CN108546755A - Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application - Google Patents
Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application Download PDFInfo
- Publication number
- CN108546755A CN108546755A CN201810440187.5A CN201810440187A CN108546755A CN 108546755 A CN108546755 A CN 108546755A CN 201810440187 A CN201810440187 A CN 201810440187A CN 108546755 A CN108546755 A CN 108546755A
- Authority
- CN
- China
- Prior art keywords
- calibration object
- fmr1
- fragile
- mental retardation
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses a kind of calibration object for the detection of fragile X mental retardation Disease-causing gene and its application, contain the different FMR1 genetic fragments of at least six CGG sequence repeat numbers in the calibration object.Fragile X mental retardation Disease-causing gene testing calibration product using the present invention, FMR1 gene C GG repeat numbers are detected using fluorescent PCR capillary electrophoresis, standard curve is built using calibration object and the result of detection, to calculate the CGG repeat numbers that same batch detects sample, this method significantly improves the resolution of fragile X mental retardation Disease-causing gene detection, keeps the detection method of fragile X mental retardation more perfect and accurate.
Description
Technical field
It is especially a kind of for the pathogenic base of fragile X mental retardation the present invention relates to fragile X mental retardation technical field of gene detection
Calibration object because of detection and its application.
Background technology
Fragile X mental retardation is the most common heredity dysnoesia type for being only second to mongolism, incidence 1/
2500~1/5000, incidence is about 6.3% in China's Hypophrenia.The disease is fallen ill there are apparent gender differences,
Male's incidence is higher, and according to statistics, male's incidence is 1:4000, women incidence is 1:8000~1:6000.It is main special
It levies as moderate to severe feeblemindedness, and the state of an illness has the tendency that exacerbation with age, other clinical manifestations are unusual facies,
, there is big testis in such as long face or protruding ears after puberty, many patients be also embodied by impulsion, more dynamic, anxieties, it is frightened it is social,
The stiff equal Autism behaviors of language.FXS seriously endangers upgrowth and development of children, and early discovery, early treatment, early intervention can significantly improve trouble
Youngster's prognosis, and prenatal genetic consulting can be provided for family heredity, avoid occurring same patient in family again, to happy family life
Happy, social population's Quality strengthening is of great importance, and has immeasurable Social benefit and economic benefit.
Fragile X mental retardation is X chromosome DNA Hypermethylations or changes the caused chain incomplete dominant lnheritances of X completely
Disease.The Disease-causing gene of FXS is No. 1 gene (FMR1) of fragile X mental retardation, and most FXS are due to FMR1 (CGG) n weights
Complex sequences hyper expanded lead to gene methylation and caused by, only only a few case is either complete by FMR1 point mutations
It lacks and causes entirely.The CGG repeat numbers of normal person are 6~44, and most commonly 29 times and 30 times, repeat number is 55~200
As " premutation ", it is " full mutation " that repeat number, which is more than 200, and it is " gray area " that repeat number, which is 45~54, between " preceding
Mutation " is between " normal ", without clinical manifestation.
Existing fragile X mental retardation detection method is using the technologies such as PCR, MLPA, Southern Blot.But these also have
There is certain defect, such as operation difficulty is high, time-consuming, of high cost for detection.In addition to this, to FMR1 gene C GG repeat numbers
Resolution is still inadequate.The FMR1 gene target fragments of based on PCR technology amplification, capillary electrophoresis detection amplified fragments are than tradition
Agarose gel electrophoresis resolution ratio higher, the different length PCR fragment of 3~8bp or more can be differentiated, but different batches are run
Also bring along certain error.
Invention content
Based on the above issues, one kind is provided and is used for it is an object of the invention to overcome above-mentioned the deficiencies in the prior art place
The calibration object of fragile X mental retardation Disease-causing gene detection is avoided that the pathogenic base of fragile X mental retardation in the prior art using the standard items
Because of the low resolution problem of detection, keep the detection method of fragile X mental retardation more perfect and accurate.
To achieve the above object, the technical solution that the present invention takes includes the following aspects：
In the first aspect, described the present invention provides a kind of calibration object for the detection of fragile X mental retardation Disease-causing gene
Contain the FMR1 genetic fragments that at least six CGG sequence repeat numbers are different in calibration object.
