CN106399296A - Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method - Google Patents
Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method Download PDFInfo
- Publication number
- CN106399296A CN106399296A CN201610803693.7A CN201610803693A CN106399296A CN 106399296 A CN106399296 A CN 106399296A CN 201610803693 A CN201610803693 A CN 201610803693A CN 106399296 A CN106399296 A CN 106399296A
- Authority
- CN
- China
- Prior art keywords
- fragments
- fragment
- standard
- fragment mixture
- molecular weight
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention provides a preparation method of a standard-molecular-weight fragment mixture and the standard-molecular-weight fragment mixture prepared by adopting the preparation method. For the standard-molecular-weight fragment mixture and the preparation method of the standard-molecular-weight fragment mixture, the standard-molecular-weight fragment mixture comprises one fragment with the size being 80bp as shown in SEQ ID No.1 and other 9 fragments, wherein the sizes of the 9 fragments are as follows: 124bp, 194bp, 224bp, 254bp, 304bp, 349bp, 399bp, 424bp and 454bp, the 9 fragments are prepared in two parts, first, a pMD18-T plasmid vector is taken as a template, thus the first parts of the 9 fragments are obtained, then, the first parts of the fragments are respectively connected with the second parts, namely, the fluorescent connectors, and thus the 9 fragments are obtained. The standard-molecular-weight fragment mixture provided by the invention can be used for measuring the sizes of the DNA sequences through capillary electrophoresis, and has the advantages that the preparation is simple, the cost is low, the practicability is strong, the detection is accurate and sensitive, etc.
Description
Technical field
The present invention relates to DNA typing technical field, more particularly, to a kind of preparation method of standard molecular weight fragment mixture
And standard molecular weight fragment mixture prepared therefrom.
Background technology
Forensic DNA typing technology since the advent of the world, causes revolutionary change in forensic science, drastically increases and hold
Method department collects the ability of criminal according to live evidence.DNA genetic marker has not with age, nutriture or environmental change
The features such as change, using capillary electrophoresis detection DNA genetic marker, and then the method for determination DNA typing is widely used.In hair
In cons electrophoresis experiment, standard molecular weight fragment mixture, as internal standard substance, is quantitatively adding in testing sample DNA, you can root
The clip size of typing DNA is treated in molecular weight presumption according to internal standard substance.
Standard molecular weight fragment mixture is one group and carries fluorescently-labeled, known molecular amount size, purer DNA piece
Section mixture.Compared with traditional DNA molecular amount reference material (Marker), first, as internal reference, itself carries fluorescence to internal standard
Labelling, is detected in same capillary tube with testing sample, and check and correction result of calculation is more accurate.Secondly, used by genetic analyzer
Electrophoretic medium is the gummosis of capillary electrophoresis, and resolution can be accurate to 1 bp, carries compared with agarose gel resolution (tens bp)
High tens times, therefore its degree of accuracy is also higher.
Although the PCR amplification method using unique DNA fragment is simple, carried out using the same fragment of same a pair of primer pair
PCR amplification repeatedly, poor repeatability sometimes, various PCR primer mutually dilute in mixing and can reach it is sometimes necessary to concentrate
To preferable concentration standard, need higher manpower and fund input.The method of the amplification of multiple PCR products, that is, utilize a pair
Or several primer is expanded to one or more templates in same reaction tube, obtain one group of PCR primer, but due to multiple
The influencing each other of primer, PCR efficiency is low, poor repeatability, difficult to realize in target produce in a large number.
How to provide one kind to have preparation is simple, low cost, be easy to preserve, practical, detection is sensitive, quantitative quick etc.
The standard molecular weight fragment mixture of advantage becomes problem to be solved.
Content of the invention
The present invention provides a kind of preparation method of standard molecular weight fragment mixture, by dividing two by standard molecular weight fragment
Step is prepared, and preparation process is simple, and can significantly reduce preparation cost.
