CN103740633A - Recombinant bacteria strain for producing lycopene and application of recombinant bacteria strain - Google Patents
Recombinant bacteria strain for producing lycopene and application of recombinant bacteria strain Download PDFInfo
- Publication number
- CN103740633A CN103740633A CN201410029600.0A CN201410029600A CN103740633A CN 103740633 A CN103740633 A CN 103740633A CN 201410029600 A CN201410029600 A CN 201410029600A CN 103740633 A CN103740633 A CN 103740633A
- Authority
- CN
- China
- Prior art keywords
- gene
- bacillus coli
- recombination bacillus
- seq
- recombinant bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant bacteria strain for producing lycopene and application of the recombinant bacteria strain. The recombinant bacteria strain 1 disclosed by the invention is constructed by improving enzyme activity of yak-based bisphosphate synthetase in recombinant Escherichia coli; the method for improving the enzyme activity of yak-based bisphosphate synthetase in recombinant Escherichia coli comprises the step of replacing an original regulation component of yak-based bisphosphate synthetase genes crtE in the recombinant Escherichia coli by an artificial regulation component 1. The strain disclosed by the invention is high in lycopene yield and has extremely high production and application values.
Description
Technical field
The present invention relates to a strain and produce recombinant bacterium and the application thereof of Lyeopene.
Background technology
Lyeopene is the main component that forms tomato red pigments, belongs to " carotenoid " material, is a kind of outstanding antioxidant.Lyeopene is 2 times of β-carotene to the cancellation effect of singlet oxygen, