthylée r ces sites sont dénommés sites à CpG, il s'agit par exemple de sites contenant le dinucléotide CpG, tels que Hpall, CCGG ou Hhal, GCGC, ou de sites susceptibles de recouvrir partiellement un dinucléotide CpG tels que Avall GG(A ou T)CC, dans une séquence CGG(A ou T)CC ou GG(A ou T)CGG ou encore BanI (GG Py Pu CC) ; les inventeurs ont mis en évidence une corrélation surprenante entre l'expression clinique de la maladie et l'inhibition de la digestibilité des sites à CpG dans la région d'environ 20 kb autour de la position 125 kb définie sur le segment d'ADN clone par les inventeurs, à environ 100 kb de la sonde Do33 en direction du centromère.These probes have in particular enabled the study, from DNA of leukocytes, of the digestibility of the restriction sites BssHII, Eaql, SacII and in general of the restriction sites whose digestion by the corresponding enzyme is inhibited when the site contains a methylated cytosine r these sites are called CpG sites, these are for example sites containing the CpG dinucleotide, such as Hpall, CCGG or Hhal, GCGC, or sites capable of partially covering a CpG dinucleotide such as Avall GG (A or T) CC, in a CGG (A or T) CC or GG (A or T) CGG or even BanI (GG Py Pu CC) sequence; the inventors have demonstrated a surprising correlation between the clinical expression of the disease and the inhibition of the digestibility of CpG sites in the region of approximately 20 kb around the 125 kb position defined on the cloned DNA segment through the inventors, approximately 100 kb from the Do33 probe in the direction of the centromere.
Ces sondes sont également appropriées pour la détection du locus X fragile, sans manifestation clinique de la maladie, qui résulte de la mutation de l'acide nucléique de la région du chromosome X décrite ci-dessus, par allongement de l'ADN.These probes are also suitable for the detection of the fragile X locus, without clinical manifestation of the disease, which results from the mutation of the nucleic acid of the X chromosome region described above, by extension of the DNA.
L'allongement peut en effet être plus ou moins important selon que le sujet est seulement porteur de l'anomalie ou qu'il présente des signes cliniques de retard mental associé à l'anomalie X fragile. Les sondes de l'invention permettent avantageusement la détection de prémutations correspondant à un allongement de l'acide nucléique d'environ lOOpb (paires de bases) à environ 500pb et la détection de mutations complètes correspondant à un allongement de l'acide nucléique d'au moins environ 500pb, pouvant aller jusqu'à plus de 3000pb. Les prémutations correspondent en général à un sujet porteur de l'anomalie sans manifestation clinique, alors que les mutations par allongement de taille supérieure à 500pb sont normalement associées avec la présence de signes cliniques.The lengthening can indeed be more or less significant depending on whether the subject is only a carrier of the anomaly or whether he has clinical signs of mental retardation associated with the fragile X anomaly. The probes of the invention advantageously allow the detection of premutations corresponding to an elongation of the nucleic acid from approximately 100 bp (base pairs) to approximately 500 bp and the detection of complete mutations corresponding to an elongation of the nucleic acid at least around 500bp, up to over 3000bp. Premutations generally correspond to a subject carrying the anomaly without clinical manifestation, whereas mutations by extension greater than 500 bp are normally associated with the presence of clinical signs.
Dans la suite le terme mutation sera utilisé pour désigner les deux situations évoquées ci-dessus et la distinction entre les mutations associées ou non à des signes cliniques sera faite si nécessaire.In the following, the term mutation will be used to designate the two situations mentioned above and the distinction between mutations associated or not with clinical signs will be made if necessary.
Des sondes intéressantes dans le cadre de la recherche de mutation de la région X fragile sans expression clinique du retard mental, sont par exemple les sondes dites adjacentes au site à CpG.Probes of interest in the search for a mutation in the fragile X region without clinical expression of mental retardation are, for example the so-called probes adjacent to the CpG site.
La figure 1 est une représentation schématique de la région du chromosome X autour de la position 125 kb se situant à environ 100 kb de ka sonde Do33 en direction du centromère. Sur l'échelle, on a représenté la localisation des sondes St677, 2-34, et Do33. En concordance avec l'échelle on a représenté les clones YAC 141 H5 et 209G4 correspondant aux segments d'ADN sus-mentionnés, et la localisation de sites de restriction Eaql, BssII etc., a été représentée sur la ligne du clone 141 H5. L'indication CpG sur la ligne du clone 141 H5 correspond à la région dont la méthylation est anormale chez les patients atteints de retard mental avec X fragile.Figure 1 is a schematic representation of the X chromosome region around the 125 kb position located about 100 kb from the Do33 probe in direction of the centromere. On the scale, the location of the probes St677, 2-34, and Do33 is shown. In accordance with the scale, the clones YAC 141 H5 and 209G4 corresponding to the above-mentioned DNA segments have been shown, and the location of restriction sites Eaql, BssII etc., has been represented on the line of clone 141 H5. The indication CpG on the line of clone 141 H5 corresponds to the region whose methylation is abnormal in patients with mental retardation with fragile X.
Ce phénomène d'inhibition de digestibilité des sites CpG peut être détecté par la méthode de Southern Blot, en utilisant des sondes provenant de la région de 20 kb autour de la position 125 kb définie à la figure 1, sondes proches ou contenant les sites à CpG.This phenomenon of inhibition of digestibility of CpG sites can be detected by the Southern Blot method, using probes originating from the 20 kb region around the 125 kb position defined in FIG. 1, probes close to or containing the sites to CpG.
Les inventeurs ont également mis en évidence par la même méthode, des anomalies de migration de fragments d'ADN, non nécessairement liées au phénomène de méthylation, anomalies qui sont caractéristiques des sujets porteurs d'une mutation X fragile.The inventors have also demonstrated, by the same method, anomalies in the migration of DNA fragments, not necessarily linked to the phenomenon of methylation, anomalies which are characteristic of subjects carrying a fragile X mutation.
Ces anomalies ont été détectées notamment dans l'ADN digéré par les enzymes EcoRI ou HindIII après hybridation avec une sonde spécifique de la susdite région.These anomalies were detected in particular in the DNA digested by the EcoRI or HindIII enzymes after hybridization with a probe specific for the above region.
Il apparaît que les mutations germinales responsables du syndrome X fragile et susceptibles d'être transmises à la descendance se situent dans la région du chromosome X définie entre les sondes St677 et Do33, et la méthylation des sites à CpG dans cette région est une conséquence non obligatoire de ces mutations, conséquence qui est liée à l'expression clinique de la maladie.It appears that the germinal mutations responsible for fragile X syndrome and capable of being transmitted to the offspring are located in the region of the X chromosome defined between the probes St677 and Do33, and the methylation of the CpG sites in this region is a consequence not obligatory of these mutations, consequence which is linked to the clinical expression of the disease.
Les anomalies de migration de fragments d'acide nucléique, corrélées à un site X fragile, chez les sujets porteurs (vecteurs) sans expression clinique nécessairement associée, résultent notamment d'un allongement du fragment d'ADN génomique autour du site X fragile. Cet allongement peut par exemple être la conséquence de 1'insertion d'une séquence additionnelle. Cette allongement peut dans certains cas résulter de l'amplification (répétition) d'une courte séquence contenue au voisinage du site X fragile, par exemple au niveau du fragment 9B12.5 près du site Eaql, représenté à la figure 2.The anomalies in migration of nucleic acid fragments, correlated to a fragile X site, in carrier subjects (vectors) without necessarily associated clinical expression, result in particular from an elongation of the genomic DNA fragment around the fragile X site. This lengthening can for example be the consequence of the insertion of an additional sequence. This elongation can in certain cases result from the amplification (repetition) of a short sequence contained in the vicinity of the fragile X site, for example at the level of the fragment 9B12.5 near the Eaql site, represented in FIG. 2.
L'invention vise en conséquence tout fragment d'acide nucléique issu de la région Xq27-q28 du chromosome X, adjacent ou contenant les sites à CpG, situé dans la région de 10 à 20 kb autour de la position 125 kb.The invention therefore relates to any nucleic acid fragment originating from the Xq27-q28 region of the X chromosome, adjacent to or containing the CpG sites, located in the region of 10 to 20 kb around the position 125 kb.
De manière générale, l'invention concerne tout fragment d'acide nucléique compris dans le segment d'ADN d'environ 225 kb, défini entre les sondes St677 et Do33. De préférence de tels fragments d'acide nucléique comprennent au moins 15pb ou nucléotides.In general, the invention relates to any nucleic acid fragment included in the DNA segment of approximately 225 kb, defined between the probes St677 and Do33. Preferably such nucleic acid fragments comprise at least 15 bp or nucleotides.
Les séquences d'acide nucléique de l'invention sont des séquences d'ADN, d'ADNc ou encore d'ARNm.The nucleic acid sequences of the invention are DNA, cDNA or even mRNA sequences.
Les séquences d'acide nucléique de l'invention sont des séquences individualisées et par conséquent elles ne sont pas dans leur environnement naturel.The nucleic acid sequences of the invention are individualized sequences and therefore they are not in their natural environment.
L'ADNc correspondant aux séquences d'acide nucléique de l'invention peut être obtenu selon les techniques conventionnelles par criblage d'une banque d'ADNc humain disponible, avec un fragment d'acide nucléique de l'invention, le criblage permettant de détecter les fragments d'ADNc qui hybrident sélectivement avec le fragment d'acide nucléique de l'invention. Cette région du chromosome X est impliquée dans le syndrome X fragile et les sondes spécifiques de cette région sont avantageusement utilisées pour détecter la présence d'anomalies de méthylation liées à l'expression clinique de la maladie, ou pour détecter la présence de mutations responsables du syndrome X fragile et de sa transmission, ou encore pour localiser, identifier et analyser l'expression du ou des gènes impliqués dans le syndrome X fragile. Ces sondes peuvent en général être utilisées pour détecter les anomalies de l'ADN qui sont la conséquence directe ou indirecte des mutations associées au syndrome X fragile.The cDNA corresponding to the nucleic acid sequences of the invention can be obtained according to conventional techniques by screening a library of available human cDNA, with a nucleic acid fragment of the invention, the screening making it possible to detect cDNA fragments which selectively hybridize with the nucleic acid fragment of the invention. This region of the X chromosome is involved in fragile X syndrome and the probes specific for this region are advantageously used to detect the presence of methylation abnormalities related to the clinical expression of the disease, or to detect the presence of mutations responsible for the fragile X syndrome and its transmission, or to locate, identify and analyze the expression of the gene (s) involved in fragile X syndrome. These probes can generally be used to detect DNA abnormalities that are the direct or indirect consequence of mutations associated with fragile X syndrome.
L'invention concerne donc toute sonde nucléotidique capable de s'hybrider sélectivement avec un fragment d'acide nucléique compris dans le segment d'ADN défini entre les sondes St677 et Do33 et plus particulièrement avec un fragment d'acide nucléique adjacent ou contenant les sites à CpG dans la région d'environ 20 kb autour de la position 125 kb.The invention therefore relates to any nucleotide probe capable of hybridizing selectively with a nucleic acid fragment included in the DNA segment defined between the St677 and Do33 probes and more particularly with a nucleic acid fragment adjacent to or containing the sites at CpG in the region of about 20 kb around the 125 kb position.
