WO1992014840A1

WO1992014840A1 - Nucleic acid fragment of the x chromosome region involved in the fragile x syndrome, nucleotide probe and method of diagnosing mental retardation with fragile x

Info

Publication number: WO1992014840A1
Application number: PCT/FR1992/000145
Authority: WO
Inventors: Jean-Louis Mandel; François Rousseau; Anne Vincent; Dominique Heitz; Isabelle +Di Oberle
Original assignee: Institut National De La Sante Et De La Recherche Medicale; HEIDET, Stéphane +hm
Priority date: 1991-02-13
Filing date: 1992-02-13
Publication date: 1992-09-03

Abstract

Nucleic acid fragment containing mutations associated with the fragile X syndrome, or other DNA anomalies resulting from these mutations such as methylations of CpG sites. Nucleotide probe for detecting these mutations and DNA anomalies associated with mental retardation with fragile X and method for diagnosing mental retardation with fragile X.

Description

NUCLEIC ACID FRAGMENT OF THE X CHROMOSOME REGION INVOLVED IN FRAGILE X SYNDROME, NUCLEOTIDE PROBE AND METHOD FOR DIAGNOSING MENTAL DELAY WITH X FRAGILE

Mental retardation syndrome with fragile X is an X chromosome-related disease that affects approximately one in every 1,500 boys. Women vectors, about one in seven hundred and fifty, have a 30% risk of having mild or even moderate debility. Mental retardation syndrome with fragile X is the most common cause of inherited mental retardation.

The diagnosis of the disease is established by a delicate cytogenetic analysis which requires particular culture conditions and the analysis of 50 to 100 mitoses, because the fragile site detectable cytogenetically is only present in 5 to 50% of mitoses. The diagnosis of vector women is even more difficult since only 50 to 60% of these women express the fragile site, in a generally low proportion of mitoses.

The difficulty of the cytogenetic test means that it is not reliably performed except in a limited number of laboratories; moreover, the diagnosis of the disease is often only made after the birth of a second affected child in the same family; however, the early establishment of such a diagnosis is essential for implementing investigations allowing prenatal diagnosis and screening of vector women who transmit the disease to 50% of their male children, in families at risk. The high frequency of the disease and the early genetic importance justify systematic neonatal screening for the disease. The present invention specifically aims to provide new means of investigation and diagnosis, based on the direct study of DNA, allowing rapid diagnosis of the disease and applicable to a large number of patients.

Mental retardation syndrome with fragile X is characterized by the presence of a fragile site in the Xq27.3 region, induced in vitro by deprivation of folic acid or by inhibitors of deoxynucleotide synthesis. Genetic mapping of the Xq27-q28 region has confirmed that the disease locus is located at or near the fragile site (Oberle et al, Proc. Natl. Acad. Sci. (1986); Suthers et al. Science (1989); Rousseau et al. J. Hum. Genêt. (1991)).

It also appears that hereditary transmission of the disease is unusual compared to other diseases linked to the X chromosome. It has been found that phenotypically normal men transmit the mutation to their daughters, who rarely exhibit the symptoms of the disease, on the other hand. sons and daughters of these women have a high rate of onset of the disease (Sherman et al, Hum. Genêt. (1985)). Several hypotheses have been proposed to explain this phenomenon.

The invention also provides means for the detection, in non-sick persons, of anomalies and in particular of mutations at the level of the fragile X site.

These non-sick people are said to be carriers or vectors.

The genetic markers proposed in the prior art can only be used to monitor the transmission of the mutation in families where the disease has already been diagnosed by a cytogenetic study, it this is an indirect diagnosis by link study; it is generally necessary to use several markers on either side of the disease locus, and these markers are only informative in varying proportions of families.

International patent application O90 / 05194 describes a new locus entitled 1A1 distant from the fragile X site but whose restriction polymorphism provides a genotypic marker. The probes capable of detecting the locus 1A1 allow the diagnosis of several diseases linked to the X chromosome and in particular fragile X syndrome, by selective hybridization at the level of the Xq27 region. - DXS52 of said X chromosome.

Other probes close to the fragile X locus have also been described, in particular by the inventors. Thus F. Rousseau et al (Am. J. Hum. Genêt. (1991) 48: 108-116) report the detection of seven regions close to the fragile X locus (FRAXA). Two of these regions between DXS369 and DXS296 contain the genetic markers closest to FRAXA known to date, one of these regions contains two probes detecting a polymorphism. These probes called St677 (DX463) and 2-34 (DXS477) both detect the polymorphic Taql restriction fragments; another probe also detecting a polymorphism, and named Do33 (DXS465: 42% heterozygocity) is located in the same region as DXS296, proximal to the point of cleavage of the chromosome corresponding to the locus of Hunter syndrome (IDS). The use of these probes made it possible to determine the physical arrangement of the preceding regions: Cen-DXS369-DXS476- (DXS463, DXS477) - (DXS296, DXS465) -IDS-DXS304-tel, and their position relative to the fragile X locus . Analysis by pulsed field electrophoresis of the fragile X locus with the previous probes and more particularly with the Do33 probe (DXS465) led the inventors to note that patients with fragile X and mental retardation are distinguished from normal subjects or from carriers of the fragile X mutation but without clinical expression of the disease, by a total or partial inhibition of the digestion of restriction sites close to the Do33 probe, and in particular of sites for the enzymes BssHII, SacII, Eagl.

