CN102286517A - Method for regulating expression strength of gene in chromosome of microbe by using artificial regulatory element and library of artificial regulatory element - Google Patents

Abstract

The invention discloses a method for regulating the expression strength of a gene in a chromosome of a microbe by using an artificial regulatory element and a library of the artificial regulatory elements, which comprises the following steps: amplifying a DNA fragment out by using a polymerase chain reaction (PCR) amplification process, wherein the DNA fragment comprises a 40-to-3,000-base fragment homologous with the upstream sequence of an original regulation region in a gene to be regulated in the chromosome of the microbe, a resistance marker gene, an artificial regulatory element or an artificial regulatory element having a certain expression strength and a 40-to-3,000-base fragment homologous with the downstream sequence of an initiating codon in the gene to be regulated in the chromosome of the microbe; and transferring the DNA fragment into the body of a microbe through electrotransformation and replacing the original regulation region in the gene to be regulated in the chromosome of the microbe with the artificial regulatory library or an artificial regulatory element with specific expression strength.

Description

Utilize the method for genetic expression intensity on artificial regulatory element and the library regulating and controlling microbial karyomit(e) thereof

Technical field

The present invention relates to utilize the method for genetic expression intensity on artificial regulatory element and the library regulating and controlling microbial karyomit(e) thereof.

Background technology

The gene expression regulation technology is one of core technology of metabolic engineering.At present when transforming microorganism raising target product synthesis capability, a kind of strategy commonly used is by the method that plasmid is crossed expression expression of gene to be regulated and control, improve the activity of certain or certain several key enzymes, thereby strengthen the metabolic flux of the synthetic target product of microorganism.When plasmid was crossed expression, normally used all was the expression that inducible promoter (as promotors such as lac, trc, ara) comes regulatory gene.Yet this method has three big drawbacks.The first, owing to need the inductor of costlinesses such as interpolation lactose, IPTG, pectinose to induce the expression of these promotors, using these inducible promoters when the production bulk chemical is infeasible economically.The second, based on the expression of plasmid a lot of drawbacks are arranged: keeping of plasmid can cause very big metabolism load, the plasmid of especially high copy to host cell; The genetic stability of a lot of plasmids is bad; Therefore have only duplicating of low copy number plasmid to carry out synchronously, also have only the copy number that they are consistent in all cells with the breeding of cell; Therefore the synthetic pathways metabolism that need construct a complexity in cell of a lot of compounds needs to introduce the length dna fragment that comprises a plurality of genes, and all difficult length dna fragment of carrying of most of plasmid.The 3rd, for the metabolism stream that makes the synthetic target product of microorganism reaches maximum, accurately each expression of gene intensity in the control route of synthesis makes them reach the state of coordinate expression.Present its intensity of widely used inducible promoter all is fixed, can not satisfy the demand of accuracy controlling genetic expression intensity.Therefore, a series of controlling elements with different expression intensities of necessary acquisition can carry out accuracy controlling to expression of gene.

Have the artificial regulatory element of different expression intensities by use, directly on karyomit(e), expression of gene is carried out accuracy controlling, can solve above-mentioned plasmid well and cross the problem that expression brings.Prokaryotic organism are mainly controlled genetic expression at transcriptional level, so promotor is topmost controlling element.In the last few years, the technology that scientists is developed multiple structure constitutive promoter library come to genetic expression regulate and control (Jenson, 1998, WO 98/07846; The letter of Peter Shandong Dell is gloomy, and 1999, CN 1233287A; Alper et al., 2005, PNAS, 102:12678-12683; Hartner et al., 2008, Nucleic Acids Res, 36:e76; Rud et al., 2006, Microbiology, 152:1011-1019; Meynial-Salles et al., 2005, Appl EnvironMicrobiol, 71:2140-2144).A kind of technology be by the intervening sequence of transforming promotor-10 and-35 zones control promotor power (Jenson, 1998, WO 98/07846; The letter of Peter Shandong Dell is gloomy, and 1999, CN 1233287A); Another kind of technology be by use fallibility PCR (error-prone PCR) technology on original promoter sequence, cause random mutation (Alper et al., 2005, PNAS, 102:12678-12683).These two kinds of technology all can obtain one group of very big promoter library of genetic expression strength difference, and these promotors can be transferred on the karyomit(e) from plasmid subsequently, thereby are implemented on the karyomit(e) regulation and control to genetic expression.The another kind of method that makes up promoter library is to utilize the chromosomal dna fragment of cutting at random.Ingram research group utilizes the Sau3AI endonuclease bamhi of zymomonas mobilis chromosomal DNA to make up promoter library, be used for screening promotor in the fine expression of klebsiella energy Erwinia endoglucanase, thereby improving cell factory is alcoholic acid ability (Zhou et al. with cellulose conversion, 2001, Appl Environ Microbiol, 67:6-14).

Expression of gene intensity also is subjected to the influence of promotor upstream sequence, messenger RNA(mRNA) stable region sequence and ribosome bind site sequence except being subjected to the regulation and control of promotor.At present, also fewer about the report that makes up promotor upstream, messenger RNA(mRNA) stable region and ribosome bind site controlling element.

Summary of the invention

An object of the present invention is to provide a kind of method of utilizing genetic expression intensity on the regulating and controlling microbial karyomit(e) of artificial regulatory element library.

The method of utilizing genetic expression intensity on the regulating and controlling microbial karyomit(e) of artificial regulatory element library provided by the present invention may further comprise the steps:

The original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with artificial regulatory element library.

Treat on the described microbial staining body that regulatory gene is the native gene and the foreign gene that is incorporated on the microbial staining body on the microbial staining body.

Described artificial regulatory element library is one or more in the library, messenger RNA(mRNA) stable region, ribosome bind site library, promotor upstream library between promoter library, promotor and the ribosome bind site.

Described promoter library is one section and contains the dna sequence dna of base at random, it comprise one contain 6 particular bases or 6 at random the promotor of base-35 nucleus, one contain 6 particular bases or 6 at random the promotor of base-10 nucleus, one contain 10-20 particular bases or 10-20 between-35 and-10 nucleuses the region intermediate, promotor upstream that contains particular bases, one of base contain the messenger RNA(mRNA) stable region of particular bases, a ribosome bind site that contains particular bases at random.

Library, described messenger RNA(mRNA) stable region is one section and contains the dna sequence dna of base at random, and it comprises that a promotor upstream that contains particular bases, promotor that contains particular bases, one contain 5-50 messenger RNA(mRNA) stable region, a ribosome bind site that contains particular bases of base at random between promotor and ribosome bind site.

Described ribosome bind site library is one section and contains the dna sequence dna of base at random, and it comprises that a promotor upstream that contains particular bases, promotor that contains particular bases, one contain the messenger RNA(mRNA) stable region of particular bases, one and contain 6-20 the ribosome bind site of base at random.

Described promotor upstream library is one section and contains the dna sequence dna of base at random, and it comprises containing 5-1000 the zone, promotor that contains particular bases, one of base contain the messenger RNA(mRNA) stable region of particular bases, a ribosome bind site that contains particular bases at random in promotor-35 nucleus upstream.

The sequence of described promoter library is sequence 1 and the sequence 2 in the sequence table.

The sequence in library, described messenger RNA(mRNA) stable region is the sequence 9 in the sequence table.

The sequence in described ribosome bind site library is the sequence 18 in the sequence table.

The sequence in described promotor upstream library is the sequence 17 in the sequence table.

Described the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with artificial regulatory element library, further comprising the steps of:

Method by PCR amplifies the section of DNA fragment, it comprise with the microbial staining body on treat one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contain the fragment (as left homology arm) of 40-3000 base, resistant maker gene, artificial regulatory element library, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Use the method for homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with resistant maker gene and artificial regulatory element library.

Described resistant maker gene is that ampicillin resistance gene, card are received in mycin resistant gene, chloramphenicol resistance gene, tetracycline resistance gene, the apramycin resistant gene one or more.

Described microorganism is colon bacillus (Escherichia coli).

Treat on the described microbial staining body that regulatory gene is beta-galactosidase gene (lacZ), the 1-deoxidation-xylulose 5-phosphate synthase gene (dxs) of colon bacillus.

Another object of the present invention provides a kind of construction process of artificial regulatory element.

The construction process of artificial regulatory element provided by the present invention may further comprise the steps:

The original regulation and control zone of marker gene on the microbial staining body is replaced with artificial regulatory element library, obtain a series of artificial regulatory elements with different regulation and control intensity.By measuring the activity of this marker gene proteins encoded, determine the intensity of each artificial regulatory element.

Marker gene is the native gene and the foreign gene that is incorporated on the microbial staining body on the microbial staining body on the described microbial staining body.

Described microorganism is colon bacillus (Escherichia coli).

Marker gene is the beta-galactosidase gene (lacZ) of colon bacillus on the described microbial staining body.

Another purpose of the present invention provides the method for genetic expression intensity on the artificial regulatory element regulating and controlling microbial karyomit(e) that a kind of utilization has certain strength.

Utilization provided by the invention has the method for genetic expression intensity on the artificial regulatory element regulating and controlling microbial karyomit(e) of certain strength, may further comprise the steps:

The original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element.

Treat on the described microbial staining body that regulatory gene is the native gene and the foreign gene that is incorporated on the microbial staining body on the microbial staining body.

Described artificial regulatory element is one section dna sequence dna that contains particular bases, and it has specific expression intensity, comprises promotor upstream, promotor, messenger RNA(mRNA) stable region and ribosome bind site.

The sequence of described artificial regulatory element is sequence 3, sequence 4, sequence 5, sequence 6, sequence 7, sequence 8, sequence 10, sequence 11, sequence 12, sequence 13, sequence 14, sequence 15, sequence 16, the sequence 19 in the sequence table.

Described the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element with particular expression intensity, may further comprise the steps:

Method by PCR amplifies the section of DNA fragment, it comprise with the microbial staining body on treat artificial regulatory element that one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contains the fragment (as left homology arm) of 40-3000 base, resistant maker gene, one and have particular expression intensity, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Use the method for a step homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with resistant maker gene and the artificial regulatory element with particular expression intensity.

Described resistant maker gene is that ampicillin resistance gene, card are received in mycin resistant gene, chloramphenicol resistance gene, tetracycline resistance gene, the apramycin resistant gene one or more.

Described the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element with particular expression intensity, further comprising the steps of:

Use the method for two step homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element with particular expression intensity.At first the method by PCR amplifies the first segment DNA fragment, it comprise with the microbial staining body on treat one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contain the fragment (as left homology arm) of 40-3000 base, resistant maker gene, Polylevulosan sucrose transferase gene, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Carry out the first step homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with resistant maker gene and Polylevulosan sucrose transferase gene.Method by PCR amplifies the second segment DNA fragment, it comprise with the microbial staining body on treat one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contain the fragment (as left homology arm) of 40-3000 base, artificial regulatory element with particular expression intensity, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Carry out the second step homologous recombination, resistant maker gene and Polylevulosan sucrose transferase gene are replaced with the artificial regulatory element with particular expression intensity.

Described resistant maker gene is that ampicillin resistance gene, card are received in mycin resistant gene, chloramphenicol resistance gene, tetracycline resistance gene, the apramycin resistant gene one or more.