Present invention also offers a kind of standard molecular weight fragment mixture, prepared by methods described, have and be easy to preserve, in fact
With the feature that property is strong, easy to detect.
Present invention also offers a kind of test kit, including described standard molecular weight fragment mixture, described test kit energy
Effectively detection DNA molecular size.
A kind of preparation method of standard molecular weight fragment mixture that the present invention provides, wherein,
Described standard molecular weight fragment mixture includes the fragment shown in SEQ ID No.1 of 1 80bp size and remaining 9
Fragment, the size of described 9 fragments be respectively 124bp, 194bp, 224bp, 254bp, 304bp, 349bp, 399bp, 424bp and
454bp,
Wherein, described 9 fragments divide two parts to be prepared, first using pMD18-T plasmid vector as template, using pin
The extension increasing sequence that performing PCR amplification obtains 9 fragments is entered respectively to described template to the amplimer of above 9 fragments, will be described
Obtain 9 target fragment after extension increasing sequence enzyme action, then each target fragment is inserted plasmid vector respectively and obtain 9 restructuring matter
Grain, and each recombiant plasmid is proceeded to host cell respectively bred, reclaim each recombiant plasmid afterwards and enzyme action obtains described 9
The Part I of fragment, described amplimer is the nucleotide sequence shown in SEQ ID No.2 to SEQ ID No.19, then will
The Part I of each fragment is connected described 9 fragments of acquisition respectively with the band fluorescent linker as Part II.
In the solution of the present invention, described SEQ ID No.1 can be obtained by synthetic.The sequence of SEQ ID No.1
It is classified as：
GAGCATGTCGTGACGTCAGAATTCTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAG
GCG.
9 pairs of amplimers that the present invention provides and its corresponding standard molecular weight fragment are as shown in table 1 below, and PCRF represents
Forward primer, PCRR represents reverse primer；
In a specific embodiment of the present invention, described Part I is with described Part II by sticky end even
Connect.
In the another embodiment of the present invention, the plasmid vector of insertion target fragment carries for pMD18-T plasmid
Body, described enzyme action is the double enzyme enzyme action of Ecol R Ι and Sal Ι.
In the solution of the present invention, described enzyme action includes the enzyme action to described extension increasing sequence, to enzyme action of recombiant plasmid etc..
In the another embodiment of the present invention, complementary by two with fluorescent linker as Part II
DNA sequence is constituted, and described DNA sequence is the sequence shown in SEQ ID No.20 and SEQ ID No.21, described band fluorescent linker
Not complementary end be Ecol R Ι sticky end, a DNA end of the described other end with fluorescent linker carries fluorescent labeling
Thing.
For example, described band fluorescent linker can be：
| Clip size | Sequence | SEQ ID NO. | Modify |
| 19bp | GAGCATGTCGTGACGTCAG | SEQ ID No.20 | 5 ' fluorescent markers |
| 23bp | CTCGTACAGCACTGCAGTCTTAA | SEQ ID No.21 | No |
Further, described fluorescent marker is located at the 5 ' ends of SEQ ID No.20, and described fluorescent marker is ROX.
Further, described host cell is JM109 Bacillus coli cells.
Further, described Part II and the condition of contact of the Part I of each fragment are：Part II with each
The mol ratio of the Part I of section is 3:1, connect temperature and be 37 DEG C, the Connection Time is 30min, then heats to 95 DEG C, 5min
Terminate coupled reaction.
Further, will come using described amplification as template to the sequence of 2391bp at pMD18-T carrier 1963bp
Primer is expanded.Applicant's research finds, no special secondary structure moderate using this section of sequence GC ratio, is conducive to stable
Obtain above-mentioned fragment.
A kind of standard molecular weight fragment mixture that the present invention provides, described standard molecular weight fragment mixture methods described
Obtain.
Present invention also offers a kind of test kit, containing described standard molecular weight fragment mixture.