Les sondes de l'invention s'hybrident spécifiquement dans des conditions de stringence appropriées avec les fragments d'acide nucléique sus¬ mentionnés mais ne s'hybrident pas avec d'autres régions du génome humain dans des mêmes conditions d'hybridation.The probes of the invention specifically hybridize under appropriate stringency conditions with the abovementioned nucleic acid fragments but do not hybridize with other regions of the human genome under the same hybridization conditions.
Une telle hybridation comporte les étapes suivantes :Such hybridization involves the following steps:
- le traitement de pré-hybridation d'un support, comme un filtre de nitrocellulose ou une membrane de nylon, sur lequel est fixé l'ADN à tester susceptible de s'hybrider avec les sondes sus¬ mentionnées, à une température de 42*C et pendant 2 heures avec une solution de pré-hybridation ayant la composition suivante : 40% de formamide ,* 0,9 M NaCl ; 200 μg/ml d'ADN de sperme de saumon ; 50 mM de sodium phosphate pH 6,5 ; 4% de dextran sulfate ; 0,08% (poids/volume) de ficoll et de polyvinyl pyrrolidone, l'hybridation dans une solution identique à la solution de pré-hybridation, comprenant en outre au moins une sonde nucléotidique conforme à l'invention avantageusement marquée, à une température de 42*C et pendant 18 heures, 4 lavages successifs, la révélation de l'hybride éventuellement formé par toute méthode adaptée au marquage de la sonde. Les conditions d'hybridation définies ci-dessus constituent des conditions préférées, mais ne sont nullement limitatives et peuvent être modifiées sans affecter les propriétés d'appariement des sondes de l'invention et les séquences de nucléotides sus¬ mentionnées.- the pre-hybridization treatment of a support, such as a nitrocellulose filter or a nylon membrane, on which is fixed the DNA to be tested capable of hybridizing with the above-mentioned probes, at a temperature of 42 * C and for 2 hours with a pre-hybridization solution having the following composition: 40% formamide, * 0.9 M NaCl; 200 μg / ml of salmon sperm DNA; 50 mM sodium phosphate pH 6.5; 4% dextran sulfate; 0.08% (weight / volume) of ficoll and of polyvinyl pyrrolidone, hybridization in a solution identical to the pre-hybridization solution, further comprising at least one nucleotide probe according to the invention advantageously labeled, at a temperature at 42 ° C and for 18 hours, 4 successive washes, revealing the hybrid possibly formed by any method suitable for labeling the probe. The hybridization conditions defined above constitute preferred conditions, but are in no way limiting and can be modified without affecting the pairing properties of the probes of the invention and the nucleotide sequences mentioned above.
Les sondes de l'invention sont avantageusement marquées par tout marqueur classiquement utilisé. Elles peuvent être marquées à l'aide d'un traceur radioactif comme 32P, 35S, 125I, , 14C et le marquage radioactif peut être réalisé selon une méthode quelconque connue de l'Homme du Métier.The probes of the invention are advantageously marked with any marker conventionally used. They can be marked using a radioactive tracer such as 32 P, 35 S, 125 I ,, 14 C and the radioactive marking can be carried out according to any method known to those skilled in the art.
Les sondes peuvent être marquées en 3' par addition d'un ou plusieurs désoxynucléotides ou ribonucléotides ou d'un didéoxynucléotide, marqué en alpha par le 32P, en présence de la Terminal Déoxynucléotidyl Transférase, ou en 5' par transfert d'un groupe phosphate radioactif d'un déoxynucléotide ou didéoxynucléotide libre marqué en position gamma, en présence de la T4 DNA ligase. Les sondes peuvent encore être marquées en utilisant un ADN polymérase par "Nick Translation" ou "Random Priming" ou "Polymérase Chain Reaction".The probes can be labeled in 3 ′ by addition of one or more deoxynucleotides or ribonucleotides or of a dideoxynucleotide, marked in alpha by 32 P, in the presence of the Terminal Deoxynucleotidyl Transferase, or in 5 ′ by transfer of a group radioactive phosphate of a deoxynucleotide or free dideoxynucleotide labeled in the gamma position, in the presence of T4 DNA ligase. Probes can still be labeled using DNA polymerase by "Nick Translation "or" Random Priming "or" Polymerase Chain Reaction ".
La méthode de détection de l'hybridation dépendra du marqueur radioactif utilisé et pourra reposer sur l'autoradiographie, la scintillation liquide, le comptage gamma ou toute autre autre technique permettant de détecter l'émission du rayonnement émis par le marqueur radioactif. un marquage non radioactif peut également être utilisé, en associant aux sondes des groupements présentant des propriétés immunologiques comme un antigène, une affinité spécifique pour certains réactifs comme un ligand, des propriétés physiques comme la fluorescence ou la luminescence, des propriétés permettant la complétion des réactions enzymatiques comme une enzyme ou un substrat d'enzyme. Le marquage non radioactif peut être fait également directement par modification chimique de l'ADN, comme la photobiotinylation ou la sulfonation.The method of detection of hybridization will depend on the radioactive marker used and may be based on autoradiography, liquid scintillation, gamma counting or any other technique making it possible to detect the emission of the radiation emitted by the radioactive marker. non-radioactive labeling can also be used, by combining with the probes groups having immunological properties such as an antigen, a specific affinity for certain reagents such as a ligand, physical properties such as fluorescence or luminescence, properties allowing the completion of the reactions enzymes like an enzyme or an enzyme substrate. Non-radioactive labeling can also be done directly by chemical modification of DNA, such as photobiotinylation or sulfonation.
Les sondes de l'invention sont utilisées pour la détection in vitro, des mutations responsables du syndrome X fragile, ainsi que des anomalies de méthylation des sites à CpG ou d'autres anomalies de l'ADN conséquentes à la présence de ces mutations et associées au syndrome.The probes of the invention are used for the in vitro detection, mutations responsible for fragile X syndrome, as well as anomalies in methylation of CpG sites or other DNA anomalies resulting from the presence of these mutations and associated to the syndrome.
La détection de mutation vise à suivre la transmission familiale et permet notamment un diagnostic des personnes non atteintes susceptibles de transmettre la maladie, telles que des femmes vectrices ou des hommes normaux transmetteurs de la mutation.The mutation detection aims to follow the family transmission and allows in particular a diagnosis of the non affected people likely to transmit the disease, such as women vectors or normal men transmitters of the mutation.
La détection des anomalies de méthylation permet un diagnostic de la maladie, exprimée cliniquement ou susceptible de l'être dans le cadre d'un diagnostic anténatal ou à la naissance. D'une manière générale, les procédés de détection des mutations responsables du syndrome X fragile, ainsi que des anomalies de méthylation des sites à CpG, ou d'autres anomalies de l'ADN associées au syndrome, reposent sur l'utilisation d'au moins une sonde conforme à l'invention et d'au moins une enzyme de restriction appropriée de manière à ce que le fragment détecté par la sonde soit différent selon qu'il contienne ou non la mutation ou l'anomalie de méthylation ou toute autre anomalie de l'ADN.The detection of methylation abnormalities allows a diagnosis of the disease, expressed clinically or likely to be expressed in the context of an antenatal or birth diagnosis. In general, the methods for detecting mutations responsible for fragile X syndrome, as well as abnormal methylation of CpG sites, or other DNA abnormalities associated with the syndrome, rely on the use of at least one probe according to the invention and at least one suitable restriction enzyme so that the fragment detected by the probe is different depending on whether or not it contains the methylation mutation or anomaly or any other anomaly DNA.
Un tel procédé peut être réalisé selon la méthode dite "Southern Blot" (Sa brook, Fritsh and Maniatis ; Molecular cloning : A laboratory manual (1989) , Cold Spring Harbor Laboratory Press) , comprenant les étapes suivantes : traitement de l'ADN génomique extrait par exemple de leucocytes ou de villosités choriales ou de toute autre source d'ADN génomique, par au moins une enzyme de restriction déterminée, dans des conditions permettant l'obtention de fragments de restriction issus du clivage de l'ADN au niveau de ses sites de restriction reconnus par ladite enzyme ; séparation des fragments par électrophorèse ; mise en contact d'une sonde nucléique selon l'invention susceptible de s'hybrider spécifiquement avec les fragments précédents dans des conditions permettant la formation de complexes d'hybridation ; détection des complexes d'hybridation ; mesure de la taille des fragments de restriction engagés dans les complexes d'hybridation. La recherche d'anomalies de méthylation pour le diagnostic in vitro du syndrome X fragile chez des patients atteints de retard mental est avantageusement réalisée selon le procédé précédent mettant en oeuvre au moins une enzyme de restriction à site sensible à la méthylation, avec au moins une sonde conforme à l'invention avantageusement marquée.Such a process can be carried out according to the so-called "Southern Blot" method (Sa brook, Fritsh and Maniatis; Molecular cloning: A laboratory manual (1989), Cold Spring Harbor Laboratory Press), comprising the following steps: treatment of genomic DNA extracted for example from leukocytes or chorionic villi or from any other source of genomic DNA, by at least one specific restriction enzyme, under conditions allowing the obtaining of restriction fragments resulting from the cleavage of DNA at its level restriction sites recognized by said enzyme; separation of the fragments by electrophoresis; bringing into contact a nucleic probe according to the invention capable of hybridizing specifically with the preceding fragments under conditions allowing the formation of hybridization complexes; detection of hybridization complexes; measurement of the size of the restriction fragments engaged in the hybridization complexes. The search for methylation anomalies for the in vitro diagnosis of fragile X syndrome in patients patients suffering from mental retardation is advantageously carried out according to the preceding method using at least one restriction enzyme with a site sensitive to methylation, with at least one probe according to the invention advantageously labeled.
Le procédé sus-mentionné peut être mis en oeuvre avec une seule enzyme à site de restriction sensible à la méthylation telle que BssHII, Eaql, Avall, BanI ; ou encore avec deux enzymes, l'une à site de restriction sensible à la méthylation et l'autre à site de restriction non sensible à la méthylation. Les sondes de l'invention utilisées pour l'hybridation avec les fragments obtenus sont avantageusement adjacentes ou contiennent le site pour l'enzyme à site sensible à la méthylation.The above-mentioned method can be carried out with a single methylation-sensitive restriction site enzyme such as BssHII, Eaql, Avall, BanI; or again with two enzymes, one with a restriction site sensitive to methylation and the other with a restriction site not sensitive to methylation. The probes of the invention used for hybridization with the fragments obtained are advantageously adjacent to or contain the site for the enzyme with a site sensitive to methylation.
La méthode de Southern Blot est également utilisée pour détecter les mutations associées au syndrome X fragile, ou les mutations existant chez les personnes vectrices, sans signes cliniques. Ces mutations sont par exemple des délétions ou des insertions de séquence d'ADN, ou d'autres anomalies de l'ADN telles que des anomalies de conformation ou de réplication, qui sont conséquentes à ces mutations.The Southern Blot method is also used to detect mutations associated with fragile X syndrome, or mutations existing in vector vectors, without clinical signs. These mutations are, for example, DNA sequence deletions or insertions, or other DNA abnormalities such as conformational or replicative abnormalities, which are consequential to these mutations.