The inventors cloned as an artificial yeast chromosome (YAC), the approximately 225 kb DNA segment defined between probes St677 and Do33, and located in the Xq27-q28 region of the human X chromosome. Probes from this segment have been prepared for the analysis of mutations, DNA methylations and genes involved in fragile X syndrome.

These probes have in particular enabled the study, from DNA of leukocytes, of the digestibility of the restriction sites BssHII, Eaql, SacII and in general of the restriction sites whose digestion by the corresponding enzyme is inhibited when the site contains a methylated cytosine r these sites are called CpG sites, these are for example sites containing the CpG dinucleotide, such as Hpall, CCGG or Hhal, GCGC, or sites capable of partially covering a CpG dinucleotide such as Avall GG (A or T) CC, in a CGG (A or T) CC or GG (A or T) CGG or even BanI (GG Py Pu CC) sequence; the inventors have demonstrated a surprising correlation between the clinical expression of the disease and the inhibition of the digestibility of CpG sites in the region of approximately 20 kb around the 125 kb position defined on the cloned DNA segment through the inventors, approximately 100 kb from the Do33 probe in the direction of the centromere.

These probes are also suitable for the detection of the fragile X locus, without clinical manifestation of the disease, which results from the mutation of the nucleic acid of the X chromosome region described above, by extension of the DNA.

The lengthening can indeed be more or less significant depending on whether the subject is only a carrier of the anomaly or whether he has clinical signs of mental retardation associated with the fragile X anomaly. The probes of the invention advantageously allow the detection of premutations corresponding to an elongation of the nucleic acid from approximately 100 bp (base pairs) to approximately 500 bp and the detection of complete mutations corresponding to an elongation of the nucleic acid at least around 500bp, up to over 3000bp. Premutations generally correspond to a subject carrying the anomaly without clinical manifestation, whereas mutations by extension greater than 500 bp are normally associated with the presence of clinical signs.

In the following, the term mutation will be used to designate the two situations mentioned above and the distinction between mutations associated or not with clinical signs will be made if necessary.

Probes of interest in the search for a mutation in the fragile X region without clinical expression of mental retardation are, for example the so-called probes adjacent to the CpG site.

Figure 1 is a schematic representation of the X chromosome region around the 125 kb position located about 100 kb from the Do33 probe in direction of the centromere. On the scale, the location of the probes St677, 2-34, and Do33 is shown. In accordance with the scale, the clones YAC 141 H5 and 209G4 corresponding to the above-mentioned DNA segments have been shown, and the location of restriction sites Eaql, BssII etc., has been represented on the line of clone 141 H5. The indication CpG on the line of clone 141 H5 corresponds to the region whose methylation is abnormal in patients with mental retardation with fragile X.

This phenomenon of inhibition of digestibility of CpG sites can be detected by the Southern Blot method, using probes originating from the 20 kb region around the 125 kb position defined in FIG. 1, probes close to or containing the sites to CpG.

The inventors have also demonstrated, by the same method, anomalies in the migration of DNA fragments, not necessarily linked to the phenomenon of methylation, anomalies which are characteristic of subjects carrying a fragile X mutation.

These anomalies were detected in particular in the DNA digested by the EcoRI or HindIII enzymes after hybridization with a probe specific for the above region.

It appears that the germinal mutations responsible for fragile X syndrome and capable of being transmitted to the offspring are located in the region of the X chromosome defined between the probes St677 and Do33, and the methylation of the CpG sites in this region is a consequence not obligatory of these mutations, consequence which is linked to the clinical expression of the disease.

The anomalies in migration of nucleic acid fragments, correlated to a fragile X site, in carrier subjects (vectors) without necessarily associated clinical expression, result in particular from an elongation of the genomic DNA fragment around the fragile X site. This lengthening can for example be the consequence of the insertion of an additional sequence. This elongation can in certain cases result from the amplification (repetition) of a short sequence contained in the vicinity of the fragile X site, for example at the level of the fragment 9B12.5 near the Eaql site, represented in FIG. 2.

The invention therefore relates to any nucleic acid fragment originating from the Xq27-q28 region of the X chromosome, adjacent to or containing the CpG sites, located in the region of 10 to 20 kb around the position 125 kb.

In general, the invention relates to any nucleic acid fragment included in the DNA segment of approximately 225 kb, defined between the probes St677 and Do33. Preferably such nucleic acid fragments comprise at least 15 bp or nucleotides.

The nucleic acid sequences of the invention are DNA, cDNA or even mRNA sequences.

The nucleic acid sequences of the invention are individualized sequences and therefore they are not in their natural environment.

The cDNA corresponding to the nucleic acid sequences of the invention can be obtained according to conventional techniques by screening a library of available human cDNA, with a nucleic acid fragment of the invention, the screening making it possible to detect cDNA fragments which selectively hybridize with the nucleic acid fragment of the invention. This region of the X chromosome is involved in fragile X syndrome and the probes specific for this region are advantageously used to detect the presence of methylation abnormalities related to the clinical expression of the disease, or to detect the presence of mutations responsible for the fragile X syndrome and its transmission, or to locate, identify and analyze the expression of the gene (s) involved in fragile X syndrome. These probes can generally be used to detect DNA abnormalities that are the direct or indirect consequence of mutations associated with fragile X syndrome.

The invention therefore relates to any nucleotide probe capable of hybridizing selectively with a nucleic acid fragment included in the DNA segment defined between the St677 and Do33 probes and more particularly with a nucleic acid fragment adjacent to or containing the sites at CpG in the region of about 20 kb around the 125 kb position.