The scheme that the present invention provides has the advantages that following outstanding：
1) present invention provides a kind of preparation method of standard molecular weight fragment mixture, solves using unique DNA fragment
Although PCR amplification method simple, using the PCR amplification carrying out repeatedly with the same fragment of a pair of primer pair, sometimes repeat
Property poor, various PCR primer mixing when mutually dilute it is sometimes necessary to concentrate the preferable concentration standard that can reach, needs
Higher manpower and a difficult problem for fund input.
2) method simultaneously also solving the amplification of multiple PCR products, that is, utilize a pair or several to primer in same reaction
In pipe, one or more templates are expanded, obtain one group of PCR primer, but influencing each other due to multi-primerses, PCR effect
Rate is low, poor repeatability, is difficult to realize a large amount of problem producing of interior target.
3) standard molecular weight fragment is carried out in two steps preparation by the present invention program, inserts plasmid using by described Part I
Carrier, and a large amount of amplified bands have the recombiant plasmid of described Part I in host's body, the plasmid amount of a batch experiment preparation is remote
Much larger than as only obtainable amount being expanded by PCR it is only necessary to the shorter Part II of synthetic, during use, pass through enzyme action
Recombiant plasmid is obtained described Part I in a large number and is connected with described Part II, and the later stage does not need archaeal dna polymerase and PCR to delay
Rush liquid, and the equipment needing is simple, significantly reduces preparation cost.The easy keeping quality of recombiant plasmid and stability, also make
Obtain standard molecular weight fragment to stablize and easily repeat it is ensured that the standard molecular weight fragment of preparation is not only stablized in length, same
When in base sequence aspect also relatively stable it is ensured that making standard molecular weight fragment spotting when it is as capillary electrophoresis
The accuracy of DNA molecular length.
Brief description
Fig. 1 shows the capillary electrophoresis detection result of the standard molecular weight fragment mixture of the present invention；
Fig. 2 shows standard molecular weight fragment mixture that 9947A standard DNA prepared using the application as the hair of object of reference
Cons electrophoresis genotyping result；
Fig. 3 shows standard molecular weight fragment mixture that 9948 standard DNA are prepared using the application as the hair of object of reference
Cons electrophoresis genotyping result.
Specific embodiment
The preparation of embodiment 1 standard molecular weight fragment mixture
Used in the present embodiment, pMD18-T plasmid vector is purchased from Takara company, catalog number 6011；Ecol RΙ
It is purchased from Takara company with Sal Ι enzyme, catalog number is respectively：Ecol R Ι is 1040S, and Sal Ι is 1080S；Buffer and
Other reaction reagents are also commercially available.
Standard molecular weight fragment mixture in the present embodiment includes the fragment shown in SEQ ID No.1 of 1 80bp size
With remaining 9 fragment, the size of described 9 fragments be respectively 124bp, 194bp, 224bp, 254bp, 304bp, 349bp,
399bp, 424bp and 454bp,
Wherein, the fragment shown in SEQ ID No.1 of 80bp size passes through the synthesis of Shanghai Sheng Gong company；
Described 9 fragments divide two parts to be prepared, first using pMD18-T plasmid vector as template, using for
The amplimer of upper 9 fragments enters the extension increasing sequence that performing PCR amplification obtains 9 fragments respectively to described template, by described amplification
Obtain 9 target fragment after sequence enzyme action, then each target fragment is inserted plasmid vector respectively and obtain 9 recombiant plasmid, and
Each recombiant plasmid is proceeded to host cell respectively bred, reclaim each recombiant plasmid afterwards and enzyme action obtains described 9 fragments
Part I, described amplimer be SEQ ID No.2 to SEQ ID No.19 shown in nucleotide sequence, then by each
The Part I of section is connected described 9 fragments of acquisition respectively with the band fluorescent linker as Part II.