La détection de ces mutations pour le diagnostic in vitro du syndrome X fragile ou plus généralement de la mutation du site X fragile, chez des patients atteints ou non de retard mental est réalisée selon la méthode de Southern Blot en soumettant l'ADN génomique à une digestion par toute enzyme de restriction appropriée non nécessairement sensible à la méthylation telle que EcoRI ou HindIII. Les fragments de restriction sont mis en évidence par hybridation avec une sonde de l'invention avantageusement marquée et la migration électrophorétique anormale desdits fragments est corrélée soit avec l'expression clinique de la maladie, soit avec la présence de la mutation même en l'absence même d'expression clinique de la maladie.The detection of these mutations for the in vitro diagnosis of fragile X syndrome or more generally of the mutation of the fragile X site, in patients with or without mental retardation is carried out according to the Southern Blot method by subjecting the genomic DNA to a digestion with any suitable restriction enzyme not necessarily sensitive to methylation such as EcoRI or HindIII. The restriction fragments are demonstrated by hybridization with a probe of the invention advantageously labeled and the abnormal electrophoretic migration of said fragments is correlated either with the clinical expression of the disease, or with the presence of the mutation even in the very absence of clinical expression of the disease.
Cette migration anormale des fragments correspond à la présence de fragments allongés par la mutation insertionnelle d'une séquence de nucléotides.This abnormal migration of the fragments corresponds to the presence of fragments elongated by the insertional mutation of a nucleotide sequence.
L'invention concerne aussi les kits pour la mise en oeuvre du procédé précédent.The invention also relates to the kits for implementing the above method.
Parmi les fragments d'acide nucléique de l'invention, ceux de 20 à 30 nucléotides peuvent être avantageusement utilisés en tant qu'amorces dans un procédé d'amplification génétique d'un fragment d'acide nucléique de la région de 20kb autour de la position 125. L'amplification peut être destinée à révéler la présence de mutations au niveau de cette région, notamment par allongement de l'ADN, ou/et detinée à la détection d'un fragment contenant les sites à CpG. Ce procédé d'amplification consiste à fixer spécifiquement par hybridation sur l'ADN génomique extrait par exemple de leucocytes, deux oligonucléotides judicieusement choisis parmi ceux contenant les fragments d'acide nucléique de 20 à 30 nucléotides de l'invention qui sont adjacents au fragment à amplifier, puis à mettre en oeuvre un processus d'extension enzymatique à l'aide d'ADN- polymérase, suivi d'un processus de dénaturation, et à répéter le cycle hybridation- extension-dénaturation connu sous le nom de cycle PCR "Polymérase Chain Reaction", un nombre de fois suffisant pour augmenter la quantité du fragment à amplifier dans une proportion exponentielle par rapport au nombre de cycles effectués.Among the nucleic acid fragments of the invention, those of 20 to 30 nucleotides can be advantageously used as primers in a method of genetic amplification of a nucleic acid fragment of the 20 kb region around the position 125. The amplification may be intended to reveal the presence of mutations in this region, in particular by lengthening of the DNA, or / and determined for the detection of a fragment containing the CpG sites. This amplification method consists in specifically fixing by hybridization on the genomic DNA extracted for example from leukocytes, two oligonucleotides judiciously chosen from those containing the nucleic acid fragments of 20 to 30 nucleotides of the invention which are adjacent to the fragment to amplify, then implement an enzymatic extension process using DNA polymerase, followed by a denaturation process, and repeat the hybridization-extension-denaturation cycle known as the PCR "Polymerase cycle Chain Reaction ", a sufficient number of times to increase the quantity of the fragment to be amplified in an exponential proportion compared to the number of cycles carried out.
La méthode d'amplification décrite peut être appliquée à la détection d'anomalies de l'ADN qui est la conséquence de la présence des susdites mutations. Le diagnostic in vitro du syndrome X fragile, notamment chez des patients atteints de retard mental, ou chez des personnes vectrices, est avantageusement réalisé par une amplification génétique effectuée en parallèle sur l'ADN digéré par au moins une enzyme de restriction choisie parmi les enzymes non sensibles à la méthylation ou au contraire sensibles à la méthylation, et sur l'ADN non digéré. L'analyse à des fins de diagnostic est faite en comparant le produit d'amplification de l'ADN non digéré à celui de l'ADN digéré par l'enzyme ou les enzymes de restriction choisies. Cette analyse des produits d'amplification peut être réalisée par visualisation de la fluorescence induite par le bromure d'ethidium, après électrophorèse sur gel d'agarose ou de polyacrylamide, ou par la détection du marquage radioactif ou non radioactif, tel que par un système biotine-avidine, des oligonucléotides amorces ou des nucléotides incorporés dans le fragment amplifié. Le nombre de cycles d'amplification est limité de façon à conserver une linéarité de l'amplification et donc une estimation quantitative de la digestibilité des sites de l'enzyme ou des enzymes utilisées. Avantageusement des marqueurs internes sont utilisés, notamment d'autres fragments du génome co-amplifié contenant également un site de l'enzyme choisie, en tant que témoin de l'action de l'enzyme de restriction, et en tant que témoin de l'efficacité de l'amplification, un fragment ne contenant pas un tel site.The amplification method described can be applied to the detection of DNA abnormalities which are the consequence of the presence of the above mutations. The in vitro diagnosis of fragile X syndrome, in particular in patients with mental retardation, or in vector vectors, is advantageously carried out by genetic amplification carried out in parallel on the DNA digested with at least one restriction enzyme chosen from the enzymes not sensitive to methylation or on the contrary sensitive to methylation, and on undigested DNA. Analysis for diagnostic purposes is done by comparing the amplification product of undigested DNA to that of DNA digested with the chosen restriction enzyme (s). This analysis of the amplification products can be carried out by visualization of the fluorescence induced by ethidium bromide, after electrophoresis on agarose or polyacrylamide gel, or by the detection of radioactive or non-radioactive labeling, such as by a system. biotin-avidin, priming oligonucleotides or nucleotides incorporated into the amplified fragment. The number of amplification cycles is limited so as to maintain a linearity of the amplification and therefore a quantitative estimate of the digestibility of the sites of the enzyme or enzymes used. Advantageously, internal markers are used, in particular other fragments of the co-amplified genome also containing a site of the chosen enzyme, as a witness for the action of the restriction enzyme, and as a witness for the efficiency of amplification, a fragment not containing such a site.
La mesure quantitative des fragments caractéristiques des mutations, en particulier résultant de l'allongement, ainsi que la mesure quantitative de la méthylation de l'ADN génomique au site étudié peut se faire par adaptation de la méthode d'amplification décrite précédemment, notamment en utilisant en plus des oligonucléotides selon l'invention, des oligonucléotides dits "linkers" et de l'ADN Ligase, méthode dénommée "Ligation mediated PCR" décrite par Steigerwald et al (Nucleic ACids Res. (1980) 18:1435-1439).The quantitative measurement of the characteristic fragments of the mutations, in particular resulting from the elongation, as well as the quantitative measurement of the methylation of the genomic DNA at the site studied can be done by adapting the method. amplification described above, in particular by using in addition to the oligonucleotides according to the invention, so-called "linker" oligonucleotides and DNA Ligase, a method called "Ligation mediated PCR" described by Steigerwald et al (Nucleic ACids Res. (1980 ) 18: 1435-1439).
Les délétions ou tout autre réarrangement constituant des mutations susceptibles de donner lieu au syndrome X fragile en particulier par allongement d'acide nucléique, peuvent être également détectés par la méthode d'amplification d'ADN dite multiplex, à l'aide de couples d'oligonucléotides pouvant être mélangés dans une seule réaction pour amplifier plusieurs fragments de la région autour de la position 125 kb et détecter la disparition ou la modification de certains de ces fragments. La détection de mutations ponctuelles est avantageusement réalisée par amplification des segments d'ADN, suivie d'une analyse par les méthodes de SSCP (single strand conformation polymorphism) ou de DGGE (denaturing gradient gel electrophoresis) , ou encore de détection d'hétéroduplex.Deletions or any other rearrangement constituting mutations liable to give rise to fragile X syndrome, in particular by lengthening of nucleic acid, can also be detected by the so-called multiplex DNA amplification method, using pairs of oligonucleotides which can be mixed in a single reaction to amplify several fragments of the region around the 125 kb position and to detect the disappearance or modification of some of these fragments. The detection of point mutations is advantageously carried out by amplification of the DNA segments, followed by an analysis by SSCP (single strand conformation polymorphism) or DGGE (denaturing gradient gel electrophoresis) methods, or even by detection of heteroduplex.
L'invention concerne également les kits pour la mise en oeuvre du procédé précédent. De tels kits comprennent : des oligonucléotides marqués ou non pour l'amplification de fragments d'acide nucléique présentant une anomalie résultant d'une mutation, notamment par allongement de l'ADN et/ou de fragments d'acide nucléique contenant un site sensible à la méthylation selon l'invention ; des oligonucléotides marqués ou non pour l'amplification des segments d'acide nucléique témoin ; des oligonucléotides dits "linkers" ; - des tampons, nucléotides et enzymes propices à 1'amplification.The invention also relates to the kits for implementing the above method. Such kits include: oligonucleotides labeled or not labeled for the amplification of nucleic acid fragments exhibiting an anomaly resulting from a mutation, in particular by lengthening of the DNA and / or of nucleic acid fragments containing a site sensitive to methylation according to the invention; oligonucleotides labeled or not for the amplification of the control nucleic acid segments; so-called "linker"oligonucleotides; - buffers, nucleotides and enzymes suitable for amplification.
Un groupe de sondes particulièrement avantageuses pour la réalisation de l'invention, comprend les sondes dont la description détaillée est donnée dans la partie expérimentale. Ces sondes comprennent les fragments 9B12.3 (désigné maintenant StB12.3) , 9B12.5 (StB12.5) , 9B12.4, 9B12.2 et 9B12.1 localisés par rapport à l'ADN situé entre les sondes Do33 et St677, représenté à la figure 2. D'autres sondes sont les fragments stA22 (Avall-Avall) d'environ 1500bp, stX21 d'environ 3800bp et stX21E (centromérique du site Eaql) .A group of probes which are particularly advantageous for carrying out the invention includes probes, the detailed description of which is given in the experimental part. These probes include the fragments 9B12.3 (now designated StB12.3), 9B12.5 (StB12.5), 9B12.4, 9B12.2 and 9B12.1 located in relation to the DNA located between the probes Do33 and St677 , represented in FIG. 2. Other probes are the stA22 (Avall-Avall) fragments of approximately 1500bp, stX21 of approximately 3800bp and stX21E (centromeric of the Eaql site).
Avantageusement la sonde 9B12.3 peut être mise en oeuvre pour détecter des anomalies au niveau du site X fragile de fragments d'acide nucléique, et plus spécialement des mutations par allongement de l'ADN, après une étape de digestion avec l'enzyme de restriction EcoRI.Advantageously, the 9B12.3 probe can be used to detect anomalies at the fragile X site of nucleic acid fragments, and more particularly mutations by lengthening of the DNA, after a step of digestion with the enzyme of EcoRI restriction.
Des résultats analogues sont obtenus en utilisant l'enzyme de restriction HindIII.Similar results are obtained using the restriction enzyme HindIII.