The probes of the invention specifically hybridize under appropriate stringency conditions with the abovementioned nucleic acid fragments but do not hybridize with other regions of the human genome under the same hybridization conditions.

Such hybridization involves the following steps:

- the pre-hybridization treatment of a support, such as a nitrocellulose filter or a nylon membrane, on which is fixed the DNA to be tested capable of hybridizing with the above-mentioned probes, at a temperature of 42 ^* C and for 2 hours with a pre-hybridization solution having the following composition: 40% formamide, * 0.9 M NaCl; 200 μg / ml of salmon sperm DNA; 50 mM sodium phosphate pH 6.5; 4% dextran sulfate; 0.08% (weight / volume) of ficoll and of polyvinyl pyrrolidone, hybridization in a solution identical to the pre-hybridization solution, further comprising at least one nucleotide probe according to the invention advantageously labeled, at a temperature at 42 ° C and for 18 hours, 4 successive washes, revealing the hybrid possibly formed by any method suitable for labeling the probe. The hybridization conditions defined above constitute preferred conditions, but are in no way limiting and can be modified without affecting the pairing properties of the probes of the invention and the nucleotide sequences mentioned above.

The probes of the invention are advantageously marked with any marker conventionally used. They can be marked using a radioactive tracer such as ³² P, ³⁵ S, ¹²⁵ I ^,, ¹⁴ C and the radioactive marking can be carried out according to any method known to those skilled in the art.

The probes can be labeled in 3 ′ by addition of one or more deoxynucleotides or ribonucleotides or of a dideoxynucleotide, marked in alpha by ³² P, in the presence of the Terminal Deoxynucleotidyl Transferase, or in 5 ′ by transfer of a group radioactive phosphate of a deoxynucleotide or free dideoxynucleotide labeled in the gamma position, in the presence of T4 DNA ligase. Probes can still be labeled using DNA polymerase by "Nick Translation "or" Random Priming "or" Polymerase Chain Reaction ".

The method of detection of hybridization will depend on the radioactive marker used and may be based on autoradiography, liquid scintillation, gamma counting or any other technique making it possible to detect the emission of the radiation emitted by the radioactive marker. non-radioactive labeling can also be used, by combining with the probes groups having immunological properties such as an antigen, a specific affinity for certain reagents such as a ligand, physical properties such as fluorescence or luminescence, properties allowing the completion of the reactions enzymes like an enzyme or an enzyme substrate. Non-radioactive labeling can also be done directly by chemical modification of DNA, such as photobiotinylation or sulfonation.

The probes of the invention are used for the in vitro detection, mutations responsible for fragile X syndrome, as well as anomalies in methylation of CpG sites or other DNA anomalies resulting from the presence of these mutations and associated to the syndrome.

The mutation detection aims to follow the family transmission and allows in particular a diagnosis of the non affected people likely to transmit the disease, such as women vectors or normal men transmitters of the mutation.

The detection of methylation abnormalities allows a diagnosis of the disease, expressed clinically or likely to be expressed in the context of an antenatal or birth diagnosis. In general, the methods for detecting mutations responsible for fragile X syndrome, as well as abnormal methylation of CpG sites, or other DNA abnormalities associated with the syndrome, rely on the use of at least one probe according to the invention and at least one suitable restriction enzyme so that the fragment detected by the probe is different depending on whether or not it contains the methylation mutation or anomaly or any other anomaly DNA.

Such a process can be carried out according to the so-called "Southern Blot" method (Sa brook, Fritsh and Maniatis; Molecular cloning: A laboratory manual (1989), Cold Spring Harbor Laboratory Press), comprising the following steps: treatment of genomic DNA extracted for example from leukocytes or chorionic villi or from any other source of genomic DNA, by at least one specific restriction enzyme, under conditions allowing the obtaining of restriction fragments resulting from the cleavage of DNA at its level restriction sites recognized by said enzyme; separation of the fragments by electrophoresis; bringing into contact a nucleic probe according to the invention capable of hybridizing specifically with the preceding fragments under conditions allowing the formation of hybridization complexes; detection of hybridization complexes; measurement of the size of the restriction fragments engaged in the hybridization complexes. The search for methylation anomalies for the in vitro diagnosis of fragile X syndrome in patients patients suffering from mental retardation is advantageously carried out according to the preceding method using at least one restriction enzyme with a site sensitive to methylation, with at least one probe according to the invention advantageously labeled.

The above-mentioned method can be carried out with a single methylation-sensitive restriction site enzyme such as BssHII, Eaql, Avall, BanI; or again with two enzymes, one with a restriction site sensitive to methylation and the other with a restriction site not sensitive to methylation. The probes of the invention used for hybridization with the fragments obtained are advantageously adjacent to or contain the site for the enzyme with a site sensitive to methylation.

The Southern Blot method is also used to detect mutations associated with fragile X syndrome, or mutations existing in vector vectors, without clinical signs. These mutations are, for example, DNA sequence deletions or insertions, or other DNA abnormalities such as conformational or replicative abnormalities, which are consequential to these mutations.

The detection of these mutations for the in vitro diagnosis of fragile X syndrome or more generally of the mutation of the fragile X site, in patients with or without mental retardation is carried out according to the Southern Blot method by subjecting the genomic DNA to a digestion with any suitable restriction enzyme not necessarily sensitive to methylation such as EcoRI or HindIII. The restriction fragments are demonstrated by hybridization with a probe of the invention advantageously labeled and the abnormal electrophoretic migration of said fragments is correlated either with the clinical expression of the disease, or with the presence of the mutation even in the very absence of clinical expression of the disease.