Further, insertion target fragment plasmid vector be pMD18-T plasmid vector, described enzyme action be Ecol R Ι and
The double enzyme enzyme action of Sal Ι；
Described primer sequence SEQ ID No.2 to SEQ ID No.19 passes through Shanghai Sheng Gong company and synthesizes.
The band fluorescent linker using is as follows, and its sequence is passed through Shanghai Sheng Gong company and synthesized：
The concrete preparation process of 9 fragments is as follows：
1. enter, using described amplimer, the extension increasing sequence that performing PCR obtains 9 fragments respectively
(1) 50ul PCR amplification system is：
(2) PCR amplification program：
After amplification terminates, configure 1% agarose gel, often row leaves 14 holes,, as index aperture, other add for one of them
Enter the reacted product of PCR.Carry out electrophoresis, draw 2 μ L sample-loading buffers, 1 μ L PCR primer, voltage 140V, 45 minutes, observe
Electrophoresis result, obtains the extension increasing sequence of 9 fragments.
2. the extension increasing sequence of acquisition is formed with inserting pMD18-T plasmid vector respectively after Ecol R Ι and Sal Ι double digestion
Recombiant plasmid：
1) extension increasing sequence is carried out with double digestion, 20ul enzyme action system is as follows：
| Extension increasing sequence | Sal I | EcoR I | 10 × H buffer |
| 16.4ul | 0.8ul | 0.8ul | 2ul |
Enzyme action condition：37 DEG C, 3h；Then at 95 DEG C, 10min terminates enzyme action；Obtain 9 target fragment.
2) pMD18-T plasmid vector is carried out with double digestion, 100ul enzyme action system is as follows：
Enzyme action condition：37 DEG C, overnight；Then 95 DEG C, 10min terminates enzyme action；Obtain the support products through double digestion.
3) by each target fragment, the support products respectively with through double digestion are attached, and 10ul linked system is as follows：
Connect test kit using from the commercially available DNA ligation kit of Takara company, catalog number：6023.
Condition of contact：16 DEG C, 1h；Obtain 9 recombiant plasmid being inserted with target fragment.
3. and then each recombiant plasmid is proceeded to host cell respectively to be expanded：
1) competence JM109 Bacillus coli cells (Takara company, the catalog number of -80 DEG C of preservations of 1 pipe are taken：
9052), put thawed on ice；
2) add above-mentioned recombiant plasmid, gently rotating centrifugal pipe is to mix content, ice bath 30min；
3) centrifuge tube is placed in 42 DEG C of thermal shock 60-90 seconds, then puts rapidly ice bath 2-3 minute, this process must not shake from
Heart pipe；
4) add 500ul LB liquid medium (without antibiotic) in each centrifuge tube, after mixing, be placed in 37 DEG C of shaking tables
Shaken cultivation 45 minutes (150 revs/min)；Purpose is to make related resistant maker gene expression on plasmid, so that thalline is recovered；
5) centrifuge tube content is mixed, the competent cell drawing 100ul conversion is added to the LB containing corresponding antibiotic
On solid agar medium (ampicillin containing 50ug/ml), with aseptic elbow glass rod with gentle, cell is uniformly spreadable.To put down
Plate is placed in room temperature until liquid is absorbed, and is inverted flat board, 37 DEG C of culture 12-16 hours, distinguishing substantially to blue, white macula.
6) in super-clean bench, single white bacterial plaque is chosen in LB fluid medium, bacterium colony one arm, 180～
200 revs/min overnight (12～16 hours, be preferred with thalline muddiness).
4. utilize plasmid QIAquick Gel Extraction Kit to reclaim each recombiant plasmid, and with the double enzyme enzyme action of Ecol R Ι and Sal Ι to obtain
State the Part I of 9 fragments：
Wherein, plasmid QIAquick Gel Extraction Kit is the little extraction reagent kit of plasmid purchased from TIANGEN Biotech (Beijing) Co., Ltd.,
Catalog number：DP103.