Un schéma des résultats obtenus sur des fragments de restriction résultant de la digestion par EcoRI, détectés par la sonde 9B12.3, montrant un fragment normal ou muté est donné à la figure 7.A diagram of the results obtained on restriction fragments resulting from digestion with EcoRI, detected by the probe 9B12.3, showing a normal or mutated fragment is given in FIG. 7.
La séquence nucléotidique des sondes 9B12.3 (stB12.3) et 9B12.5 (stB12.5) est représentée à la figure 8, avec sa séquence complémentaire.The nucleotide sequence of probes 9B12.3 (stB12.3) and 9B12.5 (stB12.5) is shown in Figure 8, with its complementary sequence.
En faisant par ailleurs appel aux sondes décrites ci-dessus, pour la révélation des fragments d'ADN auxquels on a préalablement fait subir une double digestion par une enzyme sensible à la méthylation (par exemple Eaql) et par une enzyme insensible à la méthylation (par exemple EcoRI) on peut révéler la présence de la mutation au niveau du site X fragile et l'état de méthylation.In addition, by using the probes described above, for the revelation of the DNA fragments which have been previously subjected to a double digestion by an enzyme sensitive to methylation (for example Eaql) and by an enzyme insensitive to methylation ( for example EcoRI) we can reveal the presence of the mutation at the fragile X site and the state of methylation.
Les sondes de 1'invention permettent également l'accès à la région dans laquelle se situent le ou les gènes impliqués dans l'expression clinique du syndrome X fragile. En effet, l'identification de sites CpG tels que BssHII, EagI, SacII dans la région proche de la position 125 kb, indique la présence de gènes adjacents, dont l'expression est contrôlée par cette région (îlot CpG) . Les sondes correspondant à ces gènes sont utiles pour la détection des ARN messagers correspondants, ou pour la construction de vecteurs d'expression des protéines correspondantes en vue d'application thérapeutique ou pour la production d'anticorps spécifiques susceptibles également d'être utilisés en diagnostic.The probes of the invention also allow access to the region in which the gene or genes involved in the clinical expression of fragile X syndrome are located. Indeed, the identification of CpG sites such as BssHII, EagI, SacII in the region close to the 125 kb position, indicates the presence of adjacent genes, the expression of which is controlled by this region (CpG islet). The probes corresponding to these genes are useful for the detection of the corresponding messenger RNAs, or for the construction of vectors for expression of the corresponding proteins for therapeutic application or for the production of specific antibodies which may also be used in diagnosis .
L'Homme de l'Art dispose des moyens permettant d'identifier voire de sélectionner ceux des fragments d'acide nucléique correspondant aux gènes présents dans la région entre les sondes St677 et Do33 de part et d'autre de la position 125 kb, lesquels gènes sont susceptibles d'être inactivés directement par mutation ou indirectement en raison de la méthylation des sites CpG présents autour de la position 125 kb.Those skilled in the art have the means to identify or even select those of the nucleic acid fragments corresponding to the genes present in the region between the probes St677 and Do33 on either side of the 125 kb position, which genes are likely to be inactivated directly by mutation or indirectly due to the methylation of CpG sites present around the 125 kb position.
A cet égard un fragment selon l'invention est caractérisé en ce qu'il hybride sélectivement avec un ARNm présent dans des cellules humaines, par exemple des leucocytes et en ce qu'il correspond à un gène dont l'extrémité 5' est contenue ou adjacente à l'ilôt CpG en position 125 kb sur la carte génétique représentée à la figure 2A.In this regard, a fragment according to the invention is characterized in that it selectively hybridizes with an mRNA present in human cells, for example leukocytes and in that it corresponds to a gene whose 5 'end is contained or adjacent to the CpG island in position 125 kb on the genetic map shown in Figure 2A.
Un autre fragment particulier de l'invention est caractérisé en ce qu'il est compris dans l'ADN défini entre la sonde Do33 et la position 125 kb à environ 100 kb de la sonde Do33 de la région Xq27-q28 du chromosome X, et ce qu'il hybride sélectivement avec un ARNm présent dans des cellules humaines, par exemple des leucocytes.Another particular fragment of the invention is characterized in that it is included in the DNA defined between the Do33 probe and the 125 kb position at approximately 100 kb of the Do33 probe of the Xq27-q28 region of the X chromosome, and that it selectively hybridizes with an mRNA present in human cells, for example leukocytes.
A ce titre, l'invention concerne tout ADN recombinant contenant un fragment d'acide nucléique de l'invention associé à toute séquence permettant la transcription et/ou la traduction dans la cellule hôte dans laquelle ledit ADN recombinant est susceptible d'être introduit. L'invention concerne aussi en conséquence les vecteurs de clonage et d'expression contenant un des fragments d'acide nucléique de l'invention.As such, the invention relates to any recombinant DNA containing a nucleic acid fragment of the invention associated with any sequence allowing transcription and / or translation in the host cell into which said recombinant DNA is capable of being introduced. The invention therefore also relates to the cloning and expression vectors containing one of the nucleic acid fragments of the invention.
L'introduction de l'ADN recombinant est avantageusement réalisée à l'aide d'un vecteur, notamment du type plasmidique, apte à se répliquer dans la cellule hôte et à y permettre la transcription de l'ARN correspondant et l'expression des protéines codées par le fragment d'acide nucléique contenu dans l'ADN recombinant.The introduction of the recombinant DNA is advantageously carried out using a vector, in particular of the plasmid type, able to replicate in the host cell and to allow the transcription of the corresponding RNA and the expression of the proteins. encoded by the nucleic acid fragment contained in the recombinant DNA.
Les cellules hôtes sus-mentionnées peuvent être des cellules procaryotes, notamment des cellules de E.coli, ou, d'une manière plus avantageuse, des cellules eucaryotes, qui permettent d'obtenir des protéines glycosylées et matures (levures, cellules CHO, ou cellules d'insectes infectées par le bacculovirus) . Ces protéines peuvent avantageusement être utilisées pour la préparation d'anticorps spécifiques utiles pour le diagnostic du syndrome X fragile et dans des applications thérapeutiques.The host cells mentioned above can be prokaryotic cells, in particular E. coli cells, or, more advantageously, eukaryotic cells, which make it possible to obtain glycosylated and mature proteins (yeasts, CHO cells, or insect cells infected with bacculovirus). These proteins can advantageously be used for the preparation of specific antibodies useful for the diagnosis of fragile X syndrome and in therapeutic applications.
Outre les caractéristiques qui précèdent, l'invention comporte d'autres caractéristiques qui apparaîtront au cours de la description qui suit et qui se réfèrent à des exemples de mise en oeuvre de la présente invention et qui sont illustrés par la figure, étant entendu que ces exemples ne sauraient constituer une quelconque limitation à la portée de l'invention. In addition to the foregoing features, the invention includes other features which will appear during the following description and which refer to examples of implementation of the present invention and which are illustrated in the figure, it being understood that these examples should not constitute any limitation to the scope of the invention.
I - Préparation des sondes 8t677 et Do33I - Preparation of probes 8t677 and Do33
Des segments d'ADN correspondant aux sondes St677 et Do33 peuvent être obtenus à partir d'ADN humain par amplification génétique en utilisant les oligonucléotides suivants :DNA segments corresponding to probes St677 and Do33 can be obtained from human DNA by genetic amplification using the following oligonucleotides:
- pour ST 677- for ST 677
5•ACTCCTTCACAAATCTTCCG3' et5 • ACTCCTTCACAAATCTTCCG3 'and
5'ATCATGCAAGACAGTTCTCTGC3» 5'ATCATGCAAGACAGTTCTCTGC3 »
- pour Dθ33- for Dθ33
5«GTG.AAGCAATTTGAGTTGGTGGGAG3• et5 GTG.AAGCAATTTGAGTTGGTGGGAG3 • and
5'CCCAAGTTTAGCTTCCGTAGAAGCC3'5'CCCAAGTTTAGCTTCCGTAGAAGCC3 '
Les conditions d'amplification dans un milieu standard sont les suivantes :The amplification conditions in a standard medium are as follows:
- hybridation : 1 minute à 60*C,- hybridization: 1 minute at 60 ° C,
- élongation : 8 minutes à 72*C,- elongation: 8 minutes at 72 ° C,
- dénaturation : 1 minute à 94*C.- denaturation: 1 minute at 94 * C.
II - Préparation des sondes de l'inventionII - Preparation of the probes of the invention
.Les sondes de l'invention ont été obtenues par sous-clonage des fragments d'acide nucléique de l'invention provenant de la digestion de segments d'ADN contenus dans la région d'environ 225 kb définie entre les sondes St677 et Do33, et localisés dans la région Xq27-q28 du chromosome X humain, clone sous forme de chromosome artificiel de levure (YAC) et représenté à la figure 1.The probes of the invention were obtained by subcloning the nucleic acid fragments of the invention originating from the digestion of DNA segments contained in the region of approximately 225 kb defined between the probes St677 and Do33, and located in the Xq27-q28 region of the human X chromosome, cloned as an artificial yeast chromosome (YAC) and represented in FIG. 1.
En particulier le sous-clonage vise à obtenir des sondes spécifiques de fragments situés dans la région de 20 kb autour de la position 125 kb et correspondant donc spécifiquement aux fragments d'acide nucléique adjacents ou comprenant les sites à CpG. A titre d'exemple une telle sonde est obtenue par sous-clonage de fragments préparés par double digestion Eaql, B ll du clone 141H5. La sonde obtenue 9B12 correspond à un fragment Eagl-Bgll d'environ 7 kb contenant le site Eaql à la position 125 kb sur la carte de la figure 1.In particular, subcloning aims to obtain specific probes for fragments located in the region of 20 kb around the position 125 kb and corresponding therefore specifically to the nucleic acid fragments adjacent to or comprising the CpG sites. By way of example, such a probe is obtained by subcloning of fragments prepared by double digestion Eaql, B ll of the clone 141H5. The probe obtained 9B12 corresponds to an Eagl-Bgll fragment of approximately 7 kb containing the Eaql site at the position 125 kb on the map of FIG. 1.
La figure 2 est une représentation schématique de la carte de la sonde 9B12 et de ses sous-fragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 et 9B12.5, orientés de façon inverse de la figure 1. Cette figure comporte 7 lignes suivantes :FIG. 2 is a diagrammatic representation of the map of the probe 9B12 and of its subfragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 and 9B12.5, oriented inversely to FIG. 1. This figure has the following 7 lines:
- la ligne (1) est une échelle en kb sur laquelle est mentionnée en 0 la position 125 kb définie sur la carte du segment clone de la figure 1 entre les sondes St677 et Do33 à environ 100 à 125 kb de la sonde Do33. la ligne (2) est une représentation en concordance avec l'échelle de la sonde 9B12 et de ses sous-fragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 et 9B12.5.- the line (1) is a scale in kb on which is mentioned in 0 the position 125 kb defined on the map of the clone segment of FIG. 1 between the probes St677 and Do33 at approximately 100 to 125 kb from the probe Do33. line (2) is a representation in agreement with the scale of the probe 9B12 and its subfragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 and 9B12.5.
- la ligne (3) représente la localisation, en concordance avec l'échelle, des sites BanI (GGPyPuCC) et notamment le site BanI polymorphique noté RFLP et le site BanI sensible à la méthylation noté Me.line (3) represents the location, in agreement with the scale, of the BanI sites (GGPyPuCC) and in particular the polymorphic BanI site noted RFLP and the BanI site sensitive to methylation noted Me.
- la ligne (4) représente la localisation, en concordance avec l'échelle, des sites Xmnl (GAANNNNTTC) .- line (4) represents the location, in accordance with the scale, of the Xmnl sites (GAANNNNTTC).
