KR20170096617A - Mutant Strain with Improved Histidine Production by Inactivating Non-oxidative Pentose Phosphate Pathway-related Enzyme - Google Patents

Abstract

The present invention provides a mutant strain capable of producing histidine, a method for producing the mutant strain, and a method for producing histidine. The present invention increases the ability to produce histidine by inactivating non-oxidative pentose phosphate pathway-related enzymes in a strain having histidine producing ability. According to the present invention, the mutant strain capable of producing histidine exhibits an increased histidine production ability by 5-50% as compared with the wild type strain.

Description

Mutant Strain with Improved Histidine Production by Inactivating Non-oxidative Pentose Phosphate Pathway-related Enzyme}

The present invention relates to a histidine-producing mutant strain by inactivation of an enzyme related to the non-oxidized pentose phosphate pathway.

Histidine is one of the twenty standard amino acids present in proteins. Histidine, an essential amino acid for humans, is an essential component of histamine synthesis, which promotes capillary permeability of the circulatory system. As a precursor of histamine, histidine enhances sexual function and promotes the secretion of gastric acid in hypoacidosis, thereby enhancing digestion, raising blood pressure and strengthening the muscles of the lungs. And since it is essential for tissue growth and restoration, it is essential for the growth of infants. In addition, since histidine is an amino acid necessary to enhance immunity even in patients in the recovery phase, it is also worthwhile as an amino acid supplement like other essential amino acids.

Currently, many studies are being conducted on the development of Escherichia coli for mass production of histidine, but 1) lack of research on the increase of production through the pentose phosphate cycle that produces phosphoribosylpyrophosphate (PRPP), a precursor of histidine, 2 ) Lack of information on important enzymes in genes that biosynthesize histidine, 3) Lack of information on secondary mutagenesis and screening methods for strains developed to mass-produce histidine, 4) Histidine derived from foreign hosts There are many difficulties in production due to fermentation due to the lack of optimization of metabolic flow in the synthetic metabolic circuit. The production of histidine is produced by fermentation method in Japan, and is produced by extraction method in China, and has been announced as a research on overproduction of histidine (4.9 g/L) and patent (14 g/L) (US 7067289 B1). to be.

In order to develop a histidine-producing strain, the conventional technique most commonly used a strain development method using a mutation method (mainly chemical mutagen: NTG). This is a method of selecting a mutant strain having resistance to a histidine-like structure after induction of mutation by selection of resistant strains for intermediate metabolites or final products. However, this mutation method may involve unwanted mutations in the strain, and the over-produced products accumulate in the cell due to the mutation, resulting in a decrease in cell growth.

Throughout this specification, a number of papers and patent documents are referenced and citations are indicated. The disclosure contents of the cited papers and patent documents are incorporated by reference in this specification as a whole, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

The present inventors have tried to produce a histidine-producing mutant strain that increases the productivity of histidine through an increase in phosphoribosylpyrophosphate (PRPP), a precursor in the histidine biosynthetic pathway. As a result, the present invention was completed by confirming the increased histidine-producing ability of the mutant strain of histidine-producing ability prepared by inactivating the non-oxidative pentose phosphate pathway-related enzyme.

Accordingly, an object of the present invention is to provide a histidine-producing mutant strain.

Another object of the present invention is to provide a method for producing a histidine-producing mutant strain.

Another object of the present invention is to provide a method for preparing histidine.

Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

According to an aspect of the present invention, there is provided a histidine-producing mutant strain comprising an inactivated non-oxidative pentose phosphate pathway-related enzyme.

The present inventors have tried to prepare a histidine-producing mutant strain that increases the productivity of histidine through an increase in phosphoribosylpyrophosphate (PRPP), a precursor in the histidine biosynthetic pathway. As a result, it was confirmed that the increased histidine-producing ability of the mutant strain of histidine-producing ability prepared by inactivating the non-oxidized pentose phosphate pathway-related enzyme.

As used herein, the term "non-oxidized pentose phosphate pathway" refers to one of the glucose cycle processes that produce NADPH, which is a reducing equivalent, and pentose, which is an essential component of nucleotides. The non-oxidized pentose phosphate pathway consists of the phosphorylated sugars of xylulose-5-phosphate, ribose-5-phosphate and ribose-5. -phosphate) is a reversible pathway. Phosphoribosylpyrophosphate (PRPP) formed from ribose-5-phosphate is an active compound used in the biosynthesis of histidine and purine/pyrimidine nucleotides (see: http://www.genome.jp/dbget-bin/) www_bget?map00030 and https://en.wikipedia.org/wiki/Pentose_phosphate_pathway ).

According to an embodiment of the present invention, the non-oxidized pentose phosphate pathway-related enzyme is phosphoglucoseisomerase (pgi.phosphoglucoseisomerase), transketolase A (tktA), transketolase B (tktB). ), transaldolase A (talA) and transaldolase B (talB).

The nucleotide sequence encoding the pgi is the first sequence of Sequence Listing.

The nucleotide sequence encoding tktB is the second sequence in the Sequence Listing.

The nucleotide sequence encoding tktA is SEQ ID No. 3 in Sequence Listing.

The nucleotide sequence encoding talA is SEQ ID NO: 4.

The nucleotide sequence encoding talB is SEQ ID NO: 5.

In the present invention, the term "inactivation" used while expressing a mutant strain for producing histidine refers to inhibiting or attenuating the expression and/or activity of a protein by substitution, insertion, deletion, or a combination of nucleotides encoding a gene. do.

According to one embodiment of the present invention, the inactivation of the present invention is by substitution, insertion, deletion or a combination of nucleotide sequences encoding one or more enzymes selected from the group consisting of pgi, tktA, tktB, talA and talB. It is inactivation. According to another embodiment of the present invention, the inactivation of the present invention is non-oxidized pentose phosphate by complete or partial deletion of the nucleotide sequence encoding one or more enzymes selected from the group consisting of pgi, tktA, tktB, talA and talB. It is the inactivation of pathway-related enzymes. According to a specific embodiment of the present invention, the inactivation of the present invention is a non-oxidized pentose phosphate pathway by partial deletion of a nucleotide sequence encoding one or more enzymes selected from the group consisting of pgi, tktA, tktB, talA and talB- It is the inactivation of related enzymes.

According to an embodiment of the present invention, the histidine-producing mutant strain includes an inactivated phosphoglucose isomerase, transketolase B, or a combination thereof.

According to an embodiment of the present invention, the histidine-producing mutant strain includes inactivated transketolase A, transaldolase A, transaldolase B, or a combination thereof.

Non-oxidized pentose phosphate pathway-related enzymes to be inactivated have been found and identified in various strains. In the following examples, non-oxidized pentose phosphate pathway-related enzymes of Escherichia coli of SEQ ID NOs: 1 to 5 in the Sequence Listing are exemplified, but other enzymes are included in the present invention.

The mutant strain of the present invention is a strain in which non-oxidized pentose phosphate pathway-related enzymes are inactivated using a histidine-producing strain containing a wild type or activated non-oxidized pentose phosphate pathway-related enzyme as a parent strain, Any strain that expresses the non-oxidized pentose phosphate pathway-related enzyme or contains the enzymatic activity of the non-oxidized pentose phosphate pathway-related enzyme can be used without limitation as a parent strain.

According to one embodiment of the present invention, the parent strain of the histidine-producing mutant strain is Escherichia coli DS9H KCTC18430P.

According to one embodiment of the present invention, the histidine-producing mutant strain of the present invention is a strain of the genus Escherichia. According to another embodiment of the present invention, the histidine-producing mutant strain of the present invention is Escherichia coli , Escherichia albertii , Escherichia blattae , and Escherichia pergu. Sony ( Escherichia fergusonii ), Escherichia hermannii (Escherichia hermannii) or Escherichia vulneris (Escherichia vulneris) strain. According to a specific embodiment of the present invention, the histidine-producing mutant strain of the present invention is Escherichia coli.

According to one embodiment of the present invention, the histidine-producing ability mutant strain comprising an inactivated non-oxidized pentose phosphate pathway-related enzyme of the present invention is a wild-type or activated non-oxidized pentose phosphate pathway-related histidine-producing ability. Compared to the mutant strain, the histidine production capacity was increased by 5-50%, 5-45%, 5-40%, and 10-40%.

As demonstrated through the examples of the present invention, the histidine-producing mutant strain of the present invention includes a wild-type or activated non-oxidized pentose phosphate pathway-related enzyme when the histidine-producing mutant strain of the present invention contains an inactivated pgi, and In comparison, it is a strain with an increase in the production capacity of histidine by 5-30%, 5-25%, 5-20%, 10-20% or 15-20%.

When the histidine-producing mutant strain of the present invention contains inactivated tktB, the histidine-producing ability is 10-40%, 10 compared to the histidine-producing mutant strain containing the wild-type or activated non-oxidized pentose phosphate pathway-related enzyme. -35%, 10-30%, 15-30% or 20-30% increased strain.

When the histidine-producing mutant strain of the present invention contains inactivated pgi and tktB, the histidine-producing ability is 20-50% compared to the histidine-producing mutant strain containing the wild-type or activated non-oxidized pentose phosphate pathway-related enzyme. , 20-45%, 20-40%, 25-40% or 30-40% increased strain.

When the histidine-producing mutant strain of the present invention contains inactivated tktA, the histidine-producing ability is 2-20% compared to the histidine-producing mutant strain containing the wild-type or activated non-oxidized pentose phosphate pathway-related enzyme, 2 -18%, 2-15%, 5-15% or 8-15% increased strain.

When the histidine-producing mutant strain of the present invention contains inactivated talA, the histidine-producing ability is 5-30% compared to the histidine-producing mutant strain containing the wild-type or activated non-oxidized pentose phosphate pathway-related enzyme, 5 -25%, 5-20%, 10-20% or 15-20% increased strain.

When the histidine-producing mutant strain of the present invention contains inactivated talB, the histidine-producing ability is 2-20% compared to the histidine-producing mutant strain containing a wild-type or activated non-oxidized pentose phosphate pathway-related enzyme, 2 -18%, 2-15%, 5-15% or 8-15% increased strain.

According to another aspect of the present invention, the present invention provides a method for producing a histidine-producing mutant strain comprising the step of inactivating a non-oxidized pentose phosphate pathway-related enzyme.

In the present invention, it is possible to inactivate a non-oxidized pentose phosphate pathway-related enzyme by a known genetic recombination method in a histidine-producing mutant strain containing a wild-type or activated non-oxidized pentose phosphate pathway-related enzyme.

One step inactivation method to delete one or more genes selected from the group consisting of pgi , tktA , tktB , talA and talB genes encoding the non-oxidized pentose phosphate pathway-related enzymes involved in histidine biosynthesis on the chromosome. Warner et al., PNAS, 6:6640-6645).

In the present invention, the step of transforming a histidine-producing strain containing a wild-type or activated non-oxidized pentose phosphate pathway-related enzyme may be carried out through a known method. For example, it may be carried out by an electroporation method (van der Rest et al., Appl. Microbiol. Biotechnol., 52, 541-545, 1999).

In addition, the present invention includes the steps of isolating and obtaining a transformed mutant strain from a histidine-producing strain containing untransformed wild-type or activated non-oxidized pentose phosphate pathway-related enzyme.

In the present invention, a selectively labeled vector may be used in performing the step of isolating and obtaining the transformed histidine-producing mutant strain from the non-transformed strain.

In addition, the vector used in the present invention includes, but is not limited to, a plasmid or phage.