1) use 1.5ml centrifuge tube to collect 1-5ml bacterium solution in above-mentioned 6), 12,000rpm centrifugation 1min, abandon supernatant.
2) 250 μ l P1/RNase A mixed liquors are added, whirlpool acutely vibrates up to the complete Eddy diffusion of thalline, and room temperature is quiet
Put 1-2min.
3) add 250 μ l P2, gently repeatedly overturn and mix 5-6 time.Room temperature places 1-2min, so that thalline is fully cracked,
Until forming the cracked solution of clarification.
4) add 350 μ l P3, gently repeatedly overturn immediately and mix 5-6 time.White flock precipitate now occurs.
5) 12,000rpm room temperature centrifugation 10min, collects supernatant.
6) supernatant is placed in DNA purification column, stands 1-2min.
7) 12,000rpm centrifugation 1min, abandons filtrate.
8) add 500 μ l solution PD, 12,000rpm centrifugation 1min, abandon filtrate.
9) add 500 μ l solution PW, 12,000rpm centrifugation 1min, abandon filtrate.
10) add 500 μ l solution PW, 12,000rpm centrifugation 1min, abandon filtrate.
11) 12,000rpm centrifugation 3min, with the thorough liquid removing residual in purification column.
12) DNA purification column is placed in new centrifuge tube.To purification column centre, hanging Deca 50-100 μ l water, room temperature
Place 2min.
13) 12,000rpm centrifugation 1min, ttom of pipe is high-purity recombinant plasmid dna, that is, the recombinant plasmid dna reclaiming can be put
Preserve in -20 DEG C.
14) enzyme action is carried out to the recombinant plasmid dna reclaiming, the double enzyme enzyme action system of 100ul is as follows：
Enzyme action condition：Overnight carry out enzyme action in 37 DEG C of constant incubators, then heat to 95 DEG C, 10min terminates enzyme action, obtains
Obtain the Part I of each fragment.
5. the Part I of each fragment is connected described 9 pieces of acquisition with the band fluorescent linker as Part II respectively
Section：
The ligase using is ibid.In coupled reaction, Part II and Part I mol ratio are 3:1, can be according to second
The actual concentrations of part and Part I are suitably adjusted to realize above-mentioned mol ratio to its addition, and this is to this area skill
Can be achieved on for art personnel.Condition of contact is：37 DEG C, 30min；Then heat to 95 DEG C, 5min terminates coupled reaction,
Obtain described 9 fragments.
6. after 9 fragments of preparation being mixed, obtain the standard molecular weight fragment of the present invention with described SEQ ID No.1
Mixture, carries out capillary electrophoresis detection using ABI 3130XL type genetic analyzer (Applied Biosystems company),
It can be seen that going out, peak position is correct, clip size is consistent with expected resultss, and peak type is good, and peak height is basically identical, sees Fig. 1.
As can be seen that the method that the application provides can obtain described standard scores by simple step with relatively low cost
Son amount fragment mixture.
Embodiment 2 carries out typing using standard molecular weight fragment mixture prepared by the application to known dna sample.
With 9947A, 9948 standard DNA as template, expanded with DNATyper15 test kit amplification reaction system, with this
The standard molecular weight fragment mixture of application preparation, as object of reference, carries out capillary electrophoresis through ABI 3130XL genetic analyzer
Detection, draws 9947A, 9948 genotyping result, sees Fig. 2 and Fig. 3.
As can be seen that compared to the known typing of two standard DNA, the standard molecular weight fragment using the application preparation is mixed
, as object of reference, the typing of acquisition is complete for compound, and result accurately, illustrates the standard molecular weight fragment mixing using the application preparation
Thing can be used in analyzing capillary electrophoresis DNA clip size.