- la ligne (5) représente la localisât- n, en concordance avec l'échelle de la ligne (1), des sites BglII (AGATCT) .- line (5) represents the location, in accordance with the scale of line (1), of the BglII sites (AGATCT).
- la ligne (6) représente la localisation, en concordance avec l'échelle de la ligne (1), des sites EcoRI (GAATCC) . - la ligne (7) représente la localisation, en concordance avec l'échelle de la ligne (1), des sites HindIII (AAGCT) .- line (6) represents the location, in line with the scale of line (1), of the EcoRI sites (GAATCC). - line (7) represents the location, in accordance with the scale of line (1), of the HindIII sites (AAGCT).
Les cartes des sites BanI, XmnI et EcoRI correspondent aux fragments altérés chez les porteurs de mutation X fragile.The BanI, XmnI and EcoRI site maps correspond to altered fragments in carriers of the fragile X mutation.
III- Diagnostic du retard «entai X fragile par détection d'anomalies de Méthylation selon la Méthode de Southern BlotIII- Diagnosis of the “fragile X” delay by detection of methylation anomalies according to the Southern Blot Method
L'ADN génomique extrait de leucocytes d'un patient atteint de retard mental, est coupé par les enzymes Avall, BanI ou XmnI. Les fragments d'ADN obtenus sont analysés par électrophorèse sur gel d'agarose 0,9% en tampon TAE, puis transférés sur une membrane de nylon.Genomic DNA extracted from leukocytes from a patient with mental retardation is cut by the enzymes Avall, BanI or XmnI. The DNA fragments obtained are analyzed by electrophoresis on 0.9% agarose gel in TAE buffer, then transferred to a nylon membrane.
La membrane sur laquelle sont fixés les fragments d'ADN est soumise à un traitement de pré-hybridation à 42"C pendant 2 heures avec une solution ayant la composition suivante : 40% formamide ; 0,9 M NaCl ; 200 μg/ml d'ADN de sperme de saumon ; 50 mM de sodium phosphate pH 6,5 ; 4% de dextran sulfate ; 0,8% (poids/volume) de ficoll et de polyvinyl pyrrolidone ; puis la solution de pré-hybridation est remplacée par une solution d'hybridation identique à la solution de pré-hybridation, et comprenant en outre la sonde 9B12.3 marquée au dCTP alpha ^P et d'activité spécifique 2 10B dpm/μg ; après incubation pendant 18 heures à 42"C et lavages successifs avec une solution 0,5 SSC à 65*C, on effectue une autoradiographie à -80'C.The membrane on which the DNA fragments are fixed is subjected to a pre-hybridization treatment at 42 "C for 2 hours with a solution having the following composition: 40% formamide; 0.9 M NaCl; 200 μg / ml d '' Salmon sperm DNA; 50 mM sodium phosphate pH 6.5; 4% dextran sulfate; 0.8% (weight / volume) of ficoll and polyvinyl pyrrolidone; then the pre-hybridization solution is replaced by a hybridization solution identical to the pre-hybridization solution, and further comprising the probe 9B12.3 labeled with dCTP alpha ^ P and of specific activity 2 10 B dpm / μg; after incubation for 18 hours at 42 "C and successive washings with a 0.5 SSC solution at 65 ° C., autoradiography is carried out at -80 ° C.
Tout ou partie des fragments Avall, BanI ou XmnI détectés chez les sujets normaux est remplacée chez les sujets exprimant le syndrome X fragile par des fragments plus grands. En particulier avec l'enzyme XmnI, l'apparition de plusieurs bandes assez proches les unes des autres est très caractéristique des sujets ayant une expression phénotypique du syndrome.All or part of the Avall, BanI or XmnI fragments detected in normal subjects is replaced in subjects expressing fragile X syndrome by larger fragments. In particular with the enzyme XmnI, the appearance of several bands fairly close to each other is very characteristic of subjects with a phenotypic expression of the syndrome.
Cette distinction entre anomalies liées à l'expression clinique et/ou cytogénétique et anomalies présentes chez des personnes porteuses de mutation X fragile sans expression clinique et/ou cytogénétique est explicitée dans les exemples suivants de détection desdites anomalies par la méthode de Southern Blot.This distinction between anomalies linked to clinical and / or cytogenetic expression and anomalies present in people carrying a fragile X mutation without clinical and / or cytogenetic expression is explained in the following examples of detection of said anomalies by the Southern Blot method.
Anomalies liées à l'expression clinique et/ou cytogénétiqueAbnormalities related to clinical and / or cytogenetic expression
a - Digestion par l'enzyme BanI (site GG Py Pu CC)a - Digestion by the enzyme BanI (GG Py Pu CC site)
La figure 3 est une représentation schématique d'une image d'autoradiographie sur gel d'agarose à 0,9%, d'ADN de leucocytes ou de villosités chorialeε d'hommes normaux (1 et 5) , d'un homme avec X fragile (3), d'une femme vectrice (4) et d'une femme normale, digérés par BanI et révélés par la sonde 9B12.3.FIG. 3 is a schematic representation of a autoradiography image on 0.9% agarose gel, of DNA of leukocytes or chorionic villi of normal men (1 and 5), of a man with X fragile (3), of a vector woman (4) and of a normal woman, digested by BanI and revealed by the probe 9B12.3.
La figure 4 est une représentation schématique d'une image d'autoradiographie sur gel d'agarose à 0,9%, d'ADN de villosités choriales d'un homme normal (2) , d'un homme avec X fragile (3) , d'un foetus avec X fragile, digérés par BanI et révélés par la sonde 9B12.3.FIG. 4 is a schematic representation of a autoradiography image on 0.9% agarose gel, of chorionic villus DNA from a normal man (2), from a man with fragile X (3) , of a fetus with fragile X, digested with BanI and revealed by the probe 9B12.3.
La sonde 9B12.3 détecte dans l'ADN génomique d'un homme normal, après digestion par l'enzyme BanI, soit un seul fragment de 2,9 kb (allèle 1) ou deux fragments de 2,3 et 0,6 kb (allèle 2). L'existence de deux allèles est due à la présence d'une site BanI polymorphique indiqué RFLP sur la figure 2. Chez un patient mâle atteint de retard mental avec X fragile porteur de l'allèle 1, le fragment de 2,9 kb est remplacé plus ou moins complètement par un fragment de 3,5 kb. Chez un patient porteur de l'allèle 2, le fragment de 0,6 kb est remplacé plus ou moins complètement par un fragment de 1,2 kb. Ces différences spécifiques, chez le mâle, du retard mental avec X fragile sont dues à la méthylation d'un site BanI, indiqué Me sur la figure 2. Ce site est inclu dans la séquence suivante : TCGGTGCCGA, compatible avec une inhibition par méthylation de la cytosine.The 9B12.3 probe detects in the genomic DNA of a normal man, after digestion with the enzyme BanI, either a single fragment of 2.9 kb (allele 1) or two fragments of 2.3 and 0.6 kb (allele 2). The existence of two alleles is due to the presence of a polymorphic BanI site indicated RFLP in FIG. 2. In a male patient suffering from mental retardation with fragile X carrying allele 1, the 2.9 kb fragment is replaced more or less completely by a 3.5 kb fragment. In a patient carrying allele 2, the 0.6 kb fragment is replaced more or less completely by a 1.2 kb fragment. These specific differences, in the male, of mental retardation with fragile X are due to the methylation of a BanI site, indicated Me in FIG. 2. This site is included in the following sequence: TCGGTGCCGA, compatible with inhibition by methylation of cytosine.
L'anomalie a été détectée non seulement sur ADN de leucocytes, mais également sur ADN de villosités choriales de foetus porteurs de mutation X fragile. Elle est donc utilisable en diagnostic post-natal ou anténatal chez les mâles.The anomaly was detected not only on DNA from leukocytes, but also on DNA from chorionic villi of fetuses carrying a fragile X mutation. It can therefore be used in postnatal or antenatal diagnosis in males.
Les fragments de 3,5 kb et 1,2 kb peuvent par contre être détectés chez les femmes normales (méthylation du site BanI sur le chromosome X inactif) . Toutefois, leur intensité apparaît plus forte chez les femmes vectrices avec une expression clinique ou cytogénétique du syndrome X fragile.On the other hand, fragments of 3.5 kb and 1.2 kb can be detected in normal women (methylation of the BanI site on the inactive X chromosome). However, their intensity appears stronger in women vectors with a clinical or cytogenetic expression of fragile X syndrome.
b - Digestion avec l'autre enzyme XmnI (site GAANNNNTTC)b - Digestion with the other enzyme XmnI (GAANNNNTTC site)
La figure 5 est une représentation schématique d'une image d'autoradiographie sur gel d'agarose à 0,9%, d'ADN de leucocytes d'hommes normaux (1 et 10), d'hommes avec retard mental lié au X fragile (3, 4, 6, 9), de femmes vectrices (5, 7, 8) et d'une femme normale (2) , digérés par XmnI et révélés par la sonde 9B12.3 La sonde 9B12.3 détecte un fragment de 9 kb chez les hommes et les femmes ainsi que chez les porteurs de mutation X fragile n'exprimant pas cliniquement ou cytogénétiquement la maladie. Chez les hommes atteints de retard mental avec X fragile, le fragment de 9 kb est remplacé en tout ou partie par des fragments de taille apparente supérieure à 10 kb. L'apparition de tels fragments est également caractéristique des femmes vectrices avec expression clinique et/ou cytogénétique.FIG. 5 is a schematic representation of a autoradiography image on 0.9% agarose gel, of DNA of leukocytes of normal men (1 and 10), of men with mental retardation linked to fragile X (3, 4, 6, 9), vector women (5, 7, 8) and a normal woman (2), digested with XmnI and revealed by the probe 9B12.3 The 9B12.3 probe detects a 9 kb fragment in men and women as well as in carriers of a fragile X mutation not expressing the disease clinically or cytogenetically. In men with mental retardation with fragile X, the 9 kb fragment is replaced in whole or in part by fragments of apparent size greater than 10 kb. The appearance of such fragments is also characteristic of female vectors with clinical and / or cytogenetic expression.
IV- Diagnostic d'anomalies présentes chez les personnes porteuses de mutation X fragile sans expression clinique et/ou cytogénétiqueIV- Diagnosis of anomalies present in people carrying a fragile X mutation without clinical and / or cytogenetic expression
La figure 6 est une représentation schématique d'une image d'autoradiographie sur gel d'agarose à 0,9%, d'ADN de leucocytes de femmes normales (9, 12, 13) et de femmes vectrices (1 à 8, 10 et 11) de la mutation X fragile n'exprimant pas toutes des signes clinique ou cytogénétique, digérés par EcoRI et révélés par la sonde 9B12.3FIG. 6 is a schematic representation of an autoradiography image on 0.9% agarose gel, of DNA of leukocytes of normal women (9, 12, 13) and of vector vectors (1 to 8, 10 and 11) of the fragile X mutation not all expressing clinical or cytogenetic signs, digested with EcoRI and revealed by the probe 9B12.3
La sonde 9B12.3 détecte un fragment EcoRI d'environ 6 kb chez un homme normal ou une femme normale. Par contre chez une femme vectrice de mutation X fragile, un fragment additionnel plus grand, de taille variable selon les individus (6 à 7 kb) est présent. Cette anomalie apparaît chez les femmes vectrices sans expression clinique et/ou cytogénétique, et peut donc être utilisée pour le diagnostic des femmes vectrices. Chez les hommes atteints, le fragment normal est remplacé par un fragment ou une série de fragments de taille apparente plus élevée. Des résultats très semblables sont obtenus avec l'enzyme HindIII. La figure 9 est une autre représentation de la détection de mutations au niveau de la région X fragile, par digestion de l'ADN avec EcoRI au moyen de la sonde stB12.3.The 9B12.3 probe detects an EcoRI fragment of approximately 6 kb in a normal man or a normal woman. On the other hand, in a woman vector of a fragile X mutation, an additional larger fragment, of variable size according to the individuals (6 to 7 kb) is present. This anomaly appears in vector women without clinical and / or cytogenetic expression, and can therefore be used for the diagnosis of vector women. In affected men, the normal fragment is replaced by a fragment or series of fragments of larger apparent size. Very similar results are obtained with the enzyme HindIII. FIG. 9 is another representation of the detection of mutations at the level of the fragile X region, by digestion of the DNA with EcoRI using the probe stB12.3.