Selective markers used in the present invention include antibiotic resistance genes such as kanamycin and ampicillin, which are commonly used in the art, and levansucrase, which is a product of the SacB gene derived from Bacillus bacillus.

The production method of the present invention is a method for producing the same strain as the strain having the above-described inactivated non-oxidized pentose phosphate pathway-related enzyme, and the strain having the histidine-producing ability. -Related enzymes, phosphoglucose isomerase, transketolase A, transketolase B, transaldolase A and one or more enzymes selected from the group consisting of transaldolase B) and related genes (pgi, tktA , tktB , one or more genes selected from the group consisting of talA and talB ) are in common, so the description of the common content between the two is omitted in order to avoid excessive complexity of the present specification.

According to another aspect of the present invention, there is provided a histidine production method comprising the step of culturing the histidine-producing mutant strain of the present invention.

The present invention can be cultured through a known culture method in pre-culture or seed culture of histidine-producing strains and mutant strains.

Natural medium or synthetic medium can be used in the present invention, and the carbon source of the medium may be, for example, glucose, sucrose, dextrin, glycerol, starch, etc., and as the nitrogen source, peptone, meat extract, yeast extract, dried Yeast, soybean cake, urea, thiourea, ammonium salts, nitrates and other organic or inorganic nitrogen-containing compounds may be used, but are not limited to these ingredients.

Inorganic salts contained in the medium may include phosphates such as magnesium, manganese, potassium, calcium, iron, etc., nitrates, carbonates, chlorides, etc., but are not limited thereto.

In addition to the components of the carbon source, nitrogen source, and inorganic salt, amino acids, vitamins, nucleic acids, and compounds related thereto may be added to the medium.

The present invention is a method for producing histidine using the same strain and strain manufacturing method as the histidine-producing mutant strain containing the inactivated non-oxidized pentose phosphate pathway-related enzyme. In order to avoid excessive complexity, the description is omitted.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a histidine-producing mutant strain, a method for preparing the mutant strain, and a method for preparing histidine.

(b) The present invention increases histidine-producing ability by inactivating non-oxidative pentose phosphate pathway-related enzymes in strains having histidine-producing ability.

(c) The histidine-producing mutant strain of the present invention exhibits a 5-50% increase in histidine-producing ability compared to the wild-type strain.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1: pgi , tktB Manufacture of mutant strains with deletion of genes

The pgi and tktB genes were deleted. The nucleotide sequence of the gene to be deleted is the same as the first sequence and the second sequence, respectively.

Phospho-glucose isomerase (Phosphoglucose isomerase), a gene encoding (pgi, SEQ ID NO: 1) and trans Kane Tortola Kinase B (tktB, SEQ ID NO: 2) One staff inactivation method in order to produce a deletion strains (one step inactivation; Warner et al., PNAS, 6:6640-6645 (2000)) was used. The detailed experimental method is as follows:

Table case pgi at 1, pgi gene, some sequences with pKD13 plasmid portion FR_F having the sequence (pgi), and, was used to FR_R (pgi) a pair of primers for tktB, tktB gene part sequence and the pKD13 plasmid FR_F having some sequence (tktB) and FR_R(tktB) primer pairs, and a PCR reaction using pKD13 plasmid (Genbank accession number AY048744) (total volume 50 μl, 95 5 minutes 1 cycle, 95 to 30 seconds, 58 to 30 seconds, 72) 2 minutes, after a total of 30 cycles, 72 to 5 minutes and 12 to 10 minutes), an amplified fragment of about 1.3 kb FRT having a portion complementary to pgi and about 1.3 kb of FRT having a portion complementary to tktB (1) And (2) were obtained, respectively.

In order to prepare the pgi and tktB gene deletion strains, to obtain the front fragments of the pgi and tktB genes, the genomic DNA of E. coli MG1655 was used as a template. In the case of pgi, the primers pgi_HF1 and pgi_HR1 in Table 1, and Table 2 in the case of tktB. PCR using tktB_HF1 and tktB_HR1 primers (total volume 50 μl, 95 5 minutes 1 cycle, 95 30 seconds, 57 30 seconds, 72 30 seconds, total 30 cycles 72 to 5 minutes and 12 to 10 minutes) ) To obtain approximately 200bp amplified fragments (3) and (4), respectively.

In addition, PCR (total volume 50 µl, 95 5 minutes 1 cycle) using primers pgi_HF2 and pgi_HR2 in Table 1 and tktB_HF2 and tktB_HR2 in Table 2 using the genomic DNA of E. coli MG1655 as a template to obtain the rear fragments of pgi and tktB genes. Then, 95 to 30 seconds, 57 to 30 seconds, 72 to 30 seconds, 72 to 5 minutes and 12 to 10 minutes after a total of 30 cycles) to obtain about 200 bp of amplified fragments (5) and (6), respectively. Got it.

Each of the fragments (1), (3) and (5) sets and (2), (4) and (6) sets amplified in the above experiment can be linked into one fragment due to the complementary sequence of the primers during amplification. . These fragments were subjected to a total volume of 50 µl excluding primers, 95 to 5 minutes, 1 cycle, 95 to 30 seconds, 57 to 30 seconds, 72 to 2 minutes and 30 seconds, and after a total of 30 cycles, 72 to 5 minutes and 12 to 10 minutes under conditions. PCR was performed to obtain one amplified fragment having a size of about 1.7 kb containing FRT and having a pgi fragment at both ends, and about 1.7 kb containing FRT and having a tktB fragment at both ends, respectively.

The thus-obtained DNA fragment was electroporated into Escherichia coli DS9H (Escherichia coli, DS9H; KCTC 18430P) cells containing pKD46 (GenBank No. AY048746). Subsequently, a PCR reaction was performed on a cell line exhibiting kanamycin resistance to confirm the deletion of the pgi and tktB genes. The reaction was performed using the pgi_CF and pgi_CR primers in Table 1, the tktB_CF and tktB_CR primers in Table 2 in a total volume of 20 µl, 95 5 minutes and 1 cycle, 95 to 30 seconds, 55 to 30 seconds, 72 to 2 minutes 30 seconds, total After 30 cycles, it was carried out under conditions of 72 to 5 minutes and 12 to 10 minutes. When the fragment was inserted into the chromosome, it was confirmed that about 2.0 kb was generated compared to the 1.6 kb generated when the original pgi gene was present. In addition, it was confirmed that about 2.4 kb was generated compared to 2.0 kb generated when the tktB gene was present.

A process of removing the antibiotic resistance marker gene was performed using strains in which pgi and tktB deletions were confirmed. After introducing the pCP20 plasmid into the pgi and tktB gene deletion strains to induce FLP recombination, it was confirmed whether antibiotics were removed through the growth of antibiotics (kanamycin) and non-added LB plates. It was confirmed that the strains from which antibiotics were removed grew on the LB plate, but did not grow on the LB plate to which the antibiotic (kanamycin) was added.

primer Base sequence (5'-3') pgi-HF1 TCAACCGCACTGAAAACCGC pgi-HR1 GAAGCAGCTCCAGCCTACACGATCCCGATGTTCACTACGT FR-F(pgi) GTGTAGGCTGGAGCTGCTTC FR-R(pgi) CTGTCAAACATGAGAATTAA pgi-HF2 TTAATTCTCATGTTTGACAGGCAGGAATATCGTGATCAGG pgi-HR2 ACCTGCTGGTAACGGCTGAC pgi-CF AAGTTCTCCGCAACCTTCGA pgi-CR GCCACGCTTTATAGCGGTTA

tktB-HF1 GACCTTGCCAATGCGATTCG tktB-HR1 GAAGCAGCTCCAGCCTACAC CGGTCAGATGTAGCAAACTG FR-F(tktB) GTGTAGGCTGGAGCTGCTTC FR-R(tktB) CTGTCAAACATGAGAATTAA tktB-HF2 TTAATTCTCATGTTTGACAG CAGGATGAGGAATATCGGGA tktB-HR2 CAGCACCTTATGCGCTTTTG tktB-CF CTGTCTGAAGGCATTCGTCT tktB-CR GTTAAACAAAATGGCGGGAC

Example 2: Evaluation of L-histidine production of pgi and tktB gene deletion strains

In order to confirm the production amount of L-histidine in the pgi and tktB gene deletion strain obtained in Example 1, the parent strain Escherichia coli DS9H (Escherichia coli, DS9H KCTC 18430P) and pgi and tktB deletion strains DS9Hpgi, DS9H△tktB and DS9Hpgi The amount of L-histidine production of the ΔtktB strain was compared.

The strain was cultured in a flask with the medium composition shown in Table 3.

ingredient density glucose 8% Magnesium sulfate 0.1% Ammonium sulfate 2.0% MSG 0.1% Potassium monophosphate 0.1% Yeast extract 0.1% Potassium sulfate 0.02% Thiamine-HCl 20 ppm Nicotinic acid 10 ppm Iron sulfate 5 ppm Zinc sulfate 5 ppm Manganese sulfate 5 ppm Calcium carbonate (separately sterilized) 5.0%

The medium condition (pH 7.0) was performed with a starting liquid amount of 10 ml, and the culture was performed under physical conditions of a temperature of 34 and a stirring speed of 200 rpm. As a result, it was confirmed that the production amount of L-histidine increased as shown in Table 4.

Strain name L-histidine (%) Incubation time (hr) DS9H 0.77 72 DS9Hpgi 0.91 72 DS9HtktB 0.96 72 DS9Hpgi,△tktB 1.04 72

As a result of culturing in a flask of strains (DS9Hpgi, tktB) in which pgi and tktB were deleted together, it was confirmed that L-histidine increased by about 35% compared to the parent strain Escherichia coli DS9H (Escherichia coli, DS9H KCTC 18430P). Strains in which pgi and tktB were deleted respectively also showed an increase in histidine production of 18% and 24%, respectively. Non-oxidative (non-oxidative) PPP pathway-related genes pgi and tktB were attenuated to strengthen the oxidative PPP pathway, thereby increasing the L-histidine precursor PRPP.

Example 3: tktA , talA or talB Manufacture of mutant strains with deletion of genes

Based on the results of Examples 1 and 2, in order to improve the L-histidine production ability, transketolase (tkt) A, a non-oxidizing PPP pathway-related gene other than pgi and tktB, and transaldolase, tal ) The disruption of A or transaldolase B was deleted through one step inactivation (Warner et al., PNAS, 6:6640-6645 (2000)). The nucleotide sequences of the tktA , talA, and talB genes to be inactivated are the same as the 3rd, 4th, and 5th sequences in the Sequence Listing.

In order to produce a transformer Kane Tortola dehydratase gene of tktA and trans aldolase gene, talA, trans aldolase deletion strain of gene talB encoding the B encoding the kinase A encoding the A experiment was performed as follows:

Table 5 and 6 and having the tktA, talA or talB gene part sequence and the pKD13 plasmid, some sequences of 7 primers, for example, when tktA FR_F (tktA) and FR_R (tktA) a pair of primers, FR_F (talA) and for talA FR_R (talA) a pair of primers, in the case of the talB FR_F (talB) and FR_R (talB) a pair of primers, and the pKD13 plasmid (Genbank accession number AY048744) using the PCR reaction (total volume 50㎕, 95 5 minutes for 1 cycle, 95 At 30 seconds, 58 to 30 seconds, 72 to 2 minutes, 72 to 5 minutes and 12 to 10 minutes after a total of 30 cycles), FRT having a part complementary to tktA is about 1.3 kb, which has a part complementary to talA. Amplified fragments (7) to (9) of about 1.3 kb of FRT and about 1.3 kb of FRT having a portion complementary to talB were obtained, respectively.

tktA, for talA and talB tktA to the genomic DNA of E. coli MG1655 as a template to obtain the tktA, talA, and anterior segment of talB gene to each producing a deletion strains of the genes of Table 5 tktA_HF1 and tktA_HR1 primer, in the case of talA PCR using the talA_HF1 and talA_HR1 primers in Table 6, and the talB_HF1 and talB_HR1 primers in Table 7 in the case of talB (total volume 50 μl, 95 5 minutes 1 cycle, 95 to 30 seconds, 58 to 30 seconds, 72 to 30 seconds, After a total of 30 cycles, 72 to 5 minutes and 12 to 10 minutes) were performed to obtain about 200 bp amplified fragments (10) to (12), respectively.