Described microorganism is colon bacillus (Escherichia coli).

Treat on the described microbial staining body that regulatory gene is the 1-deoxidation-xylulose 5-phosphate synthase gene (dxs) of colon bacillus, 1-deoxidation-xylulose 5-phosphate reduction isomerase gene (dxr), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol synthase gene (ispD), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol kinase gene (ispE), (E)-4-hydroxy-3-methyl-crotyl-pyrophosphate synthetase gene (ispG), (E)-4-hydroxy-3-methyl-crotyl-tetra-sodium reductase gene (ispH), isovaleryl tetra-sodium isomerase gene (idi), method Buddhist nun's diphosphate synthase gene (ispA); Yak base yak base bisphosphate (GGPP) synthase gene (crtE) of pantoea agglomerans (Pantoea agglomerans), β-Hu Luobusu cyclase gene (crtX), lycopene beta cyclase gene (crtY), phytoene desaturase gene (crtI), phytoene synthase gene (crtB).

Description of drawings

Fig. 1 is the synoptic diagram that colon bacillus promoter library 1 (P-Lib1) makes up.

Fig. 2 is that the enzyme of the beta-galactosidase enzymes of 40 recons in the colon bacillus promoter library 1 (P-Lib1) is lived.Shown enzyme work is and colon bacillus ATCC 8739 relative value that the beta-galactosidase enzymes enzyme is lived after IPTG induces.

Fig. 3 is the synoptic diagram that colon bacillus promoter library 2 (P-Lib2) makes up.

Fig. 4 is that the enzyme of the beta-galactosidase enzymes of 157 recons in the colon bacillus promoter library 2 (P-Lib2) is lived.Shown enzyme work is and colon bacillus ATCC 8739 relative value that the beta-galactosidase enzymes enzyme is lived after IPTG induces.

Fig. 5 is the synoptic diagram that library, colon bacillus messenger RNA(mRNA) stable region 1 (M-Lib1) makes up.

Fig. 6 is that the enzyme of the beta-galactosidase enzymes of 175 recons in the library, colon bacillus messenger RNA(mRNA) stable region 1 (M-Lib1) is lived.Shown enzyme work is and colon bacillus ATCC 8739 relative value that the beta-galactosidase enzymes enzyme is lived after IPTG induces.

Fig. 7 is the synoptic diagram that colon bacillus promotor upstream library 1 (U-Lib1) makes up.

Fig. 8 is that the enzyme of the beta-galactosidase enzymes of 100 recons among 1 (U-Lib1) of colon bacillus promotor upstream library is lived.Shown enzyme work is and colon bacillus ATCC 8739 relative value that the beta-galactosidase enzymes enzyme is lived after IPTG induces.

Fig. 9 is the synoptic diagram that colon bacillus ribosome bind site library 1 (R-Lib1) makes up.

Figure 10 is that the enzyme of the beta-galactosidase enzymes of 134 recons in the colon bacillus ribosome bind site library 1 (R-Lib1) is lived.Shown enzyme work is and colon bacillus ATCC 8739 relative value that the beta-galactosidase enzymes enzyme is lived after IPTG induces.

Figure 11 is the enzyme work of 7 recons in the library, messenger RNA(mRNA) stable region 1 (M-Lib1) and colon bacillus ATCC 8739 beta-galactosidase enzymes under different culture condition through IPTG induces after.Shown enzyme work is and colon bacillus ATCC 8739 relative value that the beta-galactosidase enzymes enzyme is lived after IPTG induces.

Figure 12 goes on foot the synoptic diagram that homologous recombination method is regulated and control the genetic expression on the colon bacillus karyomit(e) for end user's wage adjustment control elements and.

Figure 13 is the synoptic diagram of pTrc99A-M plasmid construction.

Figure 14 is the synoptic diagram of pACYC184-M plasmid construction.

Figure 15 is the synoptic diagram of pTrc99A-M-crt plasmid construction.

Figure 16 is the synoptic diagram of pACYC184-M-crt plasmid construction.

Figure 17 is end user's wage adjustment control elements M1-12, M1-64, M1-30, M1-46, M1-37, the M1-93 dxs to colon bacillus MG1655, dxr, ispD, ispE, ispG, ispH, idi, after the ispA expression of gene is regulated and control, the variation of β-Hu Luobusu output.Shown β-Hu Luobusu output is and colon bacillus MG1655 β-Hu Luobusu relative value of outcome.

Figure 18 goes on foot the synoptic diagram that homologous recombination methods are regulated and control the genetic expression on the colon bacillus karyomit(e) for end user's wage adjustment control elements and two.A is a first step homologous recombination, and B is the second step homologous recombination.

Figure 19 is the synoptic diagram of pXZ001, pXZ002, pXZ003-crt plasmid construction.

Figure 20 is after end user's wage adjustment control elements M1-64, M1-46, M1-37, M1-93 regulate and control the crt genetic expression of colon bacillus QL002, the variation of β-Hu Luobusu output.β-Hu Luobusu output is the relative value with QL002.

The synoptic diagram that Figure 21 regulates and control the dxs genetic expression of colon bacillus crt-M1-93-FRT for end user's wage adjustment control elements library.

Figure 22 is after end user's wage adjustment control elements library is regulated and control the dxs genetic expression of colon bacillus crt-M1-93-FRT, the variation of the β-Hu Luobusu output of 17 recons of random choose.β-Hu Luobusu output is the relative value with crt-M1-93-FRT.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

The structure of embodiment 1, colon bacillus promoter library 1 (P-Lib1)

The strategy that colon bacillus promoter library 1 (P-Lib1) makes up is that (public can obtain from Tianjin Institute of Industrial Biotechnology with colon bacillus ATCC 8739 by the Red homologous recombination technique, the non-patent literature of putting down in writing colon bacillus ATCC 8739 is Zhang, X., K.T.Shanmugam, L.O.Ingram.2010.Fermentation of glycerol tosuccinate by metabolically engineered strains of Escherichia coli.Appl Environ Microbiol, 76:2397-2401) promotor of the beta-galactosidase enzymes on the karyomit(e) (lacZ) gene replaces with manual activation sublibrary 1 (P-Lib1) (Fig. 1), determines the intensity of each promotor again by the enzyme work of measuring beta-galactosidase enzymes.

Based on the PL promoter sequence of phage (Love et al., 1996, Gene 176:49-53) has designed promoter library 1 (P-Lib1), sequence is a sequence 1 in the sequence table.It is characterized by: be 17 bases at random between promotor-35 and-10 nucleuses; 6 bases of 15 bases in upstream ,-35 district and downstream ,-10 district are identical with the PL promoter sequence.

Obtain being used for the dna fragmentation II of homologous recombination by the amplification of two-step pcr method.(public can obtain from Tianjin Institute of Industrial Biotechnology with the pKD4 plasmid, the non-patent literature of putting down in writing the pKD4 plasmid is Datsenko, K.A., and B.L.Wanner.2000.One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.Proc Natl Acad Sci USA, 97:6640-6645.) DNA be template, use primer lacI-FRT and PL1-FRT to amplify dna fragmentation I.Primer sequence is:

lacI-FRT：GCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGTAGGCTGGAGCTGCTTC，

PL1-FRT：TCCTGCTGATGTGCTCAGTATC(N?17)TGTCAACACCGCCAGAGATAACATATGAATATCCTC。

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 59 ℃ annealing of 98 ℃ of sex change are extended 1 minute 30 seconds (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).

Be template then, use primer lacI-FRT and lacZ-R to amplify dna fragmentation II with dna fragmentation I.Primer sequence is:

lacZ-R：ACGACGGCCAGTGAATCCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAGGTCAGTGCGTCCTGCTGATGTGCT。

Dna fragmentation II comprise 50 bases (up50), the FRT-Km-FRT fragment of lacI upstream region of gene, the messenger RNA(mRNA) stable region of P-Lib1, PL (message-RNA stabilizing, m-L), the ribosome bind site (RBS) of lacZ gene, 32 bases behind the lacZ gene start codon (lacZ ') (Fig. 1).

By the Red homologous recombination technique promotor of beta-galactosidase enzymes (lacZ) gene on colon bacillus ATCC 8739 karyomit(e)s is replaced with P-Lib1.Wherein, the upstream region of lacI gene (50 bases in upstream, with respect to initiator codon-zone of 50-0) in homologous recombination, be used as left homology arm; The ribosome bind site of lacZ gene and part lacZ gene (RBS::lacZ ', with respect to initiator codon-zone of 18-+32) in homologous recombination, be used as right homology arm (Fig. 1).At first (public can obtain from Tianjin Institute of Industrial Biotechnology with the pKD46 plasmid, the non-patent literature of putting down in writing the pKD46 plasmid is Datsenko, K.A., and B.L.Wanner.2000.One-step inactivation of chromosomal genes inEscherichia coli K-12 using PCR products.Proc Natl Acad Sci USA 97:6640-6645) is converted into colon bacillus ATCC 8739 by calcium chloride transformation.Then dna fragmentation II electricity is gone to the colon bacillus ATCC 8739 that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus ATCC 8739 of pKD46 plasmid; The 50ul competent cell is placed on ice, add 200ng dna fragmentation II, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 commentaries on classics were hatched 2 hours for 37 ℃.Get 200ul bacterium liquid and be coated in respectively on the LB flat board that contains 5 kantlex, 39 ℃ of incubated overnight are removed the pKD46 plasmid.1000ul bacterium liquid has obtained 250 clones altogether, and recombination efficiency is 1250 recons/ug DNA.

Picked at random 40 recombinant bacterial strains (P1-1 is to P1-40), in the LB substratum, cultivated 4 hours, carry out the enzyme activity determination of beta-galactosidase enzymes.In addition, add (0.1mM) respectively and do not add IPTG, in the LB substratum, cultivate colon bacillus ATCC 8739, measure the enzyme of beta-galactosidase enzymes and live.The concrete steps of enzyme activity determination are as follows: the single bacterium colony incubated overnight on (1) picking flat board, ratio in 1/100 is seeded in the test tube that contains 3ml LB substratum, change for 37 ℃, 220 and cultivate about 4h, OD600 is about about 2.0, and control strain colon bacillus ATCC 8739 is being cultured to OD600 adding in about 0.3 o'clock IPTG (final concentration is 0.1mM).(2) get the bacterium liquid of 1ml, the centrifugal 1min of 12000rpm, with the resuspended thalline of Z-buffer of 1ml, after cleaning, centrifugal one minute of 12000rpm abandons supernatant liquor.And thalline is resuspended among the Z-buffer.(3) use spectrophotometer, under the light absorption value of 420nm, adjust the OD420 to 1.0 of thalline.(4) getting 1ml OD420 is 1.0 bacterium liquid, adds 2 chloroforms and 1 SDS (0.1%), and vibration is 10 seconds on the vortex oscillation device.(5) get cell bacterium liquid 100ul after the above-mentioned fragmentation, add the Z-buffer of 900ul, and place 28 ℃ water-bath preheating 2min, contrast is set simultaneously.(6) ONPG (O-nitrophenyl-beta-D-galactopyranoside) of 200ul will be added in the above-mentioned system, mixing is placed in the water-bath, pick up counting, occurring in reaction system can detected yellow, adds 500ul yellow soda ash (1M) termination reaction and also stops timing.(7) reaction system is shifted out water-bath, add the pure water of 1.3ml in each system after, centrifugally thalline is removed the light absorption value of o-nitrophenol in 420nm place mensuration system.(8) condition is calculated in enzyme work: when light absorption value OD420=1, be equivalent to contain 5x10 in every milliliter of bacterium liquid ⁸Individual cell; 10 ⁹Individual cell contains the albumen of 150ug; At the 420nm place, the light absorption value that 1nmol/ml o-nitrophenol has is 0.0045.Formula: OD420X3ml/ (0.0045X75ugX0.001XT) is calculated in enzyme work, and T is the reaction times.

When inducing without IPTG, the beta-galactosidase enzymes enzyme of colon bacillus ATCC 8739 is lived and is 0.02U/mg albumen.Colon bacillus ATCC 8739 lives through the beta-galactosidase enzymes enzyme after inducing and is 1.9U/mg albumen.The work of the beta-galactosidase enzymes enzyme of 40 of random choose recombinant bacterial strains is 0.05-0.7 times (Fig. 2) after colon bacillus ATCC 8739 induces in the P-Lib1 library.

The structure of embodiment 2, colon bacillus promoter library 2 (P-Lib2)

In order to improve the efficient of homologous recombination, enlarge the storage capacity of promoter library, made up the promoter library 2 (P-Lib2) of colon bacillus.When making up P-Lib2, with the length of left homology arm by 50 bases extend to 500 bases (500 bases of lacI upstream, with respect to the lacI initiator codon-zone of 500-0) (Fig. 3).

The sequence of P-Lib2 is a sequence 2 in the sequence table.It is characterized in that: 15 bases of promotor-35 core area and upstream ,-35 district are identical with P-Lib1;-10 core area sequences are changed into TATAAT; Between promotor-35 and-10 core areas 14 base and TGR at random.-10 core area downstream sequences are changed into 6 bases at random.

Obtain being used for the dna fragmentation IV (Fig. 3) of homologous recombination by the amplification of two-step pcr method.At first, be template with the genomic dna of the recombinant bacterial strain P1-1 among the P-Lib1, use primer lacI-up500 and pL-down-35 to amplify dna fragmentation III.Primer sequence is:

lacI-up500：CGGGCGACGTTTGCCGCTTCTGAAAACC，

pL-down-35：TGTCAACACCGCCAGAGA。

Then, be template with dna fragmentation III, use primer lacI-up500 and lacZ-PL-R2 to amplify dna fragmentation IV.Primer sequence is:

lacZ-pL-R2：AATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATT(N6)ATTATAYCA(N14)TGTCAACACCGCCAGAGA。

Dna fragmentation IV comprises 12 bases after messenger RNA(mRNA) stable region (mRS), ribosome bind site (RBS) and the initiator codon of 500 bases (up500), FRT-Km-FRT fragment, P-Lib2, lacZ gene of lacI upstream region of gene (lacZ ') (Fig. 3).

By the Red homologous recombination technique promotor of beta-galactosidase enzymes (lacZ) gene on colon bacillus ATCC 8739 karyomit(e)s is replaced with P-Lib2.Wherein, the upstream region of lacI gene (500 bases in upstream, with respect to the lacI initiator codon-zone of 500-0) in homologous recombination, be used as left homology arm; The messenger RNA(mRNA) stable region of lacZ gene, ribosome bind site and part lacZ gene (mRS::RBS::lacZ ', with respect to initiator codon-zone of 38-+12) in homologous recombination, be used as right homology arm (Fig. 3).At first the pKD46 plasmid is converted into colon bacillus ATCC 8739 by calcium chloride transformation.Then dna fragmentation IV electricity is gone to the colon bacillus ATCC 8739 that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus ATCC 8739 of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ngDNA fragment IV, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with the 1mlLB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 commentaries on classics were hatched 2 hours for 37 ℃.Get 100ul bacterium liquid and be coated in respectively on the LB flat board that contains 10 kantlex, 39 ℃ of incubated overnight are removed the pKD46 plasmid.1000ul bacterium liquid has obtained 2500 clones altogether, and recombination efficiency is 12500 recons/ug DNA.

Picked at random 157 recombinant bacterial strains (P2-1 is to P2-157), in the LB substratum, cultivated 4 hours, carry out the enzyme activity determination of beta-galactosidase enzymes.In addition, measuring the beta-galactosidase enzymes enzyme of colon bacillus ATCC 8739 after IPTG induces lives.The beta-galactosidase enzymes enzyme work of 157 of random choose recombinant bacterial strains is evenly distributed in the P-Lib2 library, is the 0.2-3.3 of colon bacillus ATCC 8739 after inducing doubly (Fig. 4).Wherein, the activity of 64% recombinant bacterial strain will be higher than the activity after colon bacillus ATCC 8739 induces.

Promoter region to recombinant bacterial strain P2-53, P2-49, P2-33, P2-39, P2-30, P2-15 checks order, and sequencing primer is lacI-up500 and lacZ-373.Primer sequence is:

lacZ-373：AGTAACAACTCGTCGGATTCT。

The beta-galactosidase enzymes enzyme work of recombinant bacterial strain P2-53, P2-49, P2-33, P2-39, P2-30, P2-15 is respectively colon bacillus ATCC 8739 0.4,0.5,2.0,2.0,2.1,3.3 times after inducing.The artificial regulatory element sequences of recombinant bacterial strain P2-53 is a sequence 3 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain P2-49 is a sequence 4 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain P2-33 is a sequence 5 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain P2-39 is a sequence 6 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain P2-20 is a sequence 7 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain P2-15 is a sequence 8 in the sequence table.

The structure in embodiment 3, library, colon bacillus messenger RNA(mRNA) stable region 1 (M-Lib1)

In order to improve the stability of messenger RNA(mRNA) after the genetic transcription, between promotor and ribosome bind site, made up library, messenger RNA(mRNA) stable region (M-Lib1).

The sequence of M-Lib1 is a sequence 9 in the sequence table, it is characterized in that: the promotor P2-15 sequence that intensity is the highest among promoter sequence and the P-Lib2 is the same; The sequence of messenger RNA(mRNA) stable region is 18 base and PmeI restriction enzyme site sequences at random.

Obtain being used for the dna fragmentation VI (Fig. 5) of homologous recombination by the amplification of two-step pcr method.At first, be template with the genomic dna of recombinant bacterial strain P2-15, use primer lacI-up500 and pL-down-3 to amplify dna fragmentation V.Primer sequence is:

pL-down-3：GGCTCAATTATATCAACG。

Then, be template with dna fragmentation V, use primer lacI-up500 and lacZ-pL-R3C to amplify dna fragmentation VI.Primer sequence is:

lacZ-pL-R3C：TGTAAAACGACGGCCAGTGAATCCGTAATCATGGTCATAGCTGTTTCCTGGTTTAAAC(N18)GGCTCAATTATATCAACG。

Dna fragmentation VI comprises the ribosome bind site (RBS) of 500 bases (up500), FRT-Km-FRT fragment, P2-15, M-Lib1, lacZ gene of lacI upstream region of gene and 38 bases after the initiator codon (lacZ ') (Fig. 5).

By the Red homologous recombination technique promotor and the messenger RNA(mRNA) stable region of beta-galactosidase enzymes (lacZ) gene on colon bacillus ATCC 8739 karyomit(e)s replaced with P2-15 and M-Lib1.Wherein, the upstream region of lacI gene (500 bases in upstream, with respect to initiator codon-zone of 500-0) in homologous recombination, be used as left homology arm; The ribosome bind site of lacZ gene and part lacZ gene (RBS::lacZ ', with respect to initiator codon-zone of 12-+38) in homologous recombination, be used as right homology arm (Fig. 5).At first the pKD46 plasmid is converted into colon bacillus ATCC 8739 by calcium chloride transformation.Then dna fragmentation VI electricity is gone to the colon bacillus ATCC 8739 that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus ATCC 8739 of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ngDNA fragment VI, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with the 1mlLB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 commentaries on classics were hatched 2 hours for 37 ℃.Get 100ul bacterium liquid and be coated in respectively on the LB flat board that contains 10 kantlex, 39 ℃ of incubated overnight are removed the pKD46 plasmid.1000ul bacterium liquid has obtained 4000 clones altogether, and recombination efficiency is 20000 recons/ug DNA.

Picked at random 175 recombinant bacterial strains (M1-1 is to M1-175), in the LB substratum, cultivated 4 hours, carry out the enzyme activity determination of beta-galactosidase enzymes.In addition, measuring the beta-galactosidase enzymes enzyme of colon bacillus ATCC 8739 after IPTG induces lives.The beta-galactosidase enzymes enzyme work of 175 of random choose recombinant bacterial strains is evenly distributed in the M-Lib1 library, is the 0.03-7 of colon bacillus ATCC 8739 after inducing doubly (Fig. 6).

Artificial regulatory element to recombinant bacterial strain M1-12, M1-64, M1-30, M1-46, M1-37, M1-162, M1-93 checks order, and sequencing primer is lacI-up500 and lacZ-373.

The beta-galactosidase enzymes enzyme work of recombinant bacterial strain M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, M1-162 is respectively colon bacillus ATCC 8739 0.1,0.4,0.8,1.7,2.5,5,4.9 times after inducing.The artificial regulatory element sequences of recombinant bacterial strain M1-12 is a sequence 10 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain M1-64 is a sequence 11 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain M1-30 is a sequence 12 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain M1-46 is a sequence 13 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain M1-37 is a sequence 14 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain M1-93 is a sequence 15 in the sequence table; The artificial regulatory element sequences of recombinant bacterial strain M1-162 is a sequence 16 in the sequence table.

The structure in embodiment 4, colon bacillus promotor upstream library 1 (U-Lib1)

In order further to improve genetic expression intensity, made up promotor upstream library (U-Lib1) in the upstream of promotor.The sequence of U-Lib1 is a sequence 17 in the sequence table, it is characterized by: U-Lib1 is positioned at promotor-35 core area upstream, totally 24 bases, and 9 bases at random wherein, all the other are the sequence that is rich in AT.

Obtain being used for the dna fragmentation VIII (Fig. 7) of homologous recombination by the amplification of two-step pcr method.Genomic dna with the recombinant bacterial strain M1-93 among the M-Lib1 is a template, uses primer lacI-up500 and pL-down-5 to amplify dna fragmentation VII.Primer sequence is:

pL-down5：CATATGAATATCCTCCTTAG

Then, be template with dna fragmentation VII, use primer lacI-up500 and pL-UP-1 to amplify dna fragmentation VIII.Primer sequence is:

pL-UP-1：CATGCTAACAATACGGGCTCAATTATATCAACGTTGTTATCTCTTGTCAANNNNTTTTNN?AAAAWAWWTT?TNNNCATATG?AATATCCTC。

Dna fragmentation VIII comprises the ribosome bind site (RBS) of 500 bases (up500), FRT-Km-FRT fragment, U-Lib1, P2-15, M-93, lacZ gene of lacI upstream region of gene and 38 bases after the initiator codon (lacZ ') (Fig. 7).

FRT-Km-FRT fragment on the colon bacillus M1-93 karyomit(e) is removed, obtained colon bacillus M1-93-FRT.Concrete steps are as follows: (public can obtain from Tianjin Institute of Industrial Biotechnology with plasmid pFT-A, the non-patent literature of putting down in writing the pFT-A plasmid is Datsenko, K.A., and B.L.Wanner.2000.One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.Proc Natl Acad Sci USA, 97:6640-6645.) transform in the M1-93 competent cell 30 ℃ of incubated overnight on LB Amp100 flat board; In the 250ml triangular flask, mono-clonal is inoculated in the 10ml LB Amp50 liquid nutrient medium, 150rpm, 30 ℃ are cultured to OD0.1; The Uromycin (chlorotetracyclin, 5mg/ml) final concentration 0.025mg/ml, the continued growth 6h that add 50ul; On the LB flat board, rule 39 ℃ of cultivations; The bacterial strain called after that resistance disappears: M1-93-FRT.

By adding U-Lib1 before the promotor P2-15 of beta-galactosidase enzymes (lacZ) gene of Red homologous recombination technique on colon bacillus M1-93-FRT karyomit(e).Wherein, the upstream region of lacI gene (500 bases in upstream, with respect to initiator codon-zone of 500-0) in homologous recombination, be used as left homology arm; Promotor and messenger RNA(mRNA) stable region (P2-15::M1-93, with respect to transcription initiation site-zone of 35-+15) in homologous recombination, be used as right homology arm (Fig. 7).At first the pKD46 plasmid is converted into colon bacillus M1-93-FRT by calcium chloride transformation.Then dna fragmentation VIII electricity is gone to the colon bacillus M1-93-FRT that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus M1-93-FRT of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ngDNA fragment VIII, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 commentaries on classics were hatched 2 hours for 37 ℃.Get 100ul bacterium liquid and be coated in respectively on the LB flat board that contains 10 kantlex, 39 ℃ of incubated overnight are removed the pKD46 plasmid.1000ul bacterium liquid has obtained 20000 clones altogether, and recombination efficiency is 100000 recons/ug DNA.

Picked at random 100 recombinant bacterial strains, in the LB substratum, cultivated 4 hours, carry out the enzyme activity determination of beta-galactosidase enzymes.In addition, measuring the beta-galactosidase enzymes enzyme of colon bacillus ATCC 8739 after IPTG induces lives.The beta-galactosidase enzymes enzyme work of 100 of random choose recombinant bacterial strains is evenly distributed in the U-Lib1 library, is the 1.0-5.0 of colon bacillus ATCC 8739 after inducing doubly (Fig. 8).

The structure in embodiment 5, colon bacillus ribosome bind site library 1 (R-Lib1)

The sequence of ribosome bind site library R-Lib1 is a sequence 18 in the sequence table.It is characterized by: the core area sequence of ribosome bind site is AGGAGR, at its upstream and downstream 1 and 6 base is at random arranged respectively.

Obtain being used for the dna fragmentation X (Fig. 9) of homologous recombination by the amplification of two-step pcr method.At first, be template with the genomic dna of recombinant bacterial strain P2-15, use primer lacI-up500 and pL-down4 to amplify dna fragmentation IX.Primer sequence is:

pL-down4：TGTGAAATTGTTATCCGC。

Then, be template with dna fragmentation IX, use primer lacI-up500 and lacZ-PL-R4 to amplify dna fragmentation X.Primer sequence is:

lacZ-PL-R4：CAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTAATCATGGTCAT(N6)CTCCTNTGTGAAATTGTTATCCGC。

MRS, R-Lib1,50 bases behind the lacZ gene start codon (lacZ ') that dna fragmentation X comprises 500 bases (up500), FRT-Km-FRT fragment, P2-15, the lacZ gene of lacI upstream region of gene are (Fig. 9).

By the Red homologous recombination technique ribosome bind site of beta-galactosidase enzymes (lacZ) gene on colon bacillus ATCC 8739 karyomit(e)s is replaced with R-Lib1.Wherein, the upstream region of lacI gene (500 bases in upstream, with respect to initiator codon-zone of 500-0) in homologous recombination, be used as left homology arm; Part lacZ gene (lacZ ', with respect to initiator codon+zone of 1-+50) in homologous recombination, be used as right homology arm (Fig. 9).At first the pKD46 plasmid is converted into colon bacillus ATCC 8739 by calcium chloride transformation.Then dna fragmentation X electricity is gone to the colon bacillus ATCC 8739 that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus ATCC 8739 of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ngDNA fragment X, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 commentaries on classics were hatched 2 hours for 37 ℃.Get 100ul bacterium liquid and be coated in respectively on the LB flat board that contains 10 kantlex, 39 ℃ of incubated overnight are removed the pKD46 plasmid.1000ul bacterium liquid has obtained 4000 clones altogether, and recombination efficiency is 20000 recons/ug DNA.

Picked at random 134 recombinant bacterial strains, in the LB substratum, cultivated 4 hours, carry out the enzyme activity determination of beta-galactosidase enzymes.In addition, measuring the beta-galactosidase enzymes enzyme of colon bacillus ATCC 8739 after IPTG induces lives.The beta-galactosidase enzymes enzyme work of 134 of random choose recombinant bacterial strains is evenly distributed in the R-Lib1 library, is the 0.005-5.3 of colon bacillus ATCC 8739 after inducing doubly (Figure 10).

Ribosome bind site district to recombinant bacterial strain R1-9 checks order, and sequencing primer is lacI-up500 and lacZ-373.The beta-galactosidase enzymes enzyme work of recombinant bacterial strain R1-9 is respectively colon bacillus ATCC 8739 3.5 times after inducing.The artificial regulatory element sequences of recombinant bacterial strain R1-9 is a sequence 19 in the sequence table.

Case study on implementation 6, the strength detection of artificial regulatory element under different culture condition

Choose recombinant bacterial strain M1-12, M1-64 in the library, messenger RNA(mRNA) stable region 1 (M-Lib1), M1-30, M1-46, M1-37, M1-93, M1-162 (work of beta-galactosidase enzymes enzyme is respectively colon bacillus ATCC 8739 0.1,0.4,0.8,1.7,2.5,5.0,4.9 times after inducing) and in LB substratum, LB+5% glucose and AM1+5% glucose, cultivated 4 hours respectively, carry out the enzyme activity determination of beta-galactosidase enzymes.In addition, measuring the beta-galactosidase enzymes enzyme of colon bacillus ATCC 8739 after IPTG induces lives.

Under LB+5% glucose culture condition, the intensity of most people's wage adjustment control elements and LB culture condition be (80%-108%) quite.Having only the intensity of two controlling elements that obvious reduction: M1-46 is arranged is 53% of LB culture condition, and M1-12 is 60% of a LB culture condition.Under AM1+5% glucose culture condition, the intensity of most people's wage adjustment control elements and LB culture condition be (76%-112%) quite.Having only the intensity of this controlling element of M1-162 that obvious reduction is arranged, is 69% (Figure 11) of LB culture condition.These results show that the strength ratio of artificial regulatory element under different culture condition that we make up is consistent, belongs to constitutive expression.

Case study on implementation 7, end user's wage adjustment control elements and a step homologous recombination method are regulated and control the genetic expression on the colon bacillus karyomit(e)

By a pair of general primer, adopt a step homologous recombination method the original regulation and control zone of gene on the colon bacillus karyomit(e) can be replaced with the artificial regulatory element (Figure 12) with various intensity.The implementation case is with the 1-deoxidation in the colon bacillus terpene compound route of synthesis-xylulose 5-phosphate synthase gene (dxs), 1-deoxidation-xylulose 5-phosphate reduction isomerase gene (dxr), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol synthase gene (ispD), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol kinase gene (ispE), (E)-4-hydroxy-3-methyl-crotyl-pyrophosphate synthetase gene (ispG), (E)-4-hydroxy-3-methyl-crotyl-tetra-sodium reductase gene (ispH), isovaleryl tetra-sodium isomerase gene (idi), the original regulation and control zone of method Buddhist nun's diphosphate synthase gene (ispA) replaces with M1-12, M1-64, M1-30, M1-46, M1-37, these six kinds of artificial regulatory elements of M1-93, studying it influences the β-Hu Luobusu synthetic.

Upstream primer is gene-up-FRT, comprise treat extra-regional 50 bases of the original regulation and control of regulatory gene and with 20 bases of FRT sequence homology.Downstream primer is gene-RBS-down, comprises with 15 bases of ribosome bind site homologous of colon bacillus lacZ gene and 50 bases after treating the regulatory gene initiator codon.

For the dxs gene, use dxs-up-FRT and dxs-RBS-down primer, be template with the recombinant bacterial strain M1-93 in the library, messenger RNA(mRNA) stable region 1 (M-Lib1), amplify dna fragmentation dxs-M1-93, be used for homologous recombination (Figure 12).Primer sequence is:

dxs-up-FRT：ACTACATCATCCAGCGTAATAAATAAACAATAAGT

ATTAATAGGCCCCTG GTGTAGGCTGGAGCTGCTTC

dxs-RBS-down：GTGGAGTCGA?CCAGTGCCAG?GGTCGGGTAT?TTGGCAATATCAAAACTCAT? AGCTGTTTCC?TGGTT

(public can obtain from Tianjin Institute of Industrial Biotechnology with colon bacillus MG1655 by the Red homologous recombination technique, the non-patent literature of putting down in writing colon bacillus K-12MG1655 is Blattner et al., 1997, The Complete Genome Sequence of Escherichia coli K-12Science, 277:1453-1462.) the original regulation and control zone of the dxs gene on the karyomit(e) replaces with M1-93.At first the pKD46 plasmid is converted into colon bacillus MG1655 by calcium chloride transformation.Then dna fragmentation dxs-M1-93 electricity is gone to the colon bacillus MG1655 that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus MG1655 of pKD46 plasmid; The 50ul competent cell is placed on ice, add the 50ngDNA fragment, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 commentaries on classics were hatched 2 hours for 37 ℃.Get 100ul bacterium liquid and be coated in respectively on the LB flat board that contains kantlex, 39 ℃ of incubated overnight are removed the pKD46 plasmid.Obtain recombinant bacterial strain dxs-M1-93-FKF.

Adopt and use the same method, use dxs-up-FRT and dxs-RBS-down primer, with recombinant bacterial strain M1-12, M1-64 in the library, messenger RNA(mRNA) stable region 1 (M-Lib1), M1-30, M1-46, M1-37 is template, obtain recombinant bacterial strain dxs-M1-12-FKF, dxs-M1-64-FKF, dxs-M1-30-FKF, dxs-M1-46-FKF, dxs-M1-37-FKF after amplifying dna fragmentation dxs-M1-12, dxs-M1-64, dxs-M1-30, dxs-M1-46, dxs-M1-37 and colon bacillus MG1655 homologous recombination.