Claims (10)
1. a kind of preparation method of standard molecular weight fragment mixture it is characterised in that
Described standard molecular weight fragment mixture includes fragment shown in SEQ ID No.1 and remaining 9 piece of 1 80bp size
Section, the size of described 9 fragments be respectively 124bp, 194bp, 224bp, 254bp, 304bp, 349bp, 399bp, 424bp and
454bp,
Wherein, described 9 fragments divide two parts to be prepared, first using pMD18-T plasmid vector as template, using for
The amplimer of upper 9 fragments enters the extension increasing sequence that performing PCR amplification obtains 9 fragments respectively to described template, by described amplification
Obtain 9 target fragment after sequence enzyme action, then each target fragment is inserted plasmid vector respectively and obtain 9 recombiant plasmid, and
Each recombiant plasmid is proceeded to host cell respectively bred, reclaim each recombiant plasmid afterwards and enzyme action obtains described 9 fragments
Part I, described amplimer be SEQ ID No.2 to SEQ ID No.19 shown in nucleotide sequence, then by each
The Part I of section is connected described 9 fragments of acquisition respectively with the band fluorescent linker as Part II.
2. method according to claim 1 is it is characterised in that described Part I and described Part II are by viscosity end
End connects.
3. method according to claim 1 is it is characterised in that the plasmid vector of insertion target fragment is pMD18-T plasmid
Carrier, described enzyme action is the double enzyme enzyme action of Ecol R Ι and Sal Ι.
4. method according to claim 1 is it is characterised in that complementary by two with fluorescent linker as Part II
DNA sequence is constituted, and described DNA sequence is the sequence shown in SEQ ID No.20 and SEQ ID No.21, described band fluorescent linker
Not complementary end be Ecol R Ι sticky end, a DNA end of the described other end with fluorescent linker carries fluorescent labeling
Thing.
5. method according to claim 4 is it is characterised in that described fluorescent marker is located at the 5 ' of SEQ ID No.20
End, described fluorescent marker is ROX.
6. method according to claim 1 is it is characterised in that described host cell is JM109 Bacillus coli cells.
7. method according to claim 1 is it is characterised in that the connection of the Part I of described Part II and each fragment
Condition is：Part II is 3 with the mol ratio of the Part I of each fragment:1, connect temperature and be 37 DEG C, the Connection Time is
30min, then heats to 95 DEG C, and 5min terminates coupled reaction.
8. method according to claim 1 is it is characterised in that by the sequence to 2391bp at pMD18-T carrier 1963bp
To be expanded using described amplimer as template.
9. a kind of standard molecular weight fragment mixture is it is characterised in that described standard molecular weight fragment mixture utilizes right to want
1-8 any one methods described is asked to obtain.
10. a kind of test kit is it is characterised in that containing the standard molecular weight fragment mixture described in claim 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610803693.7A CN106399296A (en) | 2016-09-05 | 2016-09-05 | Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610803693.7A CN106399296A (en) | 2016-09-05 | 2016-09-05 | Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106399296A true CN106399296A (en) | 2017-02-15 |
Family
ID=57998412
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610803693.7A Pending CN106399296A (en) | 2016-09-05 | 2016-09-05 | Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399296A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868001A (en) * | 2017-04-10 | 2017-06-20 | 公安部第研究所 | One kind prepares calibration method in fluorescence molecule amount using rite-directed mutagenesis and enzyme incision technology |
| CN110923305A (en) * | 2019-11-25 | 2020-03-27 | 广州市达瑞生物技术股份有限公司 | DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995011971A1 (en) * | 1993-10-28 | 1995-05-04 | Life Technologies, Inc. | Nucleic acid marker ladder for estimating mass |
| CN101575599A (en) * | 2008-05-07 | 2009-11-11 | 济南大学 | DNA molecular weight standard with even 200 bp gradient and rapid preparation method thereof |