Preferably, the FMR1 genetic fragments that 6 CGG sequence repeat numbers are different are contained in the calibration object.
Preferably, the CGG sequence repeat numbers of described 6 different FMR1 genetic fragments be respectively 23,31,46,53,77,
117, as a result, 6 CGG sequence repeat numbers cover normal type in FMR1 genes (CGG sequences repeat number 6~54) and
The premutation type (55~200) of CGG sequences repeat number≤117, while calibration object can also detect that the CGG sequences of FMR1 genes
117~200 premutation type of repeat number and>200 full-mutant (CGG sequence repeat numbers>200).
Preferably, the FMR1 genetic fragment length of the repeat number 23 is 297.80~298.99bp, repeat number 31
FMR1 genetic fragment length is 321.73~322.91bp, the FMR1 genetic fragment length of repeat number 46 is 365.23~
The FMR1 genetic fragment length of 366.37bp, repeat number 53 are 388.42~389.61bp, the FMR1 genetic fragments of repeat number 77
Length is 458.33~461.86bp, and the FMR1 genetic fragment length of repeat number 117 is 574.36~575.52bp.
Preferably, standard curve, the coefficient R of the standard curve are established according to the calibration object2For 0.9997~
0.9999；It should be noted that R2Value it is higher closer to the reference value of 1 description standard curve.
Preferably, the calibration object is thin by the different fragile X mental retardation of the CGG sequence repeat numbers of 4 kinds of FMR1 genetic fragments
Born of the same parents system genomic DNA equivalent (i.e. quality) mix, wherein the cell line be respectively cell line GM06905 (wherein
The repeat number of CGG be 23 and 77), cell line GM20232 (wherein the repeat number of CGG is 46), cell line GM20233 (wherein CGG
Repeat number be 117), cell line GM20236 (wherein the repeat number of CGG is 31 and 53).
In the second aspect, the present invention provides above-mentioned calibration objects to prepare the GG repetitions of fragile X mental retardation FMR1 gene Cs
Application in several detection kits.Preferably, pcr amplification reaction system when detection and condition are as follows：
1) reaction system：The PCR of the dNTPs (10mmol/L) of 2 × GC Buffer I of 10 μ L, 0.4 μ L, 5.2 μ L enhance
Agent, each 0.3 μ L of upstream and downstream primer of 10 μm of ol/L, archaeal dna polymerase (5U/ μ L) 0.3 μ L, template quantity 80ng finally use ddH2O
Complement to 20 μ L；
2) reaction condition：After 98 DEG C of pre-degeneration 10min, 33 cycles are carried out：97 DEG C of denaturation 35s, 62 DEG C of 35s that anneal, 68
DEG C extend 4min, then 68 DEG C eventually extend 10min.
In terms of third, the present invention provides a kind of detection reagents of fragile X mental retardation FMR1 gene Cs GG repeat numbers
Box contains above-mentioned calibration object in the kit.It is useful for amplification institute it should be noted that can also contain in the kit
The sense primer (as shown in SEQ ID NO.1) and downstream primer (as shown in SEQ ID NO.2) and PCR for stating calibration object increase
Strong agent (wherein containing glycine betaine and DMSO).
In conclusion beneficial effects of the present invention are：
Fragile X mental retardation Disease-causing gene testing calibration product using the present invention, using fluorescent PCR-capillary electrophoresis pair
FMR1 gene C GG repeat numbers are detected, and standard curve are built using calibration object and the result of detection, to calculate same batch
The CGG repeat numbers of sample are detected, this method significantly improves the resolution of fragile X mental retardation Disease-causing gene detection, keeps fragile X comprehensive
The detection method of simulator sickness is more perfect and accurate.
Description of the drawings
Fig. 1 is that calibration object GeneMapper softwares analyze peak figure；
Fig. 2 is the canonical plotting of calibration object；
Fig. 3 is that 1 GeneMapper softwares of sample analyze peak figure；
Fig. 4 is that 2 GeneMapper softwares of sample analyze peak figure；
Fig. 5 is that 3 GeneMapper softwares of sample analyze peak figure；
Fig. 6 is that 4 GeneMapper softwares of sample analyze peak figure.
Specific implementation mode
To better illustrate the object, technical solutions and advantages of the present invention, below in conjunction with the drawings and specific embodiments pair
The present invention is described further.