Adopt and use the same method, use dxr-up-FRT and dxr-RBS-down primer, the original regulation and control zone of dxr gene is replaced with M1-12, M1-64, M1-30, M1-46, these six kinds of artificial regulatory elements of M1-37, M1-93, obtain recombinant bacterial strain dxr-M1-64-FKF, dxr-M1-12-FKF, dxr-M1-30-FKF, dxr-M1-46-FKF, dxr-M1-37-FKF, dxr-M1-93-FKF.Primer sequence is:

dxr-up-FRT：ATCGGCTGGCGGCGTTTTGCTTTTTATTCTGTCTCAACTCTGGATGTTTC GTGTAGGCTG GAGCTGCTTC

dxr-RBS-down：GTGCTGCAAC CAATCGAGCC GGTCGAGCCC AGAATGGTGAGTTGCTTCAT? AGCTGTTTCCTGGTT

Adopt and use the same method, use ispD-up-FRT and ispD-RBS-down primer, the original regulation and control zone of ispD gene is replaced with M1-12, M1-64, M1-30, M1-46, these six kinds of artificial regulatory elements of M1-37, M1-93, obtain recombinant bacterial strain ispD-M1-12-FKF, ispD-M1-64-FKF, ispD-M1-30-FKF, ispD-M1-46-FKF, ispD-M1-37-FKF, ispD-M1-93-FKF.Primer sequence is:

ispD-up-FRT：TGCCTGACGCGTCGAAGCGCGCACAGTCTGCGGGGC

AAAACAATCGATAA? GTGTAGGCTGGAGCTGCTTC

ispD-RBS-down：AATCCGGCCG?CCGGAACCAC GGCGCAAACA?TCCAAATGAGTGGTTGCCAT? AGCTGTTTCC?TGGTT

Adopt and use the same method, use ispE-up-FRT and ispE-RBS-down primer, the original regulation and control zone of ispE gene is replaced with M1-12, M1-64, M1-30, M1-46, these six kinds of artificial regulatory elements of M1-37, M1-93, obtain recombinant bacterial strain ispE-M1-12-FKF, ispE-M1-64-FKF, ispE-M1-30-FKF, ispE-M1-46-FKF, ispE-M1-37-FKF, ispE-M1-93-FKF.Primer sequence is:

ispE-up-FRT：ACGGTGGTCAACGCATCAAGTTAAAAATGGATAACT

GGATAGTGAAATAA? GTGTAGGCTGGAGCTGCTTC

ispE-RBS-down：ATGTATAAAA ACAGATTAAG TTTTGCCGGA GAGGGCCACTGTGTCCGCAT? AGCTGTTTCC?TGGTT

Adopt and use the same method, use ispG-up-FRT and ispG-RBS-down primer, the original regulation and control zone of ispG gene is replaced with M1-12, M1-64, M1-30, M1-46, this six all artificial regulatory element of M1-37, M1-93, obtain recombinant bacterial strain ispG-M1-12-FKF, ispG-M1-64-FKF, ispG-M1-30-FKF, ispG-M1-46-FKF, ispG-M1-37-FKF, ispG-M1-93-FKF.Primer sequence is:

ispG-up-FRT：GCCGAACAATCACCGGCGCAGTAACAGACGGGTAACGCGGG?AGATTTTTC GTGTAGGCTGGAGCTGCTTC

ispG-RBS-down：ACGTAAATAC GTGTTGATTT TCTACGTTGA ATTGGAGCCTGGTTATGCAT? AGCTGTTTCC?TGGTT

Adopt and use the same method, use ispH-up-FRT and ispH-RBS-down primer, the original regulation and control zone of ispH gene is replaced with M1-12, M1-64, M1-30, M1-46, these six kinds of artificial regulatory elements of M1-37, M1-93, obtain recombinant bacterial strain ispH-M1-12-FKF, ispH-M1-64-FKF, ispH-M1-30-FKF, ispH-M1-46-FKF, ispH-M1-37-FKF, ispH-M1-93-FKF.Primer sequence is:

ispH-up-FRT：TCATTTTGATATTGAAGTGCTGGAAATCGATCCGGC

ACTGGAGGCGTAAC? GTGTAGGCTGGAGCTGCTTC

ispH-RBS-down：CGGTCTACCC CGGCACAAAA ACCACGCGGG TTGGCCAACAGGATCTGCAT AGCTGTTTCC?TGGTT

Adopt and use the same method, use idi-up-FRT and idi-RBS-down primer, the original regulation and control zone of idi gene is replaced with M1-12, M1-64, M1-30, M1-46, these six kinds of artificial regulatory elements of M1-37, M1-93, obtain recombinant bacterial strain idi-M1-12-FKF, idi-M1-64-FKF, idi-M1-30-FKF, idi-M1-46-FKF, idi-M1-37-FKF, idi-M1-93-FKF.Primer sequence is:

idi-up-FRT：TCACTTGGTTAATCATTTCACTCTTCAATTATCT

ATAATGATGAGTGATC? GTGTAGGCTGGAGCTGCTTC

idi-RBS-down：CCCGTGGGAA CTCCCTGTGC ATTCAATAAA ATGACGTGTTCCGTTTGCAT? AGCTGTTTCC?TGGTT

Adopt and use the same method, use ispA-up-FRT and ispA-RBS-down primer, the original regulation and control zone of ispA gene is replaced with M1-12, M1-64, M1-30, M1-46, this six all artificial regulatory element of M1-37, M1-93, obtain recombinant bacterial strain ispA-M1-64-FKF, ispA-M1-12-FKF, ispA-M1-30-FKF, ispA-M1-46-FKF, ispA-M1-37-FKF, ispA-M1-93-FKF.Primer sequence is:

ispA-up-FRT：CTGACAATGAAGACGCCTCTCTAACCCCTTTTACACCGGACAATGAGT?AA GTGTAGGCTGGAGCTGCTTC

ispA-RBS-down：GCCTGGTTGGCCTGCTTAACGCAGGCTTCGAGTTGCTGCGGAAAGTCCAT AGCTGTTTCCTGGTT

In order to verify dxs, dxr, ispD, ispE, isp G, ispH, idi, to β-Hu Luobusu synthetic influence, the β-Hu Luobusu route of synthesis is incorporated in the recombinant bacterial strain after the MG1655 regulation and control behind the ispA gene expression regulation, measures the variation of β-Hu Luobusu synthesis capability.

At first with the gene clone of β-Hu Luobusu route of synthesis in pTrc99A-M and pACYC184-M plasmid.The structure of pTrc99A-M plasmid is as shown in figure 13: (public can obtain from Tianjin Institute of Industrial Biotechnology at the pTrc99A plasmid by PCR method, the non-patent literature of putting down in writing the pTrc99A plasmid is Amann E, Ochs B, Abel KJ.Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli.Gene.1988,69 (2): PacI is introduced in the lacI gene front 301-15.), SpeI and NdeI restriction enzyme site, back at rrnB T2 transcription terminator adds the PacI restriction enzyme site, and concrete steps are as follows:

With primer 99A-F1-PacI-SpeI-NdeI and 99A-R1-PacI is primer, and pTrc99A is that template is carried out pcr amplification, obtains fragment I, is primer with 99A-F2/99A-R2, and pTrc99A is that template is carried out pcr amplification, obtains fragment II.Primer sequence is:

99A-F1-PacI-SpeI-NdeI：TTAATTAACTAGTCATATG?GGCATGCATTTACGTTGACA

99A-R1-PacI：TTAATTAA?AGAAACGCAAAAAGGCCATC

99A-F2：CATTCAAATATGTATCCGCTCA

99A-R2：CGCAGGAAAGAACATGTGAG

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is: 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 58 ℃ annealing of 98 ℃ of sex change are extended 40sec (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).Amplified production fragment I comprises lacI gene, lacIq fragment, multiple clone site and the rrnB terminator codon fragment at interior about 1900bp, and amplified production fragment II comprises the fragment of about 1700bp of ampicillin resistance gene and pMB1 replication origin.The PCR product cleans back (PCR cleaning reagent box is available from Biomiga company) with PCR cleaning reagent box, handles fragment I and fragment II respectively with DpnI (available from NEB company).Enzyme cuts system and condition is: 40ul PCR product, and 5ul 10 * buffer 4,1ulDpnI was hatched 1 hour for 37 ℃, and PCR cleaning reagent box cleans fragment I and fragment II, and phosphorylation is handled fragment I.The phosphorylation system is: 8ul PCR fragment to be processed is in 70 ℃ of water bath processing 5min, add 1ul T4DNA ligase enzyme damping fluid (available from NEB company), 0.5ul T4 polynueleotide kinase (available from NEB company), 37 ℃, 60min, 60 ℃ of temperature are bathed 20min deactivation Starch phosphorylase, and PCR cleaning reagent box cleans the phosphorylation fragment.Connect enzyme soon and connect two fragments, linked system is: 2.5ul fragment I, 2.5ul fragment II, 5ul 2 * connect soon buffer, 0.5ul quick ligase enzyme (available from NEB company), mixing, room temperature reaction add in the 50ul Trans1-10 competent cell (available from the Beijing Quanshijin Biotechnology Co., Ltd) ice bath 30 minutes after 5 minutes gently.42 ℃ of heat shocks 30 seconds placed 2 minutes on ice immediately.Add 500ul LB substratum, 200rpm was hatched 1 hour for 37 ℃.Getting 200ul bacterium liquid is coated on the LB flat board that contains penbritin, after the incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out liquid culture, extraction positive colony plasmid carries out enzyme and cuts checking, proof is introduced PacI, SpeI and NdeI restriction enzyme site in lacI gene front, add the PacI restriction enzyme site in the back of rrnB T2 terminator, called after pTrc99A-M.

The structure of pACYC184-M plasmid is as shown in figure 14: (public can obtain from Tianjin Institute of Industrial Biotechnology at the pACYC184 plasmid by PCR method, the non-patent literature of putting down in writing the pACYC184-M plasmid is Rose, R.E.The nucleotide sequence of pACYC184.Nucleic Acids Res.1988,16 (1), 355.) in introduced the lacI gene of pTrc99A plasmid, the lacIq fragment, multiple clone site and rrnB terminator codon, and at lacI gene front introducing PacI, SpeI and NdeI restriction enzyme site, back at rrnB T2 terminator adds the PacI restriction enzyme site, and concrete steps are as follows:

With primer 99A-F1-PacI-SpeI-NdeI and 99A-R1-PacI is primer, and pTrc99A is that template is carried out pcr amplification, obtains fragment I, is primer with 184-F2,184-R2, and pACYC184 is that template is carried out pcr amplification, obtains fragment II.Primer sequence is:

184-F2：GGGAGAGCCTGAGCAAACT

184-R2：CGATGATAAGCTGTCAAACATGA

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is: 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 58 ℃ annealing of 98 ℃ of sex change are extended 40sec (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).Amplified production fragment I comprises lacI gene, lacIq, multiple clone site and the rrnB terminator codon fragment at interior about 1900bp, and amplified production fragment II comprises the fragment of chloramphenicol resistance gene and the about 2200bp of p15A replication origin.The PCR product is cleaned back (PCR cleaning reagent box is available from Biomiga company) with PCR cleaning reagent box, handle fragment I respectively and fragment II enzyme cuts system and condition is: 40ul PCR product with DpnI (available from NEB company), 5ul10 * buffer 4,1ul DpnI, hatched 1 hour for 37 ℃, PCR cleaning reagent box cleans fragment I and fragment II.Phosphorylation is handled fragment I, the phosphorylation system is: 8ul PCR fragment to be processed is in 70 ℃ of water bath processing 5min, add 1ul T4DNA ligase enzyme damping fluid (available from NEB company), 0.5ul T4 polynueleotide kinase (available from NEB company), 37 ℃, 60min, 60 ℃ of temperature are bathed 20min deactivation Starch phosphorylase, and PCR cleaning reagent box cleans the phosphorylation fragment.Connect enzyme soon and connect two fragments, linked system is: 2.5ul fragment I, 2.5ul fragment II, 5ul 2 * connect soon buffer, 0.5ul quick ligase enzyme (available from NEB company), mixing, room temperature reaction add in the 50ul Trans1-10 competent cell (available from the Beijing Quanshijin Biotechnology Co., Ltd) ice bath 30 minutes after 5 minutes gently.42 ℃ of heat shocks 30 seconds placed 2 minutes on ice immediately.Add 500ul LB substratum, 200rpm was hatched 1 hour for 37 ℃.Getting 200ul bacterium liquid is coated on the LB flat board that contains paraxin, after the incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out liquid culture, extraction positive colony plasmid carries out enzyme and cuts checking, proof is introduced PacI, SpeI and NdeI restriction enzyme site in lacI gene front, add the PacI restriction enzyme site in the back of rrnB T2 transcription terminator, called after pACYC184-M.

β-Hu Luobusu route of synthesis gene cluster in pantoea agglomerans (Pantoea agglomerans) exists under the same operon, this operon comprises yak base yak base bisphosphate (GGPP) synthase gene (crtE), β-Hu Luobusu cyclase gene (crtX), lycopene beta cyclase gene (crtY), phytoene desaturase gene (crtI), phytoene synthase gene (crtB), β-Hu Luobusu '-hydroxylase gene (crtZ) gene, tetra-sodium method Buddhist nun fat (FPP) in the colon bacillus can be successively through crtE, crtB, crtI, the catalysis of crtY gene encoding enzyme produces β-Hu Luobusu.With Crt-cluster-f, Crt-cluster-r is primer, with pantoea agglomerans (Pantoea agglomerans, CGMCC numbering: 1.2244.Purchase is from Chinese common micro-organisms DSMZ) genome DNA be template, amplification crtEBIXY gene.Primer sequence is:

Crt-cluster-f：CTGT GAATTCAAGGAGATATACCATGATGACGGTCTGTGCAGAA

Crt-cluster-r：TTGCA GTCGACGCTGCGAGAACGTCA

Wherein underscore partly is respectively EcoRI and SalI restriction enzyme site, and The Scarlet Letter partly is artificial RBS.

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 58 ℃ annealing of 98 ℃ of sex change are extended 2 minutes (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).Amplified production comprises crtE, crtX, crtY, crtI and crtB gene, about 5800bp base.

In the pTrc99A-M plasmid, process as shown in figure 15 with the crtEXYIB gene clone of β-Hu Luobusu route of synthesis.Cut the PCR fragment of crtEBIXY gene amplification with EcoRI and SalI enzyme, cut the pTrc99A-M plasmid with EcoRI and SalI enzyme simultaneously, connect two fragments.Linked system is: 1ul pTrc99A-M enzyme is cut product, PCR product after the 4ul enzyme is cut, 5ul connects buffer soon, 0.5ul quick ligase enzyme (available from NEB company), mixing, room temperature reaction add in the 50ulTrans1-T1 competent cell (available from the Beijing Quanshijin Biotechnology Co., Ltd) ice bath 30 minutes after 5 minutes gently.42 ℃ of heat shocks 30 seconds are immediately as for 2 minutes on ice.Add 500ul LB substratum, 200rpm was hatched 1 hour for 37 ℃.Getting 200ul bacterium liquid is coated on the LB flat board that contains penbritin, after the incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out liquid culture, extract the positive colony plasmid and carry out sequence verification, sequencing result shows that the crt serial genes is inserted into the EcoRI and the SalI place of pTrc99A-M multiple clone site, called after pTrc99A-M-crt.

In the pACYC184-M plasmid, process as shown in figure 16 with the crtEXYIB gene clone of β-Hu Luobusu route of synthesis.Cut pACYC184-M with the PacI enzyme.Cut pTrc99A-M-crt with the PacI enzyme simultaneously, cut glue and reclaim about 7.8kb fragment, the fragment of cutting pACYC184-M with the PacI enzyme links to each other, transform Top 10 competent cells (available from the Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes, 42 ℃ of heat shocks 30 seconds are immediately as for 2 minutes on ice.Add 500ul LB substratum, 200rpm was hatched 1 hour for 37 ℃.Getting 200ul bacterium liquid is coated on the LB flat board that contains paraxin, after the incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out liquid culture, extract the positive colony plasmid and carry out sequence verification, sequencing result shows that the PacI enzyme that the crt serial genes is inserted into pACYC184-M cuts the place, called after pACYC184-M-crt.

Adopt electrotransformation that pACYC184-M-crt is transformed into MG1655, dxs-M1-12-FKF, dxs-M1-64-FKF, dxs-M1-30-FKF, dxs-M1-46-FKF, dxs-M1-37-FKF, dxs-M1-93-FKF, dxr-M1-12-FKF, dxr-M1-64-FKF, dxr-M1-30-FKF, dxr-M1-46-FKF, dxr-M1-37-FKF, dxr-M1-93-FKF, ispD-M1-12-FKF, ispD-M1-64-FKF, ispD-M1-30-FKF, ispD-M1-46-FKF, ispD-M1-37-FKF, ispD-M1-93-FKF, ispE-M1-12-FKF, ispE-M1-64-FKF, ispE-M1-30-FKF, ispE-M1-46-FKF, ispE-M1-37-FKF, ispE-M1-93-FKF, ispG-M1-12-FKF, ispG-M1-64-FKF, ispG-M1-30-FKF, ispG-M1-46-FKF, ispG-M1-37-FKF, ispG-M1-93-FKF, ispH-M1-12-FKF, ispH-M1-64-FKF, ispH-M1-30-FKF, ispH-M1-46-FKF, ispH-M1-37-FKF, ispH-M1-93-FKF, idi-M1-12-FKF, idi-M1-64-FKF, idi-M1-30-FKF, idi-M1-46-FKF, idi-M1-37-FKF, idi-M1-93-FKF, ispA-M1-12-FKF, ispA-M1-64-FKF, ispA-M1-30-FKF, ispA-M1-46-FKF, ispA-M1-37-FKF, among the ispA-M1-93-FKF.

Determine β-Hu Luobusu output by the absorption of β-Hu Luobusu under 450nm of measuring acetone extract, and calculate the relative value of its pair cell turbidity (OD600nm).Contain at 5ml and to cultivate MG1655 and the dxs that contains the pACYC184-M-crt plasmid, dxr, ispD, ispE, ispG, ispH, idi, the recombinant bacterial strain behind the ispA gene expression regulation in the LB substratum of 34ug/ml paraxin.30 ℃, 220rpm were cultivated 24 hours.Get 2ml bacterium liquid in the centrifugal 10min of 4000rpm, clean one time, add 55 ℃ in 1ml acetone, dark condition extraction 15min down with aqua sterilisa, 14, the centrifugal 1min of 000rpm measures content beta-carotene under ultraviolet spectrophotometer 453nm, and the result is as shown in figure 17.

Content beta-carotene behind the dxs gene regulating is 1.3-3.5 a times of wild bacterium, and what effect was best is the M1-37 controlling element; Content beta-carotene behind the dxr gene regulating is 0.7-2.3 a times of wild bacterium, and what effect was best is the M1-30 controlling element; Content beta-carotene behind the ispD gene regulating is 0.3-1.4 a times of wild bacterium, and what effect was best is the M1-93 controlling element; Content beta-carotene behind the ispE gene regulating is 0.9-1.4 a times of wild bacterium, and what effect was best is the M1-30 controlling element; Content beta-carotene behind the ispG gene regulating is 0.9-1.2 a times of wild bacterium, and what effect was best is the M1-37 controlling element; Content beta-carotene behind the ispH gene regulating is 0.3-1.2 a times of wild bacterium, and what effect was best is the M1-64 controlling element; Content beta-carotene behind the idi gene regulating is 0.4-2.1 a times of wild bacterium, and what effect was best is the M1-37 controlling element; Content beta-carotene behind the ispA gene regulating is 1.6-2.3 a times of wild bacterium, and what effect was best is the M1-30 controlling element;

Case study on implementation 8, end user's wage adjustment control elements and two step homologous recombination methods are regulated and control the genetic expression on the colon bacillus karyomit(e)

One step homologous recombination method can stay the FRT-Km-FRT fragment on cell chromosome after finishing gene expression regulation, though the Km resistance marker can be removed by the effect of FLP, still can stay next FRT fragment.Adopt two step homologous recombination methods the original regulation and control zone of gene on the colon bacillus karyomit(e) can be replaced with the artificial regulatory element (Figure 18) with various intensity, also do not stay any dna fragmentation after having operated.When the first step homologous recombination, the original regulation and control zone for the treatment of regulatory gene is replaced with cat-sacB fragment (Figure 18 A); When second goes on foot homologous recombination, the cat-sacB fragment is replaced with artificial regulatory element (Figure 18 B) with various intensity.

Method by PCR amplifies the dna fragmentation gene-cat-sacB that is used for first round homologous recombination.Upstream primer is gene-up-Km, comprise treat extra-regional 50 bases of the original regulation and control of regulatory gene and with 20 bases of cat gene upstream sequence homologous.Downstream primer is gene-sacB-down, comprises with 20 bases of sacB gene downstream sequence homologous and 50 bases after treating the regulatory gene initiator codon.

Method by PCR amplifies and is used for second dna fragmentation of taking turns homologous recombination.Upstream primer is gene-up-P, comprises 20 bases (-50 to-31 sites of transcripting start point) for the treatment of extra-regional 50 bases of the original regulation and control of regulatory gene and artificial regulatory element promoter region.Downstream primer is gene-RBS-down, comprises with 15 bases of ribosome bind site homologous of colon bacillus lacZ gene and 50 bases after treating the regulatory gene initiator codon.

Adopt two step homologous recombination methods that the original regulation and control zone of the dxs gene of colon bacillus MG1655 is replaced with artificial regulatory element M1-93.Be template at first, use dxs-up-cat and dxs-sacB-down primer, amplify the dna fragmentation dxs-cat-sacB that is used for the first step homologous recombination with pBM002 plasmid (derive from Hefei hundred and step Bioisystech Co., Ltd).Primer sequence is:

dxs-up-cat：ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAA

TAGGCCCCTG? GGAGAAAATACCGCATCAGG

dxs-sacB-down：GTGGAGTCGA?CCAGTGCCAG?GGTCGGGTAT?TTGGCAATATCAAAACTCAT GCGTTGGCCGATTCATTA。

With M1-93 is template, uses dxs-up-P and dxs-RBS-down primer, amplifies the dna fragmentation dxs-M1-93 that is used for the second step homologous recombination.Primer sequence is:

dxs-up-P：ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAA

TAGGCCCCTG? TTATCTCTGGCGGTG?TTGAC

dxs-RBS-down：GTGGAGTCGA?CCAGTGCCAG?GGTCGGGTAT?TTGGCAATATCAAAACTCAT? AGCTGTTTCC?TGGTT

At first the pKD46 plasmid is converted into colon bacillus MG1655 by electrotransformation.Then dna fragmentation dxs-cat-sacB electricity is gone to the colon bacillus MG1655 that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus MG1655 of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ngDNA fragment dxs-cat-sacB, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 commentaries on classics were hatched 2 hours for 37 ℃.Get 200ul bacterium liquid and be coated on the LB flat board that contains paraxin, after the incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer dxs-up/dxs-down to verify).Select a correct single bacterium colony, with its called after dxs-cat-sacB.