| CN103667325A (en) * | 2012-08-31 | 2014-03-26 | 沙船（天津）生物科技发展有限公司 | Establishing method and application of plasmid for preparing Marker I |
| CN105602979A (en) * | 2016-01-22 | 2016-05-25 | 上海同科生物科技有限公司 | Preparation method and plasmid of DNA Marker and preparation method of plasmid |
-
2016
- 2016-09-05 CN CN201610803693.7A patent/CN106399296A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995011971A1 (en) * | 1993-10-28 | 1995-05-04 | Life Technologies, Inc. | Nucleic acid marker ladder for estimating mass |
| CN101575599A (en) * | 2008-05-07 | 2009-11-11 | 济南大学 | DNA molecular weight standard with even 200 bp gradient and rapid preparation method thereof |
| CN103667325A (en) * | 2012-08-31 | 2014-03-26 | 沙船（天津）生物科技发展有限公司 | Establishing method and application of plasmid for preparing Marker I |
| CN105602979A (en) * | 2016-01-22 | 2016-05-25 | 上海同科生物科技有限公司 | Preparation method and plasmid of DNA Marker and preparation method of plasmid |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868001A (en) * | 2017-04-10 | 2017-06-20 | 公安部第研究所 | One kind prepares calibration method in fluorescence molecule amount using rite-directed mutagenesis and enzyme incision technology |
| CN110923305A (en) * | 2019-11-25 | 2020-03-27 | 广州市达瑞生物技术股份有限公司 | DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection |
| CN110923305B (en) * | 2019-11-25 | 2023-12-29 | 广州市达瑞生物技术股份有限公司 | DNA molecular weight standard suitable for southern blot hybridization detection of fragile X syndrome |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947827B (en) | Bighead carp gender specific molecular marker, screening method and application thereof | |
| CN105018646B (en) | A kind of primer, probe and the kit of detection bovine epizootic fever virus | |
| CN107446929A (en) | Aptamer of specific recognition ochratoxin A and preparation method thereof | |
| WO2020253630A1 (en) | Polynucleotide for identifying male or female plant of ginkgo and use thereof | |
| CN104946795B (en) | Primer, probe and kit for Site Detection various serotype foot and mouth disease virus | |
| CN112481417B (en) | Rapid detection method and kit for new coronavirus typing and mutation sites | |
| CN110004225B (en) | Tumor chemotherapeutic drug individualized gene detection kit, primers and method | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN116656850B (en) | Sequence combination for rapidly detecting rice bacterial leaf blight bacteria based on CRISPR/Cas12a-RPA and application thereof | |
| CN107841566B (en) | Composite amplification system for rapidly mutating short tandem repeat sequence of Y chromosome, kit and application | |
| CN106399296A (en) | Preparation method of standard-molecular-weight fragment mixture and standard-molecular-weight fragment mixture prepared by adopting preparation method | |
| CN107603971A (en) | A kind of preparation method of in situ hybridization probe | |
| CN113774053B (en) | Nucleic acid probe and kit for simultaneously detecting various tomato viruses and application of nucleic acid probe and kit | |
| CN114657232A (en) | Universal blocking reagent for improving target capture efficiency and application thereof | |
| CN111534603B (en) | Method for identifying aedes albopictus by using fluorescent RPA | |
| CN108103143B (en) | Method for constructing multiple PCR and rapid library in target region | |
| CN113151567A (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| TW201321520A (en) | Method and system for virus detection | |
| WO2023202030A1 (en) | Method for constructing high-throughput sequencing library of small rna | |
| CN109797437A (en) | A kind of construction method of sequencing library when detecting multiple samples and its application | |
| CN108977552A (en) | Meat identifies positive reference substance and its preparation method and application | |
| CN108411030A (en) | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 | |
| CN107574166B (en) | Cell lysate for extracting soybean seed genome DNA and extraction method thereof | |
| CN105132563B (en) | A kind of primer sets and detection method of the detection of aphid fungal component multiplex PCR | |
| CN108949901A (en) | The enzymatic cleavage methods of methane capsule bacterium in a kind of Rapid identification pit mud |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170215 |