The preparation of the pathogenic FMR1 genetic test calibration objects of 1 fragile X mental retardation of embodiment
1, raw material
4 kinds of fragile X mental retardation cell lines are bought from Coriell Institute for Medical Research
(GM06905 repeat numbers 23/77, GM20232 repeat numbers 46, GM20233 repeat numbers 117, GM20236 repeat numbers 31/53) conduct
Raw material prepared by fragile X mental retardation genetic test calibration object.Above-mentioned cell line is cultivated to specifications.
2, extracting genome DNA
Cell after culture is extracted using the genome DNA extracting reagent kit of QIAGEN companies, is surveyed using Qubit 3.0
Determine the concentration of DNA.
3, the preparation of calibration object
The genomic DNA of the concentration measured according to step 2, each cell line respectively takes 10 μ g to be mixed, and obtains required
Calibration object.
The detection of 2 fragile X mental retardation genetic test calibration object of embodiment
1, using calibration object made from embodiment 1, PCR reactions are carried out according to following system and condition：
PCR reaction systems：The PCR reaction systems of 20 μ L are prepared in the thin-walled PCR pipe of 200 μ L, PCR amplification system is such as
Under：
Wherein, the primer being related to is as shown in table 1 below：
1 primer sequence of table
| Sense primer F sequences | FAM-TCAGGCGCTCAGCTCCGTTTCGGTTTCA(SEQ ID NO.1) |
| Downstream primer R sequences | AAGCGCCATTGGAGCCCCGCACTTCC(SEQ ID NO.2) |
The composition of PCR reinforcing agents：4 μ L of glycine betaine (5mol/L), 1.2 DMSO μ L.
PCR response procedures：First after 98 DEG C of pre-degeneration 10min, 33 cycles are carried out：97 DEG C of denaturation 35s, 62 DEG C of annealing 35s,
68 DEG C of extension 4min, then extend 10min for 68 DEG C eventually.
2, capillary electrophoresis detection pcr amplification product
After reaction, it is detected using ABI3500Dx capillary Genetic Analysers.1 μ L pcr amplification products are taken, are added
8.5μL Hi-DiTMFormamide and 0.5 μ L GeneScan 1200Size standard, 98 DEG C of denaturation after mixing
5min puts 2min on ice, upper machine testing immediately.
3, calibration object Analysis of test results
Testing result is analyzed using GeneMapper softwares.As shown in Figure 1, from the results, it was seen that 6 purposes
Segment is respectively 298.59bp, 322.47bp, 365.88bp, 389.12bp, 459.02bp, 574.94bp.According to known standard
The repeat number of product and testing result establish standard curve, as shown in Fig. 2, formula is y=0.3398x-78.662, wherein y is represented
Repeat number, x represent the fragment length (bp) that detection obtains, coefficient R2=0.9999.
Application of 3 calibration object of embodiment in detecting fragile X mental retardation related gene FMR1
1, sample collection：Known fragile X mental retardation patient peripheral blood sample 4 is collected, using the gene of QIAGEN companies
Group DNA extraction kit extraction.
2, calibration object and 4 samples are detected according to the detection method of embodiment 2, calibration curve formula y=
0.3396x-78.742 (R2=0.9999), peak figure is detected as illustrated in figures 3-6, as a result as shown in table 2 below, type and original type
It is not consistent.
The CGG repeat numbers of 2 sample of table
The Detection of Stability of 4 calibration object of embodiment application
1, it carries out 10 repetitions according to the method for embodiment 2 to 4 samples of above example 3 to detect, detection is same every time
When testing calibration product, testing result is as shown in table 3 below.The CGG repeat numbers error that 4 pattern detections are 10 times is no more than 1, detection
As a result stablize.
The CGG repeat numbers of table 3 repeated detection, 4 samples
The stability assessment of 5 calibration object of embodiment
The length of 6 difference CGG repeat number FMR1 genetic fragments is analyzed in the calibration object detected to embodiment 4, is tied
Fruit is as shown in table 4 below, and the genetic fragment length of repeat number 23 is 297.80~298.99bp, the genetic fragment length of repeat number 31
Genetic fragment length for 321.73~322.91bp, repeat number 46 is 365.23~366.37bp, the gene piece of repeat number 53
Segment length is 388.42~389.61bp, and the genetic fragment length of repeat number 77 is 458.33~461.86bp, repeat number 117
Genetic fragment length be 574.36~575.52bp, the Fragment Differential that each segment difference number obtains between 1~3bp, compared with
Stablize.