In addition, PCR using primers tktA_HF2 and tktA_HR2 in Table 5, primers talA_HF2 and talA2 in Table 6, and primers talB_HF2 and talB_HR2 in Table 7 using the genomic DNA of E. coli MG1655 as a template to obtain the rear fragments of tktA , talA and talB genes. (Total volume 50 μl, 95 5 minutes 1 cycle, 95 to 30 seconds, 58 to 30 seconds, 72 to 30 seconds, 72 to 5 minutes and 12 to 10 minutes after a total of 30 cycles) to amplify about 200 bp Fragments (13) to (15) were obtained, respectively.

Each set of fragments (7), (10) and (13) amplified in the above experiment, set of fragments (8), (11) and (14), and set of fragments (9), (12) and (15) During amplification, a single fragment may be linked due to the complementary sequence of the primers. These fragments were subjected to a total volume of 50 µl excluding primers, 95 to 5 minutes, 1 cycle, 95 to 30 seconds, 58 to 30 seconds, 72 to 2 minutes and 30 seconds, and after a total of 30 cycles, 72 to 5 minutes and 12 to 10 minutes. One having a size of about 1.7 kb containing tktA fragments at both ends of the FRT, about 1.7 kb containing talA fragments at both ends of the FRT, and about 1.7 kb containing talB fragments at both ends of the FRT by performing PCR Each of the amplified fragments of was obtained.

The thus-obtained DNA fragment was electro-invaded into Escherichia coli DS9H (Escherichia coli, DS9H; KCTC 18430P) cells containing pKD46 (GenBank No. AY048746). Subsequently, a PCR reaction was performed on a cell line exhibiting kanamycin resistance to determine whether the tktA , talA, or talB gene was deleted. The reaction was carried out using the tktA_CF and tktA_CR primers in Table 5, the talA_CF and talA_CR primers in Table 6, and the talB_CF and talB_CR primers in Table 7 in a total volume of 20 μl, 95 5 minutes, 1 cycle, 95 to 30 seconds, 55 to 30 seconds, 72 to 2 minutes and 30 seconds, after a total of 30 cycles, 72 to 5 minutes and 12 to 10 minutes were carried out under conditions. When the fragment was inserted into the chromosome, it was confirmed that about 2.4 kb was generated compared to 2.0 kb generated when the original tktA gene was present. In addition, it was confirmed that about 1.3 kb was generated compared to 0.9 kb generated when the talA gene was present. And it was confirmed that about 1.3 kb was generated compared to 0.9 kb generated when the talB gene was present.

A process of removing the antibiotic resistance marker gene was performed using strains in which the deletion of tktA , talA or talB was confirmed. After inducing FLP recombination by introducing pCP20 plasmid into the strain having the tktA , talA, or talB gene deletion, it was confirmed whether antibiotics were removed through the addition of antibiotics (kanamycin) and growth in non-added LB plates. It was confirmed that the strains from which the antibiotic was removed grew on the LB plate, but not on the LB plate to which the antibiotic (kanamycin) was added.

primer Base sequence (5'-3') tktA-HF1 CGTAAAGAGCTTGCCAATGC tktA-HR1 GAAGCAGCTCCAGCCTACACGGTGCAGCAGGCTGTAGATC FR-F(tktA) GTGTAGGCTGGAGCTGCTTC FR-R(tktA) CTGTCAAACATGAGAATTAA tktA-HF2 TTAATTCTCATGTTTGACAGGTCTACCGACGCATTTGACA tktA-HR2 CGCAACAACGTTATCAACAG tktA-CF GGCTTGCGGTAAATTGTTGG tktA-CR GTGATCTACAACACGCCTTA

primer Base sequence (5'-3') talA-HF1 CGAGTTAGACGGCATCAAAC talA-HR1 GAAGCAGCTCCAGCCTACACCAGTTTGTCACACGCTGCGA FR-F(talA) GTGTAGGCTGGAGCTGCTTC FR-R(talA) CTGTCAAACATGAGAATTAA talA-HF2 TTAATTCTCATGTTTGACAGCGCACCGAATTTACTGAAGG talA-HR2 GTTTGGCGGCAAGAAGATCT talA-CF ATGCCTGTCTGCTATGCTTT talA-CR GGATGACCAGAGTTGGCTTT

primer Base sequence (5'-3') talB-HF1 CAAATTGACCTCCCTTCGTC talB-HR1 GAAGCAGCTCCAGCCTACACCCAGACCAATATTTACTGCC FR-F(talB) GTGTAGGCTGGAGCTGCTTC FR-R(talB) CTGTCAAACATGAGAATTAA talB-HF2 TTAATTCTCATGTTTGACAGCGTAAACTGTCTTACACCGG talB-HR2 CAGCAGATCGCCGATCATTT talB-CF GCTGACGTTGCGTCGTGATA talB-CR CAGAATGATACACTGCGAAG

Example 4: tktA , talA or talB Evaluation of L-histidine production of gene deletion strains

In order to confirm the L-histidine production amount of the tktA , talA or talB gene deletion strain obtained in Example 3, the parent strains Escherichia coli DS9H (Escherichia coli, DS9H; KCTC 18430P) and tktA , talA, or talB are the deletion strains, respectively, DS9HtktA. , The amount of L-histidine production of DS9HΔtalA and DS9HtalB was compared.