This abnormal migration of the fragments corresponds to the presence of fragments elongated by the insertional mutation of a nucleotide sequence.

The invention also relates to the kits for implementing the above method.

Among the nucleic acid fragments of the invention, those of 20 to 30 nucleotides can be advantageously used as primers in a method of genetic amplification of a nucleic acid fragment of the 20 kb region around the position 125. The amplification may be intended to reveal the presence of mutations in this region, in particular by lengthening of the DNA, or / and determined for the detection of a fragment containing the CpG sites. This amplification method consists in specifically fixing by hybridization on the genomic DNA extracted for example from leukocytes, two oligonucleotides judiciously chosen from those containing the nucleic acid fragments of 20 to 30 nucleotides of the invention which are adjacent to the fragment to amplify, then implement an enzymatic extension process using DNA polymerase, followed by a denaturation process, and repeat the hybridization-extension-denaturation cycle known as the PCR "Polymerase cycle Chain Reaction ", a sufficient number of times to increase the quantity of the fragment to be amplified in an exponential proportion compared to the number of cycles carried out.

The amplification method described can be applied to the detection of DNA abnormalities which are the consequence of the presence of the above mutations. The in vitro diagnosis of fragile X syndrome, in particular in patients with mental retardation, or in vector vectors, is advantageously carried out by genetic amplification carried out in parallel on the DNA digested with at least one restriction enzyme chosen from the enzymes not sensitive to methylation or on the contrary sensitive to methylation, and on undigested DNA. Analysis for diagnostic purposes is done by comparing the amplification product of undigested DNA to that of DNA digested with the chosen restriction enzyme (s). This analysis of the amplification products can be carried out by visualization of the fluorescence induced by ethidium bromide, after electrophoresis on agarose or polyacrylamide gel, or by the detection of radioactive or non-radioactive labeling, such as by a system. biotin-avidin, priming oligonucleotides or nucleotides incorporated into the amplified fragment. The number of amplification cycles is limited so as to maintain a linearity of the amplification and therefore a quantitative estimate of the digestibility of the sites of the enzyme or enzymes used. Advantageously, internal markers are used, in particular other fragments of the co-amplified genome also containing a site of the chosen enzyme, as a witness for the action of the restriction enzyme, and as a witness for the efficiency of amplification, a fragment not containing such a site.

The quantitative measurement of the characteristic fragments of the mutations, in particular resulting from the elongation, as well as the quantitative measurement of the methylation of the genomic DNA at the site studied can be done by adapting the method. amplification described above, in particular by using in addition to the oligonucleotides according to the invention, so-called "linker" oligonucleotides and DNA Ligase, a method called "Ligation mediated PCR" described by Steigerwald et al (Nucleic ACids Res. (1980 ) 18: 1435-1439).

Deletions or any other rearrangement constituting mutations liable to give rise to fragile X syndrome, in particular by lengthening of nucleic acid, can also be detected by the so-called multiplex DNA amplification method, using pairs of oligonucleotides which can be mixed in a single reaction to amplify several fragments of the region around the 125 kb position and to detect the disappearance or modification of some of these fragments. The detection of point mutations is advantageously carried out by amplification of the DNA segments, followed by an analysis by SSCP (single strand conformation polymorphism) or DGGE (denaturing gradient gel electrophoresis) methods, or even by detection of heteroduplex.

The invention also relates to the kits for implementing the above method. Such kits include: oligonucleotides labeled or not labeled for the amplification of nucleic acid fragments exhibiting an anomaly resulting from a mutation, in particular by lengthening of the DNA and / or of nucleic acid fragments containing a site sensitive to methylation according to the invention; oligonucleotides labeled or not for the amplification of the control nucleic acid segments; so-called "linker"oligonucleotides; - buffers, nucleotides and enzymes suitable for amplification.

A group of probes which are particularly advantageous for carrying out the invention includes probes, the detailed description of which is given in the experimental part. These probes include the fragments 9B12.3 (now designated StB12.3), 9B12.5 (StB12.5), 9B12.4, 9B12.2 and 9B12.1 located in relation to the DNA located between the probes Do33 and St677 , represented in FIG. 2. Other probes are the stA22 (Avall-Avall) fragments of approximately 1500bp, stX21 of approximately 3800bp and stX21E (centromeric of the Eaql site).

Advantageously, the 9B12.3 probe can be used to detect anomalies at the fragile X site of nucleic acid fragments, and more particularly mutations by lengthening of the DNA, after a step of digestion with the enzyme of EcoRI restriction.

Similar results are obtained using the restriction enzyme HindIII.

A diagram of the results obtained on restriction fragments resulting from digestion with EcoRI, detected by the probe 9B12.3, showing a normal or mutated fragment is given in FIG. 7.

The nucleotide sequence of probes 9B12.3 (stB12.3) and 9B12.5 (stB12.5) is shown in Figure 8, with its complementary sequence.

In addition, by using the probes described above, for the revelation of the DNA fragments which have been previously subjected to a double digestion by an enzyme sensitive to methylation (for example Eaql) and by an enzyme insensitive to methylation ( for example EcoRI) we can reveal the presence of the mutation at the fragile X site and the state of methylation.

The probes of the invention also allow access to the region in which the gene or genes involved in the clinical expression of fragile X syndrome are located. Indeed, the identification of CpG sites such as BssHII, EagI, SacII in the region close to the 125 kb position, indicates the presence of adjacent genes, the expression of which is controlled by this region (CpG islet). The probes corresponding to these genes are useful for the detection of the corresponding messenger RNAs, or for the construction of vectors for expression of the corresponding proteins for therapeutic application or for the production of specific antibodies which may also be used in diagnosis .