The pKD46 plasmid is converted into dxs-cat-sacB by electrotransformation, then dna fragmentation dxs-M1-93 electricity is gone to the dxs-cat-sacB that has the pKD46 plasmid, electric commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the dxs-cat-sacB of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ng dna fragmentation dxs-M1-93, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200rpm was hatched 4 hours for 37 ℃, removal pKD46 plasmid.Bacterium liquid is transferred to the LB liquid nutrient medium that does not have sodium-chlor that contains 10% sucrose (dress 50ml substratum in the 250ml flask), cultivate after 24 hours contain on the LB solid medium that does not have sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer dxs-up/dxs-down to verify), select a correct single bacterium colony, with its called after dxs-M1-93.

Adopt electrotransformation that pACYC184-M-crt is transformed into dxs-M1-93, measure the synthesis capability of β-Hu Luobusu.The ability of the synthetic β-Hu Luobusu of dxs-M1-93 (pACYC184-M-crt) and dxs-M1-93-FKF's (pACYC184-M-crt) is the same substantially.

Case study on implementation 9, end user's wage adjustment control elements are regulated and control the exogenous gene expression on the colon bacillus karyomit(e)

The crtEXYIB gene of pantoea agglomerans can synthesize β-Hu Luobusu through series reaction by catalysis tetra-sodium method Buddhist nun's fat (FPP).At first the crtEXYIB gene is integrated into colon bacillus ATCC 8739 chromosomal ldhA sites by two methods that go on foot homologous recombination.Be used for two the step homologous recombination the plasmid construction process as shown in figure 19.

The first step is a template with colon bacillus ATCC 8739 genomic dnas, uses primer ldhA-up/ldhA-down, the lactate dehydrogenase gene ldhA of amplification colon bacillus ATCC 8739.Primer sequence is:

ldhA-up：GATAACGGAGATCGGGAATG；

ldhA-down：CTTTGGCTGTCAGTTCACCA。

Amplification system: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is: 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 58 ℃ annealing of 98 ℃ of sex change are extended 40sec (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).Amplified production is lactate dehydrogenase gene ldhA, and it is cloned on the pEASY-Blunt cloning vector.Clone body is: 1ul pcr amplification product, 1ul pEASY-Blunt cloning vector, mixing, room temperature reaction add in the 50ul Trans1-T1 competent cell (available from the Beijing Quanshijin Biotechnology Co., Ltd) ice bath 30 minutes after 5 minutes gently.42 ℃ of heat shocks 30 seconds placed 2 minutes on ice immediately.Add 250ul LB substratum, 200rpm was hatched 1 hour for 37 ℃.Getting 200ul bacterium liquid is coated on the LB flat board that contains kantlex, after the incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out liquid culture, extract the positive colony plasmid and carry out sequence verification, sequencing result shows inserted lactate dehydrogenase gene ldhA on carrier pEASY-Blunt, proves that plasmid construction is correct, with the recombinant plasmid called after pXZ001 that obtains.

Second step was a template with the pXZ001 plasmid DNA, carried out pcr amplification with primer ldhA-1/ldhA-2, obtained the DNA cloning fragment of pXZ001 plasmid, and primer sequence is as follows:

ldhA-1：TCTGGAAAAAGGCGAAACCT；

ldhA-2：TTTGTGCTATAAACGGCGAGT。

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 58 ℃ annealing of 98 ℃ of sex change are extended 2 minutes (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).Pcr amplification product comprises 400 left and right sides bases of pEASY-Blunt carrier and lactate dehydrogenase gene encoding gene upstream and downstream.

The 3rd step, with pBM002 plasmid (derive from Hefei hundred and step Bioisystech Co., Ltd) is template, carry out pcr amplification with primer 4162-F/4162-R, obtain containing chloromycetin gene (Cam) and Polylevulosan sucrose transferase gene (sacB) dna fragmentation, be connected to the pcr amplification product in second step.Primer sequence is as follows:

4162-F：GGAGAAAATACCGCATCAGG

4162-R：GCGTTGGCCGATTCATTA

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 ℃ of pre-sex change 1 minute (1 circulation); 10 seconds, 60 ℃ annealing of 98 ℃ of sex change are extended 2 minutes (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).PCR contains the base about about 3000bp of chloromycetin gene (Cam) and Polylevulosan sucrose transferase gene (sacB) dna fragmentation.

After second step obtained pcr amplification product and clean with PCR cleaning reagent box, DpnI handled; After the 3rd step obtained pcr amplification product and clean with PCR cleaning reagent box, phosphorylation was handled this fragment, and two fragments are connected.Get and transform back bacterium liquid 200ul and be coated in and contain card and receive on the LB flat board of mycin and paraxin, after the incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out liquid culture, extraction positive colony plasmid carries out enzyme and cuts checking, proof is inserted into chloromycetin gene (Cam) and Polylevulosan sucrose transferase gene (sacB) in the middle of the 400bp homology arm of pEASY-Blunt carrier and lactate dehydrogenase gene encoding gene upstream and downstream, called after pXZ002.

The 4th step was a template with the pXZ002 plasmid DNA, carried out pcr amplification with primer ldhA-up/ldhA-down, obtained the DNA cloning fragment of pXZ002 plasmid.Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNAPolymerase (2.5U/ul) 1ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 59 ℃ annealing of 98 ℃ of sex change are extended 1 minute 40 seconds (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 5 minutes (1 circulation).Dna fragmentation I comprises 400 left and right sides bases in lactic dehydrogenase enzyme coding gene upstream, Cat-sacB dna fragmentation, 400 left and right sides bases in lactic dehydrogenase enzyme coding gene downstream.Dna fragmentation I is used for homologous recombination for the first time.At first with the pKD46 plasmid.Be converted into colon bacillus ATCC 8739 by calcium chloride transformation, then dna fragmentation I electricity gone to the colon bacillus ATCC 8739 that has pKD46.Electricity commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the colon bacillus ATCC 8739 of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ngDNA fragment I, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200 change, and hatch 2 hours removal pKD46 plasmid for 37 ℃.Get 200ul bacterium liquid and be coated on the LB flat board that contains paraxin, after the incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer ldhA-up/ldhA-down to verify that correct bacterium colony amplified production is the fragment about 3700bp).Select a correct single bacterium colony, with its called after QL001.

The 5th step, the pTrc99A-M-crt plasmid is cut through the PacI enzyme, cut the about 8kb fragment of glue recovery, the PCR fragment that obtains during Klenow mends flat terminal back and second goes on foot links to each other.Getting conversion back bacterium liquid 200ul is coated with on the LB flat board that contains kantlex, after the incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out liquid culture, extract the positive colony plasmid and carry out that enzyme is cut and sequence verification, the result shows that the crtEXYIB gene is inserted in the middle of the 400bp homology arm of pEASY-Blunt carrier and lactate dehydrogenase gene encoding gene upstream and downstream called after pXZ003-crt.

The 6th step, with the pXZ003-crt plasmid DNA is template, use primer ldhA-up/ldhA-down to amplify dna fragmentation II, amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1.5ul, dna profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 1ul, distilled water 32.5ul, cumulative volume is 50ul.Amplification condition is: 98 ℃ of pre-sex change 2 minutes (1 circulation); 10 seconds, 59 ℃ annealing of 98 ℃ of sex change are extended 7 minutes (30 circulations) for 10 seconds, 72 ℃; 72 ℃ are extended 10 minutes (1 circulation).The nucleotide sequence of dna fragmentation II is shown in sequence in the sequence table 3.Dna fragmentation II comprises 400 left and right sides bases in lactic dehydrogenase enzyme coding gene upstream, trc promotor, crtEXYIB gene, 400 left and right sides bases of rrnB T2 transcription terminator and lactic dehydrogenase enzyme coding gene downstream.Dna fragmentation II is used for homologous recombination for the second time.At first the pKD46 plasmid is converted into QL001 by calcium chloride transformation, then dna fragmentation II electricity is gone to the QL001 that has the pKD46 plasmid, electric commentaries on classics condition is: at first preparation has the electric transformed competence colibacillus cell of the QL001 of pKD46 plasmid; The 50ul competent cell is placed on ice, add 50ng dna fragmentation II, placed on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After the electric shock rapidly with 1ml LB media transfer to electric shock cup, be transferred in the test tube after blow and beat 5 times, 200rpm was hatched 4 hours for 37 ℃, removal pKD46 plasmid.Bacterium liquid is transferred to the LB liquid nutrient medium that does not have sodium-chlor that contains 10% sucrose (dress 50ml substratum in the 250ml flask), cultivate after 24 hours contain on the LB solid medium that does not have sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer ldhA-up/crtE-r to verify that correct bacterium colony amplified production is the fragment about 4500bp), select a correct single bacterium colony, with its called after QL002.The crtE-r primer sequence is as follows:

crtE-r：TTAACTGACGGCAGCGAGTT

By a pair of general primer, adopt a step homologous recombination method trc promotor of foreign gene crtEXYIB can be replaced with artificial regulatory element with various intensity.

Present case replaces with M1-64, M1-46, these four kinds of artificial regulatory elements of M1-37, M1-93 with the trc promotor of foreign gene crtEXYIB, and studying it influences the β-Hu Luobusu synthetic.

Upstream primer is ldhA-up-FRT, comprise the ldhA upstream region of gene 50 bases and with 20 bases of FRT sequence homology.Downstream primer is crt-RBS-down, comprises and 15 bases of ribosome bind site homologous of lacZ gene and 50 bases behind the crtE gene start codon.Primer sequence is:

ldhA-up-FRT：ATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGTGATTCAGTGTAGGCTGGAGCTGCTTC

crtE-RBS-down：GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACCGTCATCATAGCTGTTTCCTGGTT

Use crt-up-FRT and crt-RBS-down primer, with recombinant bacterial strain M1-64, M1-46 among the M-Lib1, M1-37, M1-93 is template, obtain recombinant bacterial strain crt-M1-64-FKF, crt-M1-46-FKF, crt-M1-37-FKF, crt-M1-93-FKF after amplifying dna fragmentation crt-M1-64, crt-M1-46, crt-M1-37, crt-M1-93 and QL002 homologous recombination.

Measure QL002, crt-M1-64-FKF, crt-M1-46-FKF, crt-M1-37-FKF, crt-M1-93-FKF β-Hu Luobusu, the results are shown in Figure 20.The β-Hu Luobusu output of crt-M1-64-FKF, crt-M1-46-FKF, crt-M1-37-FKF, crt-M1-93-FKF is respectively 2.7,1.7,3,3.3 times of QL002.