Figure 9 : détection des mutations X fragile dans les produits de digestion d'ADN génomique par EcoRI. L'ADN de leucocytes a été totalement digéré par EcoRI. Les flèches indiquent la taille du fragment normal (5,2 kb) et certains fragments mutés. Sur la gauche Δ fait référence à l'accroissement de taille du fragment muté. Les symboles décrivant les sujets et leurs relations à l'intérieur de la famile sont présentés en haut. Les carrés et les ronds représentent respectivement les hommes et les femmes. Les symboles ouverts qui ne sont pas coupés en deux indiquent les sujets qui sont apparemment normaux et qui n'ont pas été testés cytogénétiquement. Pour les symboles coupés en deux, la partie droite représente la séquence du site X fragile et la partie gauche le degré de retard mental. Les symboles coupés en deux, en blanc coïncident avec des sujets normaux avec aucun syndrome X fragile, les symboles hachurés correspondent à des sujets avec un retard mental faible et une expression X fragile dans moins de 4% des cellules et les symboles pleins correspondent à des sujets avec retard mental et expression X fragile dans plus de 4% des cellules. Les symboles contenus dans un triangle correspondent à des échantillons obtenus d'un foetus. Les symboles en pointillés montrent des sujets pour lesquels la digestion par EcoRI a été faite et qui n'apportent pas de renseignement pour clarifier la relation familiale des autres sujets. L'échantillon à ligne 22 avait un nuage faible à 7,5 kb dans le produit de digestion par EcoRI. Ce nuage est plus visible comme une bande à 3 kb dans le produit de digestion par BqlII du même échantillon, montré sur la droite ; il est localisé juste au dessus du fragment BqlII normal qui a une longueur de 12 kb.Figure 9: Detection of fragile X mutations in genomic DNA digestion products by EcoRI. The leukocyte DNA was fully digested with EcoRI. The arrows indicate the size of the normal fragment (5.2 kb) and certain mutated fragments. On the left Δ refers to the increase in size of the mutated fragment. The symbols describing the subjects and their relationships within the family are presented above. The squares and circles represent men and women respectively. Open symbols that are not cut in half indicate subjects who are apparently normal and have not been tested cytogenetically. For symbols cut in half, the right part represents the sequence of the fragile X site and the left part the degree of mental retardation. Symbols cut in half, in white, coincide with normal subjects with no fragile X syndrome, hatched symbols correspond to subjects with low mental retardation and fragile X expression in less than 4% of cells and solid symbols correspond to subjects with mental retardation and fragile X expression in more than 4% of cells. The symbols contained in a triangle correspond to samples obtained from a fetus. The dotted symbols show subjects for which EcoRI digestion has been carried out and which do not provide information to clarify the family relationship of the other subjects. The sample on line 22 had a weak cloud at 7.5 kb in the EcoRI digestion product. This cloud is more visible as a band at 3 kb in the BqlII digestion product from the same sample, shown on the right; it is located just above the normal BqlII fragment which is 12 kb in length.
V - Diagnostic du ratard Mental avec X fragile par amplification génétique du fragment contenant une anomalie de MéthylationV - Diagnosis of the mental rat with fragile X by genetic amplification of the fragment containing a methylation anomaly
L'ADN génomique extrait de leucocytes d'un patient atteint de retard mental, est soumis à une digesiton par une enzyme à site sensible à la méthylation telle que Avall, BanI ou XmnI et l'amplification est réalisée en parallèle sur l'ADN génomique digéré par l'enzyme de restriction sensible à la méthylation, et sur l'ADN non digéré.The genomic DNA extracted from leukocytes of a patient suffering from mental retardation, is subjected to a digesiton by an enzyme with a site sensitive to methylation such as Avall, BanI or XmnI and the amplification is carried out in parallel on the genomic DNA digested with the methylation sensitive restriction enzyme, and on undigested DNA.
Deux oligonucléotides de 20 à 30 nucléotides adjacents au fragment d'ADN génomique à amplifier contenant le site pour l'enzyme sensible à la méthylation, sont hybrides avec l'ADN soumis à la digestion et l'ADN non soumis à la digestion. Puis un processus d'extension enzymatique à l'aide d'ADN- poly érase, suivi d'un processus de dénaturation est mis en oeuvre ; le cycle hybridation-extension-dénatu- ration est répété un nombre de fois suffisant pour augmenter la quantité du fragment contenant les sites à CpG dans une proportion exponentielle par rapport au nombre de cycles effectués.Two oligonucleotides of 20 to 30 nucleotides adjacent to the genomic DNA fragment to be amplified, containing the site for the enzyme sensitive to methylation, are hybridized with the DNA subjected to digestion and the DNA not subjected to digestion. Then an enzymatic extension process using DNA polyerase, followed by a denaturation process is implemented; the hybridization-extension-denaturation cycle is repeated a number of times sufficient to increase the quantity of the fragment containing the CpG sites in an exponential proportion relative to the number of cycles carried out.
Le nombre de cycles d'amplification est limité de façon à conserver une linéarité de l'amplification et donc une estimation quantitative de la digestibilité du site de l'enzyme sensible à la méthylation. Avantageusement des marqueurs internes sont utilisés, notamment d'autres fragments du génome co-amplifié contenant un site de l'enzyme sensible à la méthylation, non méthylé chez l'homme, ou de fragments ne contenant pas un tel site.The number of amplification cycles is limited so as to maintain a linearity of the amplification and therefore a quantitative estimate of the digestibility of the site of the enzyme sensitive to methylation. Advantageously, internal markers are used, in particular other fragments of the co-amplified genome containing a site of the methylation-sensitive enzyme, not methylated in humans, or of fragments not containing such a site.
L'analyse des produits d'amplification est réalisée par visualisation de la fluorescence induite par le bromure d'éthidium, après électrophorèse sur gel d'agarose ou de polyacrylamide. Si le site sensible à la méthylation est méthylé, le fragment amplifié est présent dans les deux réactions, si le site sensible à la méthylation est non méthylé, le fragment amplifié est présent seulement dans la réaction avec l'ADN non digéré.The analysis of the amplification products is carried out by visualization of the fluorescence induced by ethidium bromide, after electrophoresis on agarose or polyacrylamide gel. If the methylation-sensitive site is methylated, the amplified fragment is present in both reactions, if the methylation-sensitive site is unmethylated, the amplified fragment is present only in the reaction with undigested DNA.
VI- Détection de Mutations du aite X fragile et schéma de Méthylation de l'ADW digéré par EcoRI et EaglVI- Detection of mutations in fragile aite X and ADW methylation scheme digested with EcoRI and Eagl
Des familles présentant le syndrome X fragile ont été analysées par double digestion de l'ADN avec EcoRI et Eaql, un procédé qui a permis de révéler à la fois la présence de la mutation et l'état de la méthylation (Eaql est incapable de couper l'ADN si le site de restriction riche en CpG est méthylé) . Les résultats sont présentés à la figure 10. Pour cette double digestion, stB12.3 a hybride avec l'ADN de toutes les personnes normales, avec un fragment de 2,8 kb EcoRI-Eaql, correspondant au chromosome X actif (figure 10, lignes 2, 4, 5 et 14) ; chez les femmes il y a également eu hybridation avec un fragment EcoRI supplémentaire de 5,2 kb, correspondant au chromosome X inactif méthylé (lignes 1, 7, 18 et 27). Le fragment de 2,8 kb était absent chez les hommes présentant une mutation X fragile, alors que les femmes porteuses de la mutation avaient à la fois les fragments normaux (2,8 et 5,2 kb) et les fragments mutés. Les prémutations ont été détectées sous forme de fragments EcoRI-Eaql de 2,9 à environ 3,3 kb chez les hommes (ligne 3) et ont été détectées sur le chromosome X actif des femmes (lignes 8, 24, 26 et semblables) alors que des fragments EcoRI de 5,3 à 5,7 kb correspondaient à une prémutation sur le chromosome X inactif. Les fragments correspondant à des mutations complètes n'ont pas été digérés par Eaql et apparaissent donc comme des bandes simples ou hétérogènes au dessus de 5,7 kb (lignes 10, 12, 15 et semblables). Les cas de mosaïque (bande supplémentaire correspondant à une prémutation et présente en proportion variable) sont apparus sous forme d'un mélange de mutation complète (méthylée) et de prémutation non méthylée (lignes 20 et 21) . Ceci est vérifié pour la plupart des cas de méthylation incomplète déjà reconnus chez les hommes avec le syndrome X fragile. Quelques personnes présentaient une bande partiellement non méthylée, plutôt homogène avec un accroissement de taille entre 600 à lOOObp. Ce schéma a été décrit comme "mosaïque de méthylation".Families with fragile X syndrome were analyzed by double digestion of DNA with EcoRI and Eaql, a process which revealed both the presence of the mutation and the state of methylation (Eaql is unable to cut DNA if the restriction site rich in CpG is methylated). The results are presented in FIG. 10. For this double digestion, stB12.3a hybridizes with the DNA of all normal people, with a 2.8 kb EcoRI-Eaql fragment, corresponding to the active X chromosome (FIG. 10, lines 2, 4, 5 and 14); in women there was also hybridization with an additional 5.2 kb EcoRI fragment, corresponding to the inactive methylated X chromosome (lines 1, 7, 18 and 27). The 2.8 kb fragment was absent in men with a fragile X mutation, while women with the mutation had both normal fragments (2.8 and 5.2 kb) and the mutated fragments. Premutations were detected as EcoRI-Eaql fragments of 2.9 to approximately 3.3 kb in men (line 3) and were detected on the active X chromosome of women (lines 8, 24, 26 and the like) whereas EcoRI fragments of 5.3 to 5.7 kb corresponded to a premutation on the inactive X chromosome. The fragments corresponding to complete mutations were not digested by Eaql and therefore appear as simple or heterogeneous bands above 5.7 kb (lines 10, 12, 15 and the like). The mosaic cases (additional band corresponding to a premutation and present in variable proportion) appeared as a mixture of complete mutation (methylated) and unmethylated premutation (lines 20 and 21). This is verified for most cases of incomplete methylation already recognized in men with fragile X syndrome. Some people presented a partially homogeneous, partially unmethylated band with an increase in size between 600 to 10000bp. This scheme has been described as "methylation mosaic".
La figure 10 représente la détection des mutations X fragile et du schéma de méthylation pour l'ADN digéré par EcoRI et Eaql : l'ADN de leucocytes a été digéré simultanément complètement avec les enzymes EcoRI et Eaql. Les tailles sont indiquées sur la gauche pour certains des fragments mutés et pour les fragments normaux sur les chromosomes X actifs et inactifs (2,8 et 5,2 kb rspectivement) . Δ correspond à l'accroissement de taille des fragments mutés. Les schémas d'hybridation sont identifiés sur la droite. Le trait "/" dénote un membre de la famille décédé. S'agissant des autres symboles se reporter à la figure 9. Les résultats pour les lignes 6 et 16 sont faibles. L'hybridation de ces échantillons à une sonde contrôle a montré que ces lignes contenaient autant d'ADN que les autres et ne présentaient pas d'artefact de migration.FIG. 10 represents the detection of the fragile X mutations and of the methylation scheme for the DNA digested with EcoRI and Eaql: the DNA of leukocytes was simultaneously digested completely with the enzymes EcoRI and Eaql. The sizes are indicated on the left for some of the mutated fragments and for the normal fragments on the active and inactive X chromosomes (2.8 and 5.2 kb respectively). Δ corresponds to the increase in size of the mutated fragments. Hybridization patterns are identified on the right. The "/" trait denotes a deceased family member. For the other symbols, see Figure 9. The results for lines 6 and 16 are poor. Hybridization of these samples with a control probe showed that these lines contained as much DNA as the others and did not exhibit any migration artifacts.
Références aux figuresReferences to figures
Figure 2A :Figure 2A:
/V\ bandes floues (chez les patients ou les personnes susceptibles de transmettre la maladie) * tailles anormales / V \ fuzzy bands (in patients or people susceptible to transmitting the disease) * abnormal sizes