The strain was cultured using the same medium composition and culture conditions as in Example 2.

Strain name L-histidine (%) Incubation time (hr) DS9H 0.77 72 DS9HtktA 0.86 72 DS9HtalA 0.89 72 DS9HtalB 0.87 72

As shown in the results of Table 8, it was confirmed that the productivity of L-histidine was improved by about 11 to 15% compared to the parent strain by the present invention. DS9HtktA, DS9HΔtalA and DS9HtalB increased L-histidine productivity by about 12%, 15%, and 13%, respectively, compared to the parent strain.

As described above, specific parts of the present invention have been described in detail, and it is obvious that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto for those of ordinary skill in the art. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

Korea Research Institute of Bioscience and Biotechnology KCTC18430P 20151201

<110> DAESANG CORPORATION <120> Mutant Strain with Improved Histidine Production by Inactivating Non-oxidative Pentose Phosphate Pathway-related Enzyme <130> PN150580D <150> KR 10-2015-0181822 <151> 2015-12-18 <160> 5 <170> KopatentIn 2.0 <210> 1 <211> 1650 <212> DNA <213> phosphoglucose isomerase (pgi) <400> 1 atgaaaaaca tcaatccaac gcagaccgct gcctggcagg cactacagaa acacttcgat 60 gaaatgaaag acgttacgat cgccgatctt tttgctaaag acggcgatcg tttttctaag 120 ttctccgcaa ccttcgacga tcagatgctg gtggattact ccaaaaaccg catcactgaa 180 gagacgctgg cgaaattaca ggatctggcg aaagagtgcg atctggcggg cgcgattaag 240 tcgatgttct ctggcgagaa gatcaaccgc actgaaaacc gcgccgtgct gcacgtagcg 300 ctgcgtaacc gtagcaatac cccgattttg gttgatggca aagacgtaat gccggaagtc 360 aacgcggtgc tggagaagat gaaaaccttc tcagaagcga ttatttccgg tgagtggaaa 420 ggttataccg gcaaagcaat cactgacgta gtgaacatcg ggatcggcgg ttctgacctc 480 ggcccataca tggtgaccga agctctgcgt ccgtacaaaa accacctgaa catgcacttt 540 gtttctaacg tcgatgggac tcacatcgcg gaagtgctga aaaaagtaaa cccggaaacc 600 acgctgttct tggtagcatc taaaaccttc accactcagg aaactatgac caacgcccat 660 agcgcgcgtg actggttcct gaaagcggca ggtgatgaaa aacacgttgc aaaacacttt 720 gcggcgcttt ccaccaatgc caaagccgtt ggcgagtttg gtattgatac tgccaacatg 780 ttcgagttct gggactgggt tggcggccgt tactctttgt ggtcagcgat tggcctgtcg 840 attgttctct ccatcggctt tgataacttc gttgaactgc tttccggcgc acacgcgatg 900 gacaagcatt tctccaccac gcctgccgag aaaaacctgc ctgtactgct ggcgctgatt 960 ggcatctggt acaacaattt ctttggtgcg gaaactgaag cgattctgcc gtatgaccag 1020 tatatgcacc gtttcgcggc gtacttccag cagggcaata tggagtccaa cggtaagtat 1080 gttgaccgta acggtaacgt tgtggattac cagactggcc cgattatctg gggtgaacca 1140 ggcactaacg gtcagcacgc gttctaccag ctgatccacc agggaaccaa aatggtaccg 1200 tgcgatttca tcgctccggc tatcacccat aacccgctct ctgatcatca ccagaaactg 1260 ctgtctaact tcttcgccca gaccgaagcg ctggcgtttg gtaaatcccg cgaagtggtt 1320 gagcaggaat atcgtgatca gggtaaagat ccggcaacgc ttgactacgt ggtgccgttc 1380 aaagtattcg aaggtaaccg cccgaccaac tccatcctgc tgcgtgaaat cactccgttc 1440 agcctgggtg cgttgattgc gctgtatgag cacaaaatct ttactcaggg cgtgatcctg 1500 aacatcttca ccttcgacca gtggggcgtg gaactgggta aacagctggc gaaccgtatt 1560 ctgccagagc tgaaagatga taaagaaatc agcagccacg atagctcgac caatggtctg 1620 attaaccgct ataaagcgtg gcgcggttaa 1650 <210> 2 <211> 2004 <212> DNA <213> transketolase B <400> 2 atgtcccgaa aagaccttgc caatgcgatt cgcgcactca gtatggatgc ggtacaaaaa 60 gccaactctg gtcatcccgg cgcgccgatg ggcatggctg atattgccga agtgctgtgg 120 aacgattttc ttaaacataa ccctaccgac ccaacctggt atgatcgcga ccgctttatt 180 ctttccaacg gtcacgcgtc gatgctgctc tacagtttgc tacatctgac cggttacgac 240 ctgccgctgg aagaactgaa gaacttccgt cagttgcatt cgaaaacccc aggccacccg 300 gagattggct atacgccagg cgttgaaacc accaccggcc cgcttggaca aggtttggcg 360 aacgccgtcg ggctggcgat agcagagcgt acactggcgg cgcagtttaa ccagccagac 420 catgagatcg tcgatcactt cacctatgtg tttatgggcg acggctgcct gatggaaggt 480 atttcccacg aagtctgttc gctggcaggc acgctgggac tgggcaagct gattggtttt 540 tacgatcaca acggtatttc catcgacggt gaaacagaag gctggtttac cgacgatacg 600 gcaaaacgtt ttgaagccta tcactggcat gtgatccatg aaatcgacgg tcacgatccg 660 caggcggtga aggaagcgat ccttgaagcg caaagcgtga aagataagcc gtcgctgatt 720 atctgccgta cggtgattgg ctttggttcg ccgaataaag caggtaagga agaggcgcac 780 ggcgcaccac tgggggaaga agaagtggcg ctggcacggc aaaaactggg ctggcaccat 840 ccgccatttg agatccctaa agagatttat cacgcctggg atgcccgtga aaaaggcgaa 900 aaagcgcagc agagctggaa tgagaagttt gccgcctata aaaaggctca tccgcaactg 960 gcagaagagt ttacccgacg gatgagcggt ggtttaccga aggactggga gaaaacgact 1020 cagaaatata tcaatgagtt acaggcaaat ccggcgaaaa tcgctacccg taaggcttcg 1080 caaaatacgc ttaacgctta cgggccgatg ctgcctgagt tgctcggcgg ttcggcggat 1140 ctggctccca gcaacctgac catctggaaa ggttctgttt cgctgaagga agatccagcg 1200 ggcaactaca ttcactacgg ggtgcgtgaa tttggcatga ccgctatcgc caacggcatc 1260 gcgcaccacg gcggctttgt gccgtatacc gcgacgttcc tgatgtttgt tgaatacgcc 1320 cgtaacgccg cgcggatggc ggcactgatg aaagcgcggc agattatggt ttatacccac 1380 gactcaattg gcctgggcga agatggtccg acgcaccagg ctgttgagca actggccagc 1440 ctgcgcttaa cgccaaattt cagcacctgg cgaccgtgcg atcaggtgga agcggcggtg 1500 ggctggaagc tggcggttga gcgccacaac ggaccgacgg cactgatcct ctcaaggcag 1560 aatctggccc aggtggaacg tacgccggat caggttaaag agattgctcg tggcggttat 1620 gtgctgaaag acagcggcgg taagccagat attattctga ttgccaccgg