In addition, the pTrc99A-M-crt plasmid is transformed into colon bacillus ATCC 8739, measures β-Hu Luobusu output, it is 2 times of QL002.This shows that the engineering bacteria of single copy crt gene integration on karyomit(e) produced the effect of the energy force rate plasmid high expression level of β-Hu Luobusu and will be got well.

Case study on implementation 10, end user's wage adjustment control elements library are regulated and control the genetic expression on the colon bacillus karyomit(e)

Set up artificial regulatory element library the dxs gene on the colon bacillus karyomit(e) is carried out expression regulation, thus the output (Figure 21) of raising β-Hu Luobusu.

At first eliminate card among the crt-M1-93-FKF and receive mycin resistant gene, plasmid pFT-Amp is transformed crt-M1-93-FKF by the calcium method for transformation, conversion fluid is applied on the LB flat board that contains penbritin, 30 ℃ of incubated overnight are chosen 3 colony inoculations and are contained in the LB liquid nutrient medium of penbritin 30 ℃ in 10ml, 220rmp is cultured to about OD600=0.1, add Uromycin and induce 6h, on the LB flat board, rule, 39 ℃ of incubated overnight.Choose single bacterium colony and rule on LB, the band card of LB, band penbritin are received the LB flat board of mycin respectively, whether checking is eliminated card and is received mycin resistant gene and pFT-Amp plasmid.Only grow on the LB flat board, the bacterium colony that can not grow on LB, the band card of band penbritin are received the LB flat board of mycin is correct elimination card and receives the bacterial strain of mycin resistant gene.The correct bacterial strain of picking, called after crt-M1-93-FRT.

With dxs-up480F/dxs-RBSL-down is primer, genomic dna with dxs-M1-93-FRT is that template is carried out PCR, obtain being used for the dna fragmentation dxs-R-Lib1 of homologous recombination, this fragment comprises dxs upstream region of gene 480bp homology arm, M1-93 artificial regulatory element and variable RBS district (Figure 21).Primer sequence is:

dxs-up480F：AGTGGTATTGCCGGAATG

dxs-RBSL-down：GTGGAGTCGACCAGTGCCAGGGTCGGGTATTTGGCAATATCAAAACTCATNNNNNNYCTCCTGGTTTAAACGTACATG

Adopt the method for a step homologous recombination that dxs-R-Lib1 is inserted in dxs gene front, regulation and control dxs expression of gene.The pcr amplification of dxs-R-Lib1 and a step homologous recombination method are referring to case study on implementation 7, dxs-R-Lib1 fragment electricity is converted into crt-M1-93-FRT, 30 ℃, 75rmp are cultivated 2h, get 200ul and be applied to the LB plate that contains kantlex, 39 ℃ of incubated overnight, because dxs-M1-93-FRT contains crtEXYIB gene and M1-93 artificial regulatory element, can produce β-Hu Luobusu, so colony colour is yellow.Insert dxs-R-Lib1 before the dxs gene after, the artificial regulatory element that intensity is high will make dxs genetic expression higher, and it is more to make bacterial strain produce β-Hu Luobusu, and bacterium colony is more yellow.The darker bacterial strain of picking 17 strain colors from make up dxs controlling element storehouse is cultivated in containing the LB liquid nutrient medium of kantlex, measures content beta-carotene, the results are shown in Figure 22.The content beta-carotene of dxs-8, dxs-15, these three recons of dxs-16 is the highest, is respectively 1.7,1.7,1.8 times of crt-M1-93-FRT.

In addition, also the original regulation and control zone with the dxs of crt-M1-93-FRT replaces with M1-37, obtains bacterial strain dxs-M1-37-FKF2, and its content beta-carotene is 1.6 times of crt-M1-93-FRT.Therefore, regulate and control dxs genetic expression than the better effects if of regulating and control dxs genetic expression with the artificial regulatory element of certain strength by the artificial element library.

Claims (12)

1. method of utilizing genetic expression intensity on the regulating and controlling microbial karyomit(e) of artificial regulatory element library may further comprise the steps:

The original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with artificial regulatory element library.

Treat on the described microbial staining body that regulatory gene is the native gene and the foreign gene that is incorporated on the microbial staining body on the microbial staining body.

Described artificial regulatory element library is one or more in the library, messenger RNA(mRNA) stable region, ribosome bind site library, promotor upstream library between promoter library, promotor and the ribosome bind site.

2. method according to claim 1 is characterized in that:

Described promoter library is one section and contains the dna sequence dna of base at random, it comprise one contain 6 particular bases or 6 at random the promotor of base-35 nucleus, one contain 6 particular bases or 6 at random the promotor of base-10 nucleus, one contain 10-20 particular bases or 10-20 between-35 and-10 nucleuses the region intermediate, promotor upstream that contains particular bases, one of base contain the messenger RNA(mRNA) stable region of particular bases, a ribosome bind site that contains particular bases at random.

Library, described messenger RNA(mRNA) stable region is one section and contains the dna sequence dna of base at random, and it comprises that a promotor upstream that contains particular bases, promotor that contains particular bases, one contain 5-50 messenger RNA(mRNA) stable region, a ribosome bind site that contains particular bases of base at random between promotor and ribosome bind site.

Described ribosome bind site library is one section and contains the dna sequence dna of base at random, and it comprises that a promotor upstream that contains particular bases, promotor that contains particular bases, one contain the messenger RNA(mRNA) stable region of particular bases, one and contain 6-20 the ribosome bind site of base at random.

Described promotor upstream library is one section and contains the dna sequence dna of base at random, and it comprises containing 5-1000 the zone, promotor that contains particular bases, one of base contain the messenger RNA(mRNA) stable region of particular bases, a ribosome bind site that contains particular bases at random in promotor-35 nucleus upstream.

3. according to the described method of claim 1-2, it is characterized in that:

The sequence of described promoter library is sequence 1 and the sequence 2 in the sequence table.

The sequence in library, described messenger RNA(mRNA) stable region is the sequence 9 in the sequence table.

The sequence in described ribosome bind site library is the sequence 18 in the sequence table.

The sequence in described promotor upstream library is the sequence 17 in the sequence table.

4. according to the described method of claim 1-3, it is characterized in that:

Described the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with artificial regulatory element library, may further comprise the steps:

Method by PCR amplifies the section of DNA fragment, it comprise with the microbial staining body on treat one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contain the fragment (as left homology arm) of 40-3000 base, resistant maker gene, artificial regulatory element library, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Use the method for homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with resistant maker gene and artificial regulatory element library.

Described resistant maker gene is that ampicillin resistance gene, card are received in mycin resistant gene, chloramphenicol resistance gene, tetracycline resistance gene, the apramycin resistant gene one or more.

5. according to the described method of claim 1-4, it is characterized in that:

Described microorganism is colon bacillus (Escherichia coli).

Treat on the described microbial staining body that regulatory gene is beta-galactosidase gene (lacZ), the 1-deoxidation-xylulose 5-phosphate synthase gene (dxs) of colon bacillus.

6. the construction process of an artificial regulatory element may further comprise the steps:

The original regulation and control zone of marker gene on the microbial staining body is replaced with artificial regulatory element library, obtain a series of artificial regulatory elements with different regulation and control intensity.By measuring the activity of this marker gene proteins encoded, determine the intensity of each artificial regulatory element.

Marker gene is the native gene and the foreign gene that is incorporated on the microbial staining body on the microbial staining body on the described microbial staining body.

7. method according to claim 6 is characterized in that:

Described microorganism is colon bacillus (Escherichia coli).

Marker gene is the beta-galactosidase gene (lacZ) of colon bacillus on the described microbial staining body.

8. a utilization has the method for genetic expression intensity on the artificial regulatory element regulating and controlling microbial karyomit(e) of certain strength, may further comprise the steps:

The original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element.

Treat on the described microbial staining body that regulatory gene is the native gene and the foreign gene that is incorporated on the microbial staining body on the microbial staining body.

Described artificial regulatory element is one section dna sequence dna that contains particular bases, and it has specific expression intensity, comprises promotor upstream, promotor, messenger RNA(mRNA) stable region and ribosome bind site.

9. method according to claim 8 is characterized in that:

The sequence of described artificial regulatory element is sequence 3, sequence 4, sequence 5, sequence 6, sequence 7, sequence 8, sequence 10, sequence 11, sequence 12, sequence 13, sequence 14, sequence 15, sequence 16, the sequence 19 in the sequence table.

10. described method according to Claim 8-9 is characterized in that:

Described the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element with particular expression intensity, may further comprise the steps:

Method by PCR amplifies the section of DNA fragment, it comprise with the microbial staining body on treat artificial regulatory element that one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contains the fragment (as left homology arm) of 40-3000 base, resistant maker gene, one and have particular expression intensity, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Use the method for a step homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with resistant maker gene and the artificial regulatory element with particular expression intensity.

Described resistant maker gene is that ampicillin resistance gene, card are received in mycin resistant gene, chloramphenicol resistance gene, tetracycline resistance gene, the apramycin resistant gene one or more.

11. described method according to Claim 8-9 is characterized in that:

Described the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element with particular expression intensity, may further comprise the steps:

Use the method for two step homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with the artificial regulatory element with particular expression intensity.At first the method by PCR amplifies the first segment DNA fragment, it comprise with the microbial staining body on treat one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contain the fragment (as left homology arm) of 40-3000 base, resistant maker gene, Polylevulosan sucrose transferase gene, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Carry out the first step homologous recombination, the original regulation and control zone for the treatment of regulatory gene on the microbial staining body is replaced with resistant maker gene and Polylevulosan sucrose transferase gene.

Method by PCR amplifies the second segment DNA fragment, it comprise with the microbial staining body on treat one section of the regional upstream sequence homologous of the original regulation and control of regulatory gene contain the fragment (as left homology arm) of 40-3000 base, artificial regulatory element with particular expression intensity, with the microbial staining body on treat that one section of regulatory gene initiator codon downstream sequence homologous contains the fragment (as right homology arm) of 40-3000 base.Carry out the second step homologous recombination, resistant maker gene and Polylevulosan sucrose transferase gene are replaced with the artificial regulatory element with particular expression intensity.

Described resistant maker gene is that ampicillin resistance gene, card are received in mycin resistant gene, chloramphenicol resistance gene, tetracycline resistance gene, the apramycin resistant gene one or more.

12. described method according to Claim 8-11 is characterized in that:

Described microorganism is colon bacillus (Escherichia coli).

Treat on the described microbial staining body that regulatory gene is the 1-deoxidation-xylulose 5-phosphate synthase gene (dxs) of colon bacillus, 1-deoxidation-xylulose 5-phosphate reduction isomerase gene (dxr), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol synthase gene (ispD), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol kinase gene (ispE), (E)-4-hydroxy-3-methyl-crotyl-pyrophosphate synthetase gene (ispG), (E)-4-hydroxy-3-methyl-crotyl-tetra-sodium reductase gene (ispH), isovaleryl tetra-sodium isomerase gene (idi), method Buddhist nun's diphosphate synthase gene (ispA); Yak base yak base bisphosphate (GGPP) synthase gene (crtE) of pantoea agglomerans (Pantoea agglomerans), β-Hu Luobusu cyclase gene (crtX), lycopene beta cyclase gene (crtY), phytoene desaturase gene (crtI), phytoene synthase gene (crtB).

Images