Claims

R E V E N D I C A T I O N S
1. Fragment d'acide nucléique issu de la région Xq27- q28 du chromosome X, caractérisé en ce qu'il est compris dans le segment d'ADN d'environ 225 kb défini entre les sondes St677 et Do33, et en ce qu'il contient au moins 15pb ou nucléotides.1. Nucleic acid fragment from the Xq27- q28 region of the X chromosome, characterized in that it is included in the DNA segment of approximately 225 kb defined between the probes St677 and Do33, and in that it contains at least 15bp or nucleotides.
2. Fragment d'acide nucléique selon la revendication 1, caractérisé en ce qu'il est adjacent aux sites à CpG ou en ce qu'il contient les sites à CpG, (Eaql, BssHII, SacII) , situé dans la région de 20 kb autour de la position 125 kb définie par rapport à la carte génétique de la figure 2A.2. Nucleic acid fragment according to claim 1, characterized in that it is adjacent to the CpG sites or in that it contains the CpG sites, (Eaql, BssHII, SacII), located in the region of 20 kb around the 125 kb position defined with respect to the genetic map of Figure 2A.
3. Fragment d'acide nucléique, caractérisé en ce qu'il hybride sélectivement avec un fragment d'acide nucléique selon l'une quelconque des revendications 1 ou 2, et en ce qu'il s'agit d'ADN ou d'ARN.3. Nucleic acid fragment, characterized in that it selectively hybridizes with a nucleic acid fragment according to any one of claims 1 or 2, and in that it is DNA or RNA .
4. Fragment d'acide nucléique selon la revendication 1 ou la revendication 2, caractérisé en ce qu'il hybride sélectivement avec un ARNm présent dans des cellules humaines, par exemple des leucocytes et en ce qu'il correspond à un gène dont l'extrémité 5' est contenue ou adjacente à l'ilôt CpG en position 125 kb sur la carte génétique représentée à la figure 2A.4. Nucleic acid fragment according to claim 1 or claim 2, characterized in that it selectively hybridizes with an mRNA present in human cells, for example leukocytes and in that it corresponds to a gene whose 5 ′ end is contained or adjacent to the CpG island in position 125 kb on the genetic map represented in FIG. 2A.
5. Fragment d'acide nucléique, caractérisé en ce qu'il s'agit de l'ADNc correspondant à l'ADN selon la revendication 4.5. Nucleic acid fragment, characterized in that it is the cDNA corresponding to the DNA according to claim 4.
6. Sonde nucléotidique pour détecter in vitro des mutations responsables du syndrome X fragile, ou d'autres anomalies conséquentes à la présence desdites mutations ou pour localiser le ou les gènes impliqués dans le syndrome X fragile, caractérisée en ce qu'elle est capable d'hybrider sélectivement avec un fragment d'acide nucléique selon l'une quelconque des revendications 1 à 5. 6. Nucleotide probe to detect in vitro mutations responsible for fragile X syndrome, or other anomalies resulting from the presence of said mutations or to locate the gene or genes involved in fragile X syndrome, characterized in that it is capable of '' Selectively hybridize with a nucleic acid fragment according to any one of Claims 1 to 5.
7. Sonde nucléotidique selon la revendication 5, caractérisée en ce qu'elle est choisie parmi : les fragments 9B12 (Eaql-Bqll) d'environ 7000bp, 9B12.3 (Pstl-PstI) d'environ 1200bp (Pstl-PstI) d'environ lOOObp, 9B12.5 (EaqI-PstI) d'environ 900bp, 9B12.2 (Pstl-PstI) d'environ 1800bp, stA22 (Avall-Avall) d'environ 1500bp, stX21 d'environ 3800bp et stX21E (centromérique du site Eaql) ; - les fragments hybridant sélectivement avec l'un des fragments ci-dessus.7. Nucleotide probe according to claim 5, characterized in that it is chosen from: fragments 9B12 (Eaql-Bqll) of approximately 7000bp, 9B12.3 (Pstl-PstI) of approximately 1200bp (Pstl-PstI) d '' approx 100OOp, 9B12.5 (EaqI-PstI) approx 900bp, 9B12.2 (Pstl-PstI) approx 1800bp, stA22 (Avall-Avall) approx 1500bp, stX21 approx 3800bp and stX21E (centromeric from the Eaql site); - the fragments selectively hybridizing with one of the above fragments.
8. Sonde nucléotidique selon l'une quelconque des revendications 5 ou 6, caractérisée en ce qu'elle correspond au fragment 9B12.3 compris entre les nucléotides 1 et 1078 de l'enchaînement représenté à la figure 8, ou toute partie de ce fragment hybridant sélectivement avec un fragment d'acide nucléique selon l'une quelconque des revendications 1 à 4.8. Nucleotide probe according to any one of claims 5 or 6, characterized in that it corresponds to fragment 9B12.3 comprised between nucleotides 1 and 1078 of the sequence represented in FIG. 8, or any part of this fragment selectively hybridizing with a nucleic acid fragment according to any one of claims 1 to 4.
9. Sonde nucléotidique selon l'une quelconque des revendications 5 à 6, caractérisée en ce qu'elle correspond au fragment 9B12.5 compris entre les nucléotides 1079 et 1985 de l'enchaînement représenté à la figure 8, ou toute partie de ce fragment hybridant sélectivement avec un fragment d'acide nucléique selon l'une quelconque des revendications 1 à 4.9. nucleotide probe according to any one of claims 5 to 6, characterized in that it corresponds to the fragment 9B12.5 comprised between the nucleotides 1079 and 1985 of the sequence represented in FIG. 8, or any part of this fragment selectively hybridizing with a nucleic acid fragment according to any one of claims 1 to 4.
10. Sonde nucléotidique selon l'une quelconque des revendications 5 à 8, caractérisée en ce qu'elle est marquée radioactivement, ou par un marqueur non radioactif, notamment un marqueur enzymatique, un ligand, un marqueur luminescent ou fluorescent.10. Nucleotide probe according to any one of claims 5 to 8, characterized in that it is radioactively labeled, or by a non-radioactive marker, in particular an enzymatic marker, a ligand, a luminescent or fluorescent marker.
11. Fragment d'ARNm, notamment issu de leucocytes humains, caractérisé en ce qu'il hybride avec une sonde selon l'une quelconque des revendications 6 à 10.11. Fragment of mRNA, in particular derived from human leukocytes, characterized in that it hybridizes with a probe according to any one of claims 6 to 10.
12. Procédé de détection in vitro des mutations associées au syndrome X fragile ou existant chez des personnes ne présentant pas de signes cliniques ou d'autres anomalies de l'ADN conséquentes à la présence de ces mutations, caractérisé en ce qu'il comporte les étapes suivantes : le traitement d'un échantillon d'ADN génomique avec au moins une enzyme de restriction à site sensible telle que Eaql ou insensible telle que EcoRI ou HindIII à la méthylation ; la séparation des fragments par électrophorèse et leur hybridation avec au moins une sonde selon l'une quelconque des revendications 5 à 10 ; la visualisation des hybrides formés et la détection de fragments de longueur supérieure à la longueur des fragments de contrôle obtenus par traitement dans les mêmes conditions, à partir d'un échantillon biologique prélevé chez un sujet normal, non porteur de mutation au site X fragile.12. Method for in vitro detection of mutations associated with fragile X syndrome or existing in people without clinical signs or other DNA abnormalities resulting from the presence of these mutations, characterized in that it comprises the following stages: the treatment of a genomic DNA sample with at least one enzyme restriction to a sensitive site such as Eaql or insensitive such as EcoRI or HindIII to methylation; separation of the fragments by electrophoresis and their hybridization with at least one probe according to any one of Claims 5 to 10; the visualization of the hybrids formed and the detection of fragments of length greater than the length of the control fragments obtained by treatment under the same conditions, from a biological sample taken from a normal subject, not carrying a mutation at the fragile X site.
13. Procédé de détection d'anomalies de l'ADN selon la revendication 12 pour le diagnostic in vitro du syndrome X fragile, caractérisé en ce qu'il comporte les étapes suivantes : le traitement de l'ADN génomique par au moins une enzyme de restriction à site sensible à la méthylation ; la séparation des fragments par électrophorèse et leur hybridation avec au moins une sonde selon l'une quelconque des revendications 5 à 10 ; la visualisation des hybrides formés et comparaison avec les résultats obtenus dans les mêmes conditions sur des fragments de contrôle.13. A method of detecting DNA anomalies according to claim 12 for the in vitro diagnosis of fragile X syndrome, characterized in that it comprises the following steps: the treatment of genomic DNA with at least one enzyme of methylation sensitive site restriction; separation of the fragments by electrophoresis and their hybridization with at least one probe according to any one of Claims 5 to 10; visualization of the hybrids formed and comparison with the results obtained under the same conditions on control fragments.
14. Procédé pour le diagnostic in vitro du syndrome X fragile ou de la présence de mutations chez des sujets porteurs sans manifestations cliniques de retard mental, selon la revendication 13, caractérisé en ce que la digestion de l'ADN génomique est réalisée par une enzyme de restriction à site sensible à la méthylation telle que Eaql et une enzyme de restriction à site non sensible à la méthylation telle que EcoRI ou HindIII.14. Method for the in vitro diagnosis of fragile X syndrome or the presence of mutations in carriers without clinical manifestations of mental retardation, according to claim 13, characterized in that the digestion of genomic DNA is carried out by a restriction enzyme with a methylation-sensitive site such as Eaql and a restriction enzyme with a non-methylation-sensitive site such as EcoRI or HindIII.
15. Procédé d'amplification génétique d'un fragment d'acide nucléique contenant des mutations ou d'autres anomalies, au sujet du site X fragile, le cas échéant conséquentes à ces mutations, caractérisé en ce qu'il consiste à fixer par hybridation sur l'ADN génomique deux oligonucléotides marqués flanquant ledit fragment, choisis parmi les fragments d'acide nucléique de 20 à 30 nucléotides hybridant sélectivement avec les fragments d'acide nucléique selon la revendication 1 ou 2, puis à mettre en oeuvre un processus d'extension enzymatique à l'aide d'ADN-polymérase, suivi d'un processus de dénaturation, et à répéter le cycle hybridation-extension-dénaturation un nombre de fois suffisant pour augmenter la quantité du fragment dans une proportion exponentielle par rapport au nombre de cycles effectués, dans des conditions permettant la visualisation des fragments amplifiés.15. Method for the genetic amplification of a nucleic acid fragment containing mutations or other anomalies, concerning the fragile X site, if necessary consequent on these mutations, characterized in that it consists in fixing by hybridization on the genomic DNA two labeled oligonucleotides flanking said fragment, chosen from the nucleic acid fragments of 20 to 30 nucleotides selectively hybridizing with the nucleic acid fragments according to claim 1 or 2, then to implement a process of enzymatic extension using DNA polymerase, followed by a denaturation process, and repeating the hybridization-extension-denaturation cycle a number of times sufficient to increase the quantity of the fragment in an exponential proportion relative to the number of cycles carried out, under conditions allowing the visualization of the amplified fragments.
16. Procédé de diagnostic in vitro du syndrome X fragile, caractérisé en ce que l'on effectue en parallèle un procédé d'amplification génétique selon la revendication 15, d'une part sur de l'ADN soumis à la digestion par une enzyme à site sensible à la méthylation et d'autre part sur de l'ADN non soumis à la digestion par ladite enzyme, puis en ce que l'on compare les fragments obtenus visualisés au bromure d'éthidiu ou détectés grâce au marquage des oligonucléotides amorces.16. A method of in vitro diagnosis of fragile X syndrome, characterized in that a genetic amplification method according to claim 15 is carried out in parallel, on the one hand on DNA subjected to digestion with an enzyme to site sensitive to methylation and on the other hand to DNA not subjected to digestion by said enzyme, then in that the fragments obtained visualized with ethidiu bromide or compared by detection of the labeling of the priming oligonucleotides are compared.
17. Procédé de détection de mutation associée au syndrome X fragile caractérisé en ce que l'on effectue une amplification génétique selon la revendication 15 ou 16 d'un ou plusieurs fragments d'acide nucléique de la région de 20 kb autour de la position 125 kb en particulier de la région contenant les sites proches de l'ilôt CpG, et en ce que l'on détecte la disparition ou la modification de certains de ces fragments, en particulier en ce que l'on détecte des fragments allongés par rapport à la taille des fragments obtenus dans les mêmes conditions de traitement, à partir d'un échantillon normal, non porteur de la mutation X fragile.17. Method for detecting a mutation associated with fragile X syndrome, characterized in that one performs a genetic amplification according to claim 15 or 16 of one or more nucleic acid fragments of the region of 20 kb around the position 125 kb in particular of the region containing the sites close to the CpG island, and in that the disappearance or the modification of some of these fragments is detected, in particular in that fragments elongated relative to the size of the fragments obtained under the same processing conditions are detected, from a normal sample, not carrying the fragile X mutation.
18. ADN recombinant contenant au moins un fragment d'acide nucléique selon l'une quelconque des revendications 1 à 5, le cas échéant associé à une séquence permettant la transcription et/ou la traduction dans une cellule hôte choisie dans laquelle ledit ADN recombinant est susceptible d'être introduit.18. Recombinant DNA containing at least one nucleic acid fragment according to any one of claims 1 to 5, optionally associated with a sequence allowing transcription and / or translation in a chosen host cell in which said recombinant DNA is likely to be introduced.
19. Vecteur de clonage et d'expression caractérisé en ce qu'il contient un ADN recombinant selon la revendication 18.19. Cloning and expression vector characterized in that it contains a recombinant DNA according to claim 18.
20. Hôte cellulaire caractérisé en ce qu'il est transformé par un vecteur recombinant selon la revendication 19.20. Cell host characterized in that it is transformed by a recombinant vector according to claim 19.
21. Protéine résultant de la transcription et de la traduction d'un fragment d'ADNc selon la revendication 5, tel qu'obtenu par les étapes de : transformation d'un hôte cellulaire déterminé par cet ADNc, dans des conditions permettant sa transcription et sa traduction ; récupération de la protéine exprimée le cas échéant après lyse de l'hôte cellulaire.21. Protein resulting from the transcription and translation of a cDNA fragment according to claim 5, as obtained by the steps of: transformation of a cellular host determined by this cDNA, under conditions allowing its transcription and its translation; recovery of the expressed protein if necessary after lysis of the cell host.
22. Anticorps dirigés contre une protéine selon la revendication 21. 22. Antibodies directed against a protein according to claim 21.
PCT/FR1992/000145 1991-02-13 1992-02-13 Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x WO1992014840A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
DE69225797T DE69225797T2 (en) 1991-02-13 1992-02-13 NUCLEIC ACID FRAGMENT OF THE X-CHROMOSOME AREA PARTICIPATING IN THE SENSITIVE X-SYNDROME, NUCLEOTIDIC PROBE AND METHOD FOR THE DIAGNOSIS OF MENTAL RESIDUAL WITH SENSITIVE X
AU14136/92A AU671418B2 (en) 1991-02-13 1992-02-13 Nucleic acid fragment of the X chromosome region involved inthe fragile X syndrome, nucleotide probe and method of diagnosing mental retardation with fragile X
CA002104110A CA2104110C (en) 1991-02-13 1992-02-13 Nucleic acid fragment from the chromosome x region involved in the fragile x syndrome, nucleotide probe and method for the diagnosis of mental retardation with fragile x
JP4506537A JPH06507310A (en) 1991-02-13 1992-02-13 Nucleic acid fragment of the X chromosome region involved in fragile X syndrome, diagnostic method for mental retardation associated with fragile X syndrome, and nucleotide probe
EP92907135A EP0580621B1 (en) 1991-02-13 1992-02-13 Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR91/01684 1991-02-13
FR9101684A FR2672618B1 (en) 1991-02-13 1991-02-13 NUCLEIC ACID FRAGMENT OF THE X CHROMOSOME REGION INVOLVED IN FRAGILE X SYNDROME, NUCLEOTIDE PROBE AND METHOD FOR DIAGNOSING MENTAL DELAY WITH X FRAGILE.
US81593291A 1991-12-30 1991-12-30