Those skilled in the art have the means to identify or even select those of the nucleic acid fragments corresponding to the genes present in the region between the probes St677 and Do33 on either side of the 125 kb position, which genes are likely to be inactivated directly by mutation or indirectly due to the methylation of CpG sites present around the 125 kb position.

In this regard, a fragment according to the invention is characterized in that it selectively hybridizes with an mRNA present in human cells, for example leukocytes and in that it corresponds to a gene whose 5 'end is contained or adjacent to the CpG island in position 125 kb on the genetic map shown in Figure 2A.

Another particular fragment of the invention is characterized in that it is included in the DNA defined between the Do33 probe and the 125 kb position at approximately 100 kb of the Do33 probe of the Xq27-q28 region of the X chromosome, and that it selectively hybridizes with an mRNA present in human cells, for example leukocytes.

As such, the invention relates to any recombinant DNA containing a nucleic acid fragment of the invention associated with any sequence allowing transcription and / or translation in the host cell into which said recombinant DNA is capable of being introduced. The invention therefore also relates to the cloning and expression vectors containing one of the nucleic acid fragments of the invention.

The introduction of the recombinant DNA is advantageously carried out using a vector, in particular of the plasmid type, able to replicate in the host cell and to allow the transcription of the corresponding RNA and the expression of the proteins. encoded by the nucleic acid fragment contained in the recombinant DNA.

The host cells mentioned above can be prokaryotic cells, in particular E. coli cells, or, more advantageously, eukaryotic cells, which make it possible to obtain glycosylated and mature proteins (yeasts, CHO cells, or insect cells infected with bacculovirus). These proteins can advantageously be used for the preparation of specific antibodies useful for the diagnosis of fragile X syndrome and in therapeutic applications.

In addition to the foregoing features, the invention includes other features which will appear during the following description and which refer to examples of implementation of the present invention and which are illustrated in the figure, it being understood that these examples should not constitute any limitation to the scope of the invention.

I - Preparation of probes 8t677 and Do33

DNA segments corresponding to probes St677 and Do33 can be obtained from human DNA by genetic amplification using the following oligonucleotides:

- for ST 677

5 • ACTCCTTCACAAATCTTCCG3 'and

5'ATCATGCAAGACAGTTCTCTGC3 ^»

- for Dθ33

5 ^“ GTG.AAGCAATTTGAGTTGGTGGGAG3 • and

5'CCCAAGTTTAGCTTCCGTAGAAGCC3 '

The amplification conditions in a standard medium are as follows:

- hybridization: 1 minute at 60 ° C,

- elongation: 8 minutes at 72 ° C,

- denaturation: 1 minute at 94 * C.

II - Preparation of the probes of the invention

The probes of the invention were obtained by subcloning the nucleic acid fragments of the invention originating from the digestion of DNA segments contained in the region of approximately 225 kb defined between the probes St677 and Do33, and located in the Xq27-q28 region of the human X chromosome, cloned as an artificial yeast chromosome (YAC) and represented in FIG. 1.

In particular, subcloning aims to obtain specific probes for fragments located in the region of 20 kb around the position 125 kb and corresponding therefore specifically to the nucleic acid fragments adjacent to or comprising the CpG sites. By way of example, such a probe is obtained by subcloning of fragments prepared by double digestion Eaql, B ll of the clone 141H5. The probe obtained 9B12 corresponds to an Eagl-Bgll fragment of approximately 7 kb containing the Eaql site at the position 125 kb on the map of FIG. 1.

FIG. 2 is a diagrammatic representation of the map of the probe 9B12 and of its subfragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 and 9B12.5, oriented inversely to FIG. 1. This figure has the following 7 lines:

- the line (1) is a scale in kb on which is mentioned in 0 the position 125 kb defined on the map of the clone segment of FIG. 1 between the probes St677 and Do33 at approximately 100 to 125 kb from the probe Do33. line (2) is a representation in agreement with the scale of the probe 9B12 and its subfragments 9B12.1, 9B12.2, 9B12.3, 9B12.4 and 9B12.5.

line (3) represents the location, in agreement with the scale, of the BanI sites (GGPyPuCC) and in particular the polymorphic BanI site noted RFLP and the BanI site sensitive to methylation noted Me.

- line (4) represents the location, in accordance with the scale, of the Xmnl sites (GAANNNNTTC).

- line (5) represents the location, in accordance with the scale of line (1), of the BglII sites (AGATCT).

- line (6) represents the location, in line with the scale of line (1), of the EcoRI sites (GAATCC). - line (7) represents the location, in accordance with the scale of line (1), of the HindIII sites (AAGCT).

The BanI, XmnI and EcoRI site maps correspond to altered fragments in carriers of the fragile X mutation.

III- Diagnosis of the “fragile X” delay by detection of methylation anomalies according to the Southern Blot Method

Genomic DNA extracted from leukocytes from a patient with mental retardation is cut by the enzymes Avall, BanI or XmnI. The DNA fragments obtained are analyzed by electrophoresis on 0.9% agarose gel in TAE buffer, then transferred to a nylon membrane.