The length of FMR1 genetic fragments in 4 calibration object of table
In conclusion can steadily detect the fragile X mental retardation related gene of sample using the calibration object of the present invention
The CGG repeat numbers of FMR1.The calibration object includes the segment of 6 difference CGG repeat numbers, is obtained through fluorescent PCR-capillary electrophoresis detection
The fragment length different to 6 builds standard curve using fragment length as abscissa by ordinate of repeat number, so that it may with
The CGG repeat numbers that sample is detected to same batch difference significantly improve the resolution of fragile X mental retardation related genes detection
Degree keeps the detection method of fragile X mental retardation more perfect and accurate.
Finally, it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention rather than is protected to the present invention
The limitation of range is protected, although being explained in detail to the present invention with reference to preferred embodiment, those skilled in the art should
Understand, technical scheme of the present invention can be modified or replaced equivalently, without departing from the essence of technical solution of the present invention
And range.
Claims (8)
1. a kind of calibration object for the detection of fragile X mental retardation Disease-causing gene, which is characterized in that containing at least in the calibration object
The different FMR1 genetic fragments of 6 CGG sequence repeat numbers.
2. calibration object according to claim 1, which is characterized in that in the calibration object not containing 6 CGG sequences repeat numbers
Same FMR1 genetic fragments.
3. calibration object according to claim 2, which is characterized in that the CGG sequences of described 6 different FMR1 genetic fragments
Repeat number is respectively 23,31,46,53,77,117.
4. calibration object according to claim 3, which is characterized in that the FMR1 genetic fragment length of the repeat number 23 is
The FMR1 genetic fragment length of 297.80~298.99bp, repeat number 31 are 321.73~322.91bp, the FMR1 of repeat number 46
Genetic fragment length is 365.23~366.37bp, and the FMR1 genetic fragment length of repeat number 53 is 388.42~389.61bp,
The FMR1 genetic fragment length of repeat number 77 is 458.33~461.86bp, and the FMR1 genetic fragment length of repeat number 117 is
574.36~575.52bp.
5. calibration object according to claim 4, which is characterized in that establish standard curve, the mark according to the calibration object
The coefficient R of directrix curve2It is 0.9997~0.9999.
6. calibration object according to claim 4, which is characterized in that the calibration object by 4 kinds of FMR1 genetic fragments CGG sequences
The genomic DNA mixed in equal amounts of the different fragile X mental retardation cell line of row repeat number forms, wherein the cell line is respectively
Cell line GM06905, cell line GM20232, cell line GM20233, cell line GM20236.
7. claim 1~6 any one of them calibration object is in the detection for preparing fragile X mental retardation FMR1 gene C GG repeat numbers
Application in kit.
8. a kind of detection kit of fragile X mental retardation FMR1 gene Cs GG repeat numbers, which is characterized in that contain in the kit
It has the right 1~6 any one of them calibration object of requirement.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810440187.5A CN108546755A (en) | 2018-05-09 | 2018-05-09 | Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810440187.5A CN108546755A (en) | 2018-05-09 | 2018-05-09 | Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108546755A true CN108546755A (en) | 2018-09-18 |
Family
ID=63494567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810440187.5A Pending CN108546755A (en) | 2018-05-09 | 2018-05-09 | Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108546755A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923305A (en) * | 2019-11-25 | 2020-03-27 | 广州市达瑞生物技术股份有限公司 | DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection |
| CN114645084A (en) * | 2020-12-17 | 2022-06-21 | 浙江大学医学院附属儿童医院 | Primer and kit for detecting CGG repeat number of FMR1 gene |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005044086A2 (en) * | 2003-10-30 | 2005-05-19 | Tufts-New England Medical Center | Prenatal diagnosis using cell-free fetal dna in amniotic fluid |