Publications (1)

Publication Number Publication Date
WO1992014840A1 true WO1992014840A1 (en) 1992-09-03

Family

ID=26228510

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1992/000145 WO1992014840A1 (en) 1991-02-13 1992-02-13 Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x

Country Status (1)

Country Link
WO (1) WO1992014840A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5741645A (en) * 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5834183A (en) * 1993-06-29 1998-11-10 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5876949A (en) * 1995-05-31 1999-03-02 The Trustees Of The University Of Pennsylvania Antibodies specific for fragile X related proteins and method of using the same
US6197500B1 (en) 1991-01-04 2001-03-06 Adelaide Medical Centre For Women And Children DNA sequences related to fragile X syndrome
US8409805B2 (en) 2009-02-13 2013-04-02 Asuragen, Inc. Method of amplification of GC-rich DNA templates
US8679757B2 (en) 2009-03-24 2014-03-25 Asuragen, Inc. PCR methods for characterizing the 5′ untranslated region of the FMR1 and FMR2 genes
US9371560B2 (en) 2012-07-20 2016-06-21 Asuragen, Inc. Comprehensive FMR1 genotyping
CN110923305A (en) * 2019-11-25 2020-03-27 广州市达瑞生物技术股份有限公司 DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection
US11497816B2 (en) * 2015-10-06 2022-11-15 The Children's Hospital Of Philadelphia Compositions and methods for treating fragile X syndrome and related syndromes

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986005512A1 (en) * 1985-03-13 1986-09-25 Centre National De La Recherche Scientifique (Cnrs Dna probe intended to the anti-natal diagnosis of certain chromosomal anomalies
WO1990005194A1 (en) * 1988-11-01 1990-05-17 Medical Research Council Probe for detection of the fragile x syndrome
WO1991009140A1 (en) * 1989-12-12 1991-06-27 Medical Research Council Probe for detection of the fragile x syndrome

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986005512A1 (en) * 1985-03-13 1986-09-25 Centre National De La Recherche Scientifique (Cnrs Dna probe intended to the anti-natal diagnosis of certain chromosomal anomalies
WO1990005194A1 (en) * 1988-11-01 1990-05-17 Medical Research Council Probe for detection of the fragile x syndrome
WO1991009140A1 (en) * 1989-12-12 1991-06-27 Medical Research Council Probe for detection of the fragile x syndrome

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CELL, vol. 64, no. 4, 22 février 1991, pages 861-866, Cambridge, MA, US, M.V. BELL et al.: "Physical Mapping across the Fragile X: Hypermethylation and Clinical Expression of the Fragile X Syndrome", document en entier *
GENOMICS, vol. 10, no. 1, 1991, pages 243-249, US, M.C. HIRST et al.: "Linear Order of New and Established DNA Markers around the Fragile Site at Xq27.3", document en entier, particulièrement figures 2,3 *
GENOMICS, vol. 9, no. 1, 1991, pages 37-43, US, G.K. SUTHERS et al.: "Genetic Mapping of New RFLP's at Xq27-q28", document en entier *
PROC. NATL. ACAD. SCI. USA, vol. 87, no. 10, mai 1990, pages 3856-3860, Washington, DC, US, S.T. WARREN et al.: "Isolation of the human chromosomal band Xq28 within somatic cell hybrids by fragile X site breakage", document en entier *
SCIENCE, vol. 251, no. 4998, 8 mars 1991, pages 1236-1239, Washington, DC, US, D. HEITZ et al.: "Isolation of Sequences That Span the Fragile X and Identification of a Fragile X-Related CpG Island", document en entier *
THE AMERICAN JOURNAL OF HUMAN GENETICS, vol. 47, no. 2, août 1990, pages 187-195, US, G. SUTHERS et al.: "Physical Mapping of New DNA Probes near the Fragile X Mutation (FRAXA) by Using a Panel of Cell Lines", document en entier *
THE AMERICAN JOURNAL OF HUMAN GENETICS, vol. 48, no. 1, janvier 1991, pages 108-116, US, F. ROUSSEAU et al.: "Four Chromosomal Breakpoints and Four New Probes Mark Out a 10-cM Region Encompassing the Fragile-X Locus (FRAXA), document en entier (document cité dans la description) *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6197500B1 (en) 1991-01-04 2001-03-06 Adelaide Medical Centre For Women And Children DNA sequences related to fragile X syndrome
US6242576B1 (en) 1991-01-04 2001-06-05 Women's And Children's Hospital Monoclonal and polyclonal antibodies relating to fragile X syndrome
US5741645A (en) * 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5834183A (en) * 1993-06-29 1998-11-10 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5876949A (en) * 1995-05-31 1999-03-02 The Trustees Of The University Of Pennsylvania Antibodies specific for fragile X related proteins and method of using the same
US8409805B2 (en) 2009-02-13 2013-04-02 Asuragen, Inc. Method of amplification of GC-rich DNA templates
US8679757B2 (en) 2009-03-24 2014-03-25 Asuragen, Inc. PCR methods for characterizing the 5′ untranslated region of the FMR1 and FMR2 genes
US9783848B2 (en) 2009-03-24 2017-10-10 Asuragen, Inc. PCR methods for characterizing the 5′ untranslated region of the FMR1 and FMR2 genes
US9371560B2 (en) 2012-07-20 2016-06-21 Asuragen, Inc. Comprehensive FMR1 genotyping
US11497816B2 (en) * 2015-10-06 2022-11-15 The Children's Hospital Of Philadelphia Compositions and methods for treating fragile X syndrome and related syndromes
CN110923305A (en) * 2019-11-25 2020-03-27 广州市达瑞生物技术股份有限公司 DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection
CN110923305B (en) * 2019-11-25 2023-12-29 广州市达瑞生物技术股份有限公司 DNA molecular weight standard suitable for southern blot hybridization detection of fragile X syndrome

Similar Documents

Publication Publication Date Title
EP0412883B1 (en) Fast method for detection and/or identification of a single base in a nucleic acid sequence and its applications
US5650277A (en) Method of determining the presence and quantifying the number of di- and trinucleotide repeats
Sherlock et al. Assessment of diagnostic quantitative fluorescent multiplex polymerase chain reaction assays performed on single cells
JP3206812B2 (en) A method for intron sequence analysis to detect alleles at adjacent and distant loci as halotypes
US5658764A (en) Method and kits for detection of fragile X specific, GC-rich DNA sequences
JPH10509594A (en) Composite microsatellite primers for detection of genetic polymorphism
JP2010081944A (en) Multiplex amplification of short tandem repeat loci
JPH11511010A (en) Cloning and expression of thermostable mutS gene and proteins and uses thereof
EP0566685B1 (en) METHOD OF DESCRIBING REPERTOIRES OF ANTIBODIES (Ab) AND T CELL RECEPTORS (TcR) OF THE IMMUNE SYSTEM OF AN INDIVIDUAL
WO1991015600A1 (en) Detection of minimal residual disease in lymphoid malignancies
WO1992014840A1 (en) Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x
JPH08507198A (en) Single nucleotide primer extension method for the detection of specific alleles and a kit therefor
Tan et al. The amplification refractory mutation system (ARMS): A rapid and direct prenatal diagnostic technique for β‐thalassaemia in Singapore
AU647806B2 (en) Genomic mapping method by direct haplotyping using intron sequence analysis
EP0580621B1 (en) Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x
FR2680520A1 (en) Process for the detection of new hypervariable regions in a DNA sequence, nucleotide sequences constituting hybridisation probes and their biological application
FR2733251A1 (en) DETECTION OF JUVENILE GLAUCOMA
EP0591332B1 (en) Methods and means for studying genetic polymorphism in the angiotensin converting enzyme
ES2445709T3 (en) Method for the identification by molecular techniques of genetic variants that do not encode D (D-) antigen and encode altered C (C + W) antigen
JPH11507222A (en) Detection of male infertility Y chromosome deletion by multiplex primer binding
KR20150005974A (en) Method and kit for detecting hla-a*24:02
Kawaguchi Angiotensin-converting enzyme and angiotensinogen gene polymorphism in hypertrophic cardiomyopathy
EP1741791A9 (en) Method and kit for the genotypification of hla-b27 based on real time pcr
Carroll et al. Biased T-cell receptor δ element recombination in scid thymocytes
Geifman‐Holtzman et al. Detection of fetal HLA‐DQα sequences in maternal blood: A gender‐independent technique of fetal cell identification

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR CA CS FI HU JP KP KR LK MG MN MW NO PL RO RU SD US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BF BJ CF CG CH CI CM DE DK ES FR GA GB GN GR IT LU MC ML MR NL SE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1992907135

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2104110

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 1992907135

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 1994 107677

Country of ref document: US

Date of ref document: 19940803

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 1997 777993

Country of ref document: US

Date of ref document: 19970102

Kind code of ref document: A

WWG Wipo information: grant in national office

Ref document number: 1992907135

Country of ref document: EP