The membrane on which the DNA fragments are fixed is subjected to a pre-hybridization treatment at 42 "C for 2 hours with a solution having the following composition: 40% formamide; 0.9 M NaCl; 200 μg / ml d '' Salmon sperm DNA; 50 mM sodium phosphate pH 6.5; 4% dextran sulfate; 0.8% (weight / volume) of ficoll and polyvinyl pyrrolidone; then the pre-hybridization solution is replaced by a hybridization solution identical to the pre-hybridization solution, and further comprising the probe 9B12.3 labeled with dCTP alpha ^ P and of specific activity 2 10 ^B dpm / μg; after incubation for 18 hours at 42 "C and successive washings with a 0.5 SSC solution at 65 ° C., autoradiography is carried out at -80 ° C.

All or part of the Avall, BanI or XmnI fragments detected in normal subjects is replaced in subjects expressing fragile X syndrome by larger fragments. In particular with the enzyme XmnI, the appearance of several bands fairly close to each other is very characteristic of subjects with a phenotypic expression of the syndrome.

This distinction between anomalies linked to clinical and / or cytogenetic expression and anomalies present in people carrying a fragile X mutation without clinical and / or cytogenetic expression is explained in the following examples of detection of said anomalies by the Southern Blot method.

Abnormalities related to clinical and / or cytogenetic expression

a - Digestion by the enzyme BanI (GG Py Pu CC site)

FIG. 3 is a schematic representation of a autoradiography image on 0.9% agarose gel, of DNA of leukocytes or chorionic villi of normal men (1 and 5), of a man with X fragile (3), of a vector woman (4) and of a normal woman, digested by BanI and revealed by the probe 9B12.3.

FIG. 4 is a schematic representation of a autoradiography image on 0.9% agarose gel, of chorionic villus DNA from a normal man (2), from a man with fragile X (3) , of a fetus with fragile X, digested with BanI and revealed by the probe 9B12.3.

The 9B12.3 probe detects in the genomic DNA of a normal man, after digestion with the enzyme BanI, either a single fragment of 2.9 kb (allele 1) or two fragments of 2.3 and 0.6 kb (allele 2). The existence of two alleles is due to the presence of a polymorphic BanI site indicated RFLP in FIG. 2. In a male patient suffering from mental retardation with fragile X carrying allele 1, the 2.9 kb fragment is replaced more or less completely by a 3.5 kb fragment. In a patient carrying allele 2, the 0.6 kb fragment is replaced more or less completely by a 1.2 kb fragment. These specific differences, in the male, of mental retardation with fragile X are due to the methylation of a BanI site, indicated Me in FIG. 2. This site is included in the following sequence: TCGGTGCCGA, compatible with inhibition by methylation of cytosine.

The anomaly was detected not only on DNA from leukocytes, but also on DNA from chorionic villi of fetuses carrying a fragile X mutation. It can therefore be used in postnatal or antenatal diagnosis in males.

On the other hand, fragments of 3.5 kb and 1.2 kb can be detected in normal women (methylation of the BanI site on the inactive X chromosome). However, their intensity appears stronger in women vectors with a clinical or cytogenetic expression of fragile X syndrome.

b - Digestion with the other enzyme XmnI (GAANNNNTTC site)

FIG. 5 is a schematic representation of a autoradiography image on 0.9% agarose gel, of DNA of leukocytes of normal men (1 and 10), of men with mental retardation linked to fragile X (3, 4, 6, 9), vector women (5, 7, 8) and a normal woman (2), digested with XmnI and revealed by the probe 9B12.3 The 9B12.3 probe detects a 9 kb fragment in men and women as well as in carriers of a fragile X mutation not expressing the disease clinically or cytogenetically. In men with mental retardation with fragile X, the 9 kb fragment is replaced in whole or in part by fragments of apparent size greater than 10 kb. The appearance of such fragments is also characteristic of female vectors with clinical and / or cytogenetic expression.

IV- Diagnosis of anomalies present in people carrying a fragile X mutation without clinical and / or cytogenetic expression

FIG. 6 is a schematic representation of an autoradiography image on 0.9% agarose gel, of DNA of leukocytes of normal women (9, 12, 13) and of vector vectors (1 to 8, 10 and 11) of the fragile X mutation not all expressing clinical or cytogenetic signs, digested with EcoRI and revealed by the probe 9B12.3

The 9B12.3 probe detects an EcoRI fragment of approximately 6 kb in a normal man or a normal woman. On the other hand, in a woman vector of a fragile X mutation, an additional larger fragment, of variable size according to the individuals (6 to 7 kb) is present. This anomaly appears in vector women without clinical and / or cytogenetic expression, and can therefore be used for the diagnosis of vector women. In affected men, the normal fragment is replaced by a fragment or series of fragments of larger apparent size. Very similar results are obtained with the enzyme HindIII. FIG. 9 is another representation of the detection of mutations at the level of the fragile X region, by digestion of the DNA with EcoRI using the probe stB12.3.

Figure 9: Detection of fragile X mutations in genomic DNA digestion products by EcoRI. The leukocyte DNA was fully digested with EcoRI. The arrows indicate the size of the normal fragment (5.2 kb) and certain mutated fragments. On the left Δ refers to the increase in size of the mutated fragment. The symbols describing the subjects and their relationships within the family are presented above. The squares and circles represent men and women respectively. Open symbols that are not cut in half indicate subjects who are apparently normal and have not been tested cytogenetically. For symbols cut in half, the right part represents the sequence of the fragile X site and the left part the degree of mental retardation. Symbols cut in half, in white, coincide with normal subjects with no fragile X syndrome, hatched symbols correspond to subjects with low mental retardation and fragile X expression in less than 4% of cells and solid symbols correspond to subjects with mental retardation and fragile X expression in more than 4% of cells. The symbols contained in a triangle correspond to samples obtained from a fetus. The dotted symbols show subjects for which EcoRI digestion has been carried out and which do not provide information to clarify the family relationship of the other subjects. The sample on line 22 had a weak cloud at 7.5 kb in the EcoRI digestion product. This cloud is more visible as a band at 3 kb in the BqlII digestion product from the same sample, shown on the right; it is located just above the normal BqlII fragment which is 12 kb in length.