ttcagagatg 1680 gaaattaccc tgcaagcggc agagaaatta gcaggagaag gtcgcaatgt acgcgtagtt 1740 tccctgccct cgaccgatat tttcgacgcc caggatgagg aatatcggga gtcggtgttg 1800 ccttctaacg ttgcggctcg cgtggcggtg gaagcaggta ttgccgatta ctggtacaag 1860 tatgttggtc tgaaaggggc aattgtcggg atgacgggtt acggggaatc tgctccggcg 1920 gataagctgt tcccgttctt tggctttacc gccgagaata ttgtggcaaa agcgcataag 1980 gtgctgggag tgaaaggtgc ctga 2004 <210> 3 <211> 1992 <212> DNA <213> transketolase A <400> 3 atgtcctcac gtaaagagct tgccaatgct attcgtgcgc tgagcatgga cgcagtacag 60 aaagccaaat ccggtcaccc gggtgcccct atgggtatgg ctgacattgc cgaagtcctg 120 tggcgtgatt tcctgaaaca caacccgcag aatccgtcct gggctgaccg tgaccgcttc 180 gtgctgtcca acggccacgg ctccatgctg atctacagcc tgctgcacct caccggttac 240 gatctgccga tggaagaact gaaaaacttc cgtcagctgc actctaaaac tccgggtcac 300 ccggaagtgg gttacaccgc tggtgtggaa accaccaccg gtccgctggg tcagggtatt 360 gccaacgcag tcggtatggc gattgcagaa aaaacgctgg cggcgcagtt taaccgtccg 420 ggccacgaca ttgtcgacca ctacacctac gccttcatgg gcgacggctg catgatggaa 480 ggcatctccc acgaagtttg ctctctggcg ggtacgctga agctgggtaa actgattgca 540 ttctacgatg acaacggtat ttctatcgat ggtcacgttg aaggctggtt caccgacgac 600 accgcaatgc gtttcgaagc ttacggctgg cacgttattc gcgacatcga cggtcatgac 660 gcggcatcta tcaaacgcgc agtagaagaa gcgcgcgcag tgactgacaa accttccctg 720 ctgatgtgca aaaccatcat cggtttcggt tccccgaaca aagccggtac ccacgactcc 780 cacggtgcgc cgctgggcga cgctgaaatt gccctgaccc gcgaacaact gggctggaaa 840 tatgcgccgt tcgaaatccc gtctgaaatc tatgctcagt gggatgcgaa agaagcaggc 900 caggcgaaag aatccgcatg gaacgagaaa ttcgctgctt acgcgaaagc ttatccgcag 960 gaagccgctg aatttacccg ccgtatgaaa ggcgaaatgc cgtctgactt cgacgctaaa 1020 gcgaaagagt tcatcgctaa actgcaggct aatccggcga aaatcgccag ccgtaaagcg 1080 tctcagaatg ctatcgaagc gttcggtccg ctgttgccgg aattcctcgg cggttctgct 1140 gacctggcgc cgtctaacct gaccctgtgg tctggttcta aagcaatcaa cgaagatgct 1200 gcgggtaact acatccacta cggtgttcgc gagttcggta tgaccgcgat tgctaacggt 1260 atctccctgc acggtggctt cctgccgtac acctccacct tcctgatgtt cgtggaatac 1320 gcacgtaacg ccgtacgtat ggctgcgctg atgaaacagc gtcaggtgat ggtttacacc 1380 cacgactcca tcggtctggg cgaagacggc ccgactcacc agccggttga gcaggtcgct 1440 tctctgcgcg taaccccgaa catgtctaca tggcgtccgt gtgaccaggt tgaatccgcg 1500 gtcgcgtgga aatacggtgt tgagcgtcag gacggcccga ccgcactgat cctctcccgt 1560 cagaacctgg cgcagcagga acgaactgaa gagcaactgg caaacatcgc gcgcggtggt 1620 tatgtgctga aagactgcgc cggtcagccg gaactgattt tcatcgctac cggttcagaa 1680 gttgaactgg ctgttgctgc ctacgaaaaa ctgactgccg aaggcgtgaa agcgcgcgtg 1740 gtgtccatgc cgtctaccga cgcatttgac aagcaggatg ctgcttaccg tgaatccgta 1800 ctgccgaaag cggttactgc acgcgttgct gtagaagcgg gtattgctga ctactggtac 1860 aagtatgttg gcctgaacgg tgctatcgtc ggtatgacca ccttcggtga atctgctccg 1920 gcagagctgc tgtttgaaga gttcggcttc actgttgata acgttgttgc gaaagcaaaa 1980 gaactgctgt aa 1992 <210> 4 <211> 951 <212> DNA <213> transaldolase A <400> 4 atgaacgagt tagacggcat caaacagttc accactgtcg tggcagacag cggcgatatt 60 gagtccattc gccattatca tccccaggat gccaccacca atccttcgct gttactcaaa 120 gctgccggat tatcacaata tgagcattta atagacgatg ctatcgcctg gggtaaaaaa 180 aatggcaaga cccaggaaca acaggtggtc gcagcgtgtg acaaactggc ggtcaatttc 240 ggtgctgaaa tcctcaaaat cgtacccggt cgcgtgtcaa cagaagttga tgcacgcctc 300 tcttttgata aagaaaagag tattgagaag gcgcgccatc tggtggactt gtatcagcaa 360 caaggcgttg agaaatcacg cattctgatc aagctggctt cgacctggga aggaattcgc 420 gcggcagaag agctggaaaa agaaggtatt aactgcaacc tgacgctgct gttttctttt 480 gcacaggcac gggcctgtgc ggaagcaggc gtttttctga tttcgccgtt tgtcgggcgt 540 atttatgact ggtatcaggc acgcaagccg atggacccgt atgtggtgga agaagatccg 600 ggcgttaaat cggtgcgcaa tatctacgac tactataagc aacaccacta tgaaaccatt 660 gtgatgggcg cgagcttccg tcgcaccgaa caaatcctcg ccttaaccgg ctgcgatcga 720 ctgactatcg caccgaattt actgaaggag ctgcaggaaa aagtttcgcc agtggtacgt 780 aaattaatcc caccttctca gacgttccca cgcccagctc ccatgagcga agcggagttc 840 cgttgggagc acaatcagga tgcgatggcg gtagaaaaac tgtctgaagg cattcgtctg 900 ttcgccgttg atcaacgcaa actggaagat cttcttgccg ccaaactata a 951 <210> 5 <211> 954 <212> DNA <213> transaldolase B <400> 5 atgacggaca aattgacctc ccttcgtcag tacaccaccg tagtggccga cactggggac 60 atcgcggcaa tgaagctgta tcaaccgcag gatgccacaa ccaacccttc tctcattctt 120 aacgcagcgc agattccgga ataccgtaag ttgattgatg atgctgtcgc ctgggcgaaa 180 cagcagagca acgatcgcgc gcagcagatc gtggacgcga ccgacaaact ggcagtaaat 240 attggtctgg aaatcctgaa actggttccg ggccgtatct caactgaagt tgatgcgcgt 300 ctttcctatg acaccgaagc gtcaattgcg aaagcaaaac gcctgatcaa actctacaac 360 gatgctggta ttagcaacga tcgtattctg atcaaactgg cttctacctg gcagggtatc 420 cgtgctgcag aacagctgga aaaagaaggc atcaactgta acctgaccct gctgttctcc 480 ttcgctcagg ctcgtgcttg tgcggaagcg ggcgtgttcc tgatctcgcc gtttgttggc 540 cgtattcttg actggtacaa agcgaatacc gataagaaag agtacgctcc ggcagaagat 600 ccgggcgtgg tttctgtatc tgaaatctac cagtactaca aagagcacgg ttatgaaacc 660 gtggttatgg gcgcaagctt ccgtaacatc ggcgaaattc tggaactggc aggctgcgac 720 cgtctgacca tcgcaccggc actgctgaaa gagctggcgg agagcgaagg ggctatcgaa 780 cgtaaactgt cttacaccgg cgaagtgaaa gcgcgtccgg cgcgtatcac tgagtccgag 840 ttcctgtggc agcacaacca ggatccaatg gcagtagata aactggcgga aggtatccgt 900 aagtttgcta ttgaccagga aaaactggaa aaaatgatcg gcgatctgct gtaa 954