| CN101871001A (en) * | 2009-04-22 | 2010-10-27 | 中山大学达安基因股份有限公司 | Kit for detecting fragile X syndrome |
| WO2011006165A2 (en) * | 2009-07-10 | 2011-01-13 | Perkinelmer Health Sciences, Inc. | Detecting multinucleotide repeats |
| CN103282517A (en) * | 2010-10-29 | 2013-09-04 | 奥斯瑞根公司 | Mpcr methods for analyzing repeat sequences |
-
2018
- 2018-05-09 CN CN201810440187.5A patent/CN108546755A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005044086A2 (en) * | 2003-10-30 | 2005-05-19 | Tufts-New England Medical Center | Prenatal diagnosis using cell-free fetal dna in amniotic fluid |
| CN101871001A (en) * | 2009-04-22 | 2010-10-27 | 中山大学达安基因股份有限公司 | Kit for detecting fragile X syndrome |
| WO2011006165A2 (en) * | 2009-07-10 | 2011-01-13 | Perkinelmer Health Sciences, Inc. | Detecting multinucleotide repeats |
| CN103282517A (en) * | 2010-10-29 | 2013-09-04 | 奥斯瑞根公司 | Mpcr methods for analyzing repeat sequences |
Non-Patent Citations (2)
| Title |
|---|
| GRACE LIM等: "Validation of a Commercially Available Screening Tool for the Rapid Identification of CGG Trinucleotide Repeat Expansions in FMR1", 《THE JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
| KARLADLER等: "A Novel Assay for Evaluating Fragile X Locus Repeats", 《THE JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923305A (en) * | 2019-11-25 | 2020-03-27 | 广州市达瑞生物技术股份有限公司 | DNA molecular weight standard suitable for fragile X syndrome southern blot hybridization detection |
| CN110923305B (en) * | 2019-11-25 | 2023-12-29 | 广州市达瑞生物技术股份有限公司 | DNA molecular weight standard suitable for southern blot hybridization detection of fragile X syndrome |
| CN114645084A (en) * | 2020-12-17 | 2022-06-21 | 浙江大学医学院附属儿童医院 | Primer and kit for detecting CGG repeat number of FMR1 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ells et al. | Candida albicans or Candida dubliniensis? | |
| CN101921834B (en) | Polymerase chain reaction-sequence based typing (PCR-SBT) method for ABO blood type genotyping and reagent | |
| Stence et al. | Validation of optical genome mapping for the molecular diagnosis of facioscapulohumeral muscular dystrophy | |
| CN102146476B (en) | Fluorescent quantitative PCR kit for detecting alpha-globin gene deletion | |
| CN107058538B (en) | Primer composition, kit composed of primer composition and application of kit | |
| CN104404164A (en) | Hereditary deafness gene mutation detection kit | |
| CN106521023B (en) | A kind of kit and method detecting Chinese HPFH and δ β-thalassemia | |
| CN114438214B (en) | Colorectal cancer tumor marker and detection method and device thereof | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| Laig et al. | Digital PCR and the QuantStudio™ 3D Digital PCR system | |
| CN109355376A (en) | Fragile X mental retardation FMR1 genetic test primer, kit and detection method | |
| Long et al. | The carriage rates of αααanti3. 7, αααanti4. 2, and HKαα in the population of Guangxi, China measured using a rapid detection qPCR system to determine CNV in the α-globin gene cluster | |
| CN108546755A (en) | Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN110846409A (en) | Primer combination for detecting TNNI3K gene mutation and application thereof | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| Tristezza et al. | An optimized protocol for the production of interdelta markers in Saccharomyces cerevisiae by using capillary electrophoresis | |
| CN105950766B (en) | Primer group and kit for detecting HLA-B5801 allele | |
| CN108300776A (en) | Fragile X mental retardation fast screening reagent kit | |
| CN116574795A (en) | Thalassemia genotyping primer set and kit based on time-of-flight mass spectrometry | |
| CN116064775A (en) | Detection kit and detection method for TRECs, KRECs and SMN1 | |
| CN113755568B (en) | Primer probe, kit and application for detecting alpha globin gene copy number by utilizing microdroplet digital PCR | |
| CN105274232A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for one-step quantitative detection of TRECs gene and its application | |
| CN116732158A (en) | 22q11 microdeletion and/or micro-repetition detection primer set, primer probe composition, kit and application thereof | |
| CN105506067A (en) | AMRMS-qPCR detection kit and detection method for NOSLAP genotyping |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180918 |