V - Diagnosis of the mental rat with fragile X by genetic amplification of the fragment containing a methylation anomaly

The genomic DNA extracted from leukocytes of a patient suffering from mental retardation, is subjected to a digesiton by an enzyme with a site sensitive to methylation such as Avall, BanI or XmnI and the amplification is carried out in parallel on the genomic DNA digested with the methylation sensitive restriction enzyme, and on undigested DNA.

Two oligonucleotides of 20 to 30 nucleotides adjacent to the genomic DNA fragment to be amplified, containing the site for the enzyme sensitive to methylation, are hybridized with the DNA subjected to digestion and the DNA not subjected to digestion. Then an enzymatic extension process using DNA polyerase, followed by a denaturation process is implemented; the hybridization-extension-denaturation cycle is repeated a number of times sufficient to increase the quantity of the fragment containing the CpG sites in an exponential proportion relative to the number of cycles carried out.

The number of amplification cycles is limited so as to maintain a linearity of the amplification and therefore a quantitative estimate of the digestibility of the site of the enzyme sensitive to methylation. Advantageously, internal markers are used, in particular other fragments of the co-amplified genome containing a site of the methylation-sensitive enzyme, not methylated in humans, or of fragments not containing such a site.

The analysis of the amplification products is carried out by visualization of the fluorescence induced by ethidium bromide, after electrophoresis on agarose or polyacrylamide gel. If the methylation-sensitive site is methylated, the amplified fragment is present in both reactions, if the methylation-sensitive site is unmethylated, the amplified fragment is present only in the reaction with undigested DNA.

VI- Detection of mutations in fragile aite X and ADW methylation scheme digested with EcoRI and Eagl

Families with fragile X syndrome were analyzed by double digestion of DNA with EcoRI and Eaql, a process which revealed both the presence of the mutation and the state of methylation (Eaql is unable to cut DNA if the restriction site rich in CpG is methylated). The results are presented in FIG. 10. For this double digestion, stB12.3a hybridizes with the DNA of all normal people, with a 2.8 kb EcoRI-Eaql fragment, corresponding to the active X chromosome (FIG. 10, lines 2, 4, 5 and 14); in women there was also hybridization with an additional 5.2 kb EcoRI fragment, corresponding to the inactive methylated X chromosome (lines 1, 7, 18 and 27). The 2.8 kb fragment was absent in men with a fragile X mutation, while women with the mutation had both normal fragments (2.8 and 5.2 kb) and the mutated fragments. Premutations were detected as EcoRI-Eaql fragments of 2.9 to approximately 3.3 kb in men (line 3) and were detected on the active X chromosome of women (lines 8, 24, 26 and the like) whereas EcoRI fragments of 5.3 to 5.7 kb corresponded to a premutation on the inactive X chromosome. The fragments corresponding to complete mutations were not digested by Eaql and therefore appear as simple or heterogeneous bands above 5.7 kb (lines 10, 12, 15 and the like). The mosaic cases (additional band corresponding to a premutation and present in variable proportion) appeared as a mixture of complete mutation (methylated) and unmethylated premutation (lines 20 and 21). This is verified for most cases of incomplete methylation already recognized in men with fragile X syndrome. Some people presented a partially homogeneous, partially unmethylated band with an increase in size between 600 to 10000bp. This scheme has been described as "methylation mosaic".

FIG. 10 represents the detection of the fragile X mutations and of the methylation scheme for the DNA digested with EcoRI and Eaql: the DNA of leukocytes was simultaneously digested completely with the enzymes EcoRI and Eaql. The sizes are indicated on the left for some of the mutated fragments and for the normal fragments on the active and inactive X chromosomes (2.8 and 5.2 kb respectively). Δ corresponds to the increase in size of the mutated fragments. Hybridization patterns are identified on the right. The "/" trait denotes a deceased family member. For the other symbols, see Figure 9. The results for lines 6 and 16 are poor. Hybridization of these samples with a control probe showed that these lines contained as much DNA as the others and did not exhibit any migration artifacts.

References to figures

Figure 2A:

/ V \ fuzzy bands (in patients or people susceptible to transmitting the disease) * abnormal sizes

Claims

1. Nucleic acid fragment from the Xq27- q28 region of the X chromosome, characterized in that it is included in the DNA segment of approximately 225 kb defined between the probes St677 and Do33, and in that it contains at least 15bp or nucleotides.

2. Nucleic acid fragment according to claim 1, characterized in that it is adjacent to the CpG sites or in that it contains the CpG sites, (Eaql, BssHII, SacII), located in the region of 20 kb around the 125 kb position defined with respect to the genetic map of Figure 2A.

3. Nucleic acid fragment, characterized in that it selectively hybridizes with a nucleic acid fragment according to any one of claims 1 or 2, and in that it is DNA or RNA .

4. Nucleic acid fragment according to claim 1 or claim 2, characterized in that it selectively hybridizes with an mRNA present in human cells, for example leukocytes and in that it corresponds to a gene whose 5 ′ end is contained or adjacent to the CpG island in position 125 kb on the genetic map represented in FIG. 2A.