Claims (4)

(a) a phosphoglucose isomerase encoded by a nucleotide sequence of the first sequence of the sequence listing; (b) transaldolase A encoded by the nucleotide sequence of Sequence Listing 4; (c) a transaldolase B encoded by the nucleotide sequence of SEQ ID NO: 5; Or (d) a combination of transposolase B encoded by the nucleotide sequence of the phosphoglucose isomerase of (a) and the nucleotide sequence of Sequence Listing 2 is inactivated and the ability to produce histidine is increased by 5-50% Escherichia genus mutant.
The Escherichia coli strain according to claim 1, wherein the strain of Escherichia is Escherichia coli , Escherichia albertii , Escherichia blattae , Escherichia fergusonii , , Escherichia hermannii or Escherichia vulneris strain. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt;
(a) a phosphoglucose isomerase encoded by a nucleotide sequence of the first sequence of the sequence listing; (b) transaldolase A encoded by the nucleotide sequence of Sequence Listing 4; (c) a transaldolase B encoded by the nucleotide sequence of SEQ ID NO: 5; Or (d) inactivating the combination of transposolase B encoded by the nucleotide sequence of the phosphoglucose isomerase of (a) and the nucleotide sequence of the second sequence of SEQ ID &lt; RTI ID = 0.0 &gt; A method for producing an Escherichia genus mutant increased by 50%.
A method for producing histidine comprising culturing the mutant strain of claim 1 or 2.