5. Nucleic acid fragment, characterized in that it is the cDNA corresponding to the DNA according to claim 4.

6. Nucleotide probe to detect in vitro mutations responsible for fragile X syndrome, or other anomalies resulting from the presence of said mutations or to locate the gene or genes involved in fragile X syndrome, characterized in that it is capable of '' Selectively hybridize with a nucleic acid fragment according to any one of Claims 1 to 5.

7. Nucleotide probe according to claim 5, characterized in that it is chosen from: fragments 9B12 (Eaql-Bqll) of approximately 7000bp, 9B12.3 (Pstl-PstI) of approximately 1200bp (Pstl-PstI) d '' approx 100OOp, 9B12.5 (EaqI-PstI) approx 900bp, 9B12.2 (Pstl-PstI) approx 1800bp, stA22 (Avall-Avall) approx 1500bp, stX21 approx 3800bp and stX21E (centromeric from the Eaql site); - the fragments selectively hybridizing with one of the above fragments.

8. Nucleotide probe according to any one of claims 5 or 6, characterized in that it corresponds to fragment 9B12.3 comprised between nucleotides 1 and 1078 of the sequence represented in FIG. 8, or any part of this fragment selectively hybridizing with a nucleic acid fragment according to any one of claims 1 to 4.

9. nucleotide probe according to any one of claims 5 to 6, characterized in that it corresponds to the fragment 9B12.5 comprised between the nucleotides 1079 and 1985 of the sequence represented in FIG. 8, or any part of this fragment selectively hybridizing with a nucleic acid fragment according to any one of claims 1 to 4.

10. Nucleotide probe according to any one of claims 5 to 8, characterized in that it is radioactively labeled, or by a non-radioactive marker, in particular an enzymatic marker, a ligand, a luminescent or fluorescent marker.

11. Fragment of mRNA, in particular derived from human leukocytes, characterized in that it hybridizes with a probe according to any one of claims 6 to 10.

12. Method for in vitro detection of mutations associated with fragile X syndrome or existing in people without clinical signs or other DNA abnormalities resulting from the presence of these mutations, characterized in that it comprises the following stages: the treatment of a genomic DNA sample with at least one enzyme restriction to a sensitive site such as Eaql or insensitive such as EcoRI or HindIII to methylation; separation of the fragments by electrophoresis and their hybridization with at least one probe according to any one of Claims 5 to 10; the visualization of the hybrids formed and the detection of fragments of length greater than the length of the control fragments obtained by treatment under the same conditions, from a biological sample taken from a normal subject, not carrying a mutation at the fragile X site.

13. A method of detecting DNA anomalies according to claim 12 for the in vitro diagnosis of fragile X syndrome, characterized in that it comprises the following steps: the treatment of genomic DNA with at least one enzyme of methylation sensitive site restriction; separation of the fragments by electrophoresis and their hybridization with at least one probe according to any one of Claims 5 to 10; visualization of the hybrids formed and comparison with the results obtained under the same conditions on control fragments.

14. Method for the in vitro diagnosis of fragile X syndrome or the presence of mutations in carriers without clinical manifestations of mental retardation, according to claim 13, characterized in that the digestion of genomic DNA is carried out by a restriction enzyme with a methylation-sensitive site such as Eaql and a restriction enzyme with a non-methylation-sensitive site such as EcoRI or HindIII.

15. Method for the genetic amplification of a nucleic acid fragment containing mutations or other anomalies, concerning the fragile X site, if necessary consequent on these mutations, characterized in that it consists in fixing by hybridization on the genomic DNA two labeled oligonucleotides flanking said fragment, chosen from the nucleic acid fragments of 20 to 30 nucleotides selectively hybridizing with the nucleic acid fragments according to claim 1 or 2, then to implement a process of enzymatic extension using DNA polymerase, followed by a denaturation process, and repeating the hybridization-extension-denaturation cycle a number of times sufficient to increase the quantity of the fragment in an exponential proportion relative to the number of cycles carried out, under conditions allowing the visualization of the amplified fragments.

16. A method of in vitro diagnosis of fragile X syndrome, characterized in that a genetic amplification method according to claim 15 is carried out in parallel, on the one hand on DNA subjected to digestion with an enzyme to site sensitive to methylation and on the other hand to DNA not subjected to digestion by said enzyme, then in that the fragments obtained visualized with ethidiu bromide or compared by detection of the labeling of the priming oligonucleotides are compared.

17. Method for detecting a mutation associated with fragile X syndrome, characterized in that one performs a genetic amplification according to claim 15 or 16 of one or more nucleic acid fragments of the region of 20 kb around the position 125 kb in particular of the region containing the sites close to the CpG island, and in that the disappearance or the modification of some of these fragments is detected, in particular in that fragments elongated relative to the size of the fragments obtained under the same processing conditions are detected, from a normal sample, not carrying the fragile X mutation.

18. Recombinant DNA containing at least one nucleic acid fragment according to any one of claims 1 to 5, optionally associated with a sequence allowing transcription and / or translation in a chosen host cell in which said recombinant DNA is likely to be introduced.

19. Cloning and expression vector characterized in that it contains a recombinant DNA according to claim 18.

20. Cell host characterized in that it is transformed by a recombinant vector according to claim 19.

21. Protein resulting from the transcription and translation of a cDNA fragment according to claim 5, as obtained by the steps of: transformation of a cellular host determined by this cDNA, under conditions allowing its transcription and its translation; recovery of the expressed protein if necessary after lysis of the cell host.

22. Antibodies directed against a protein according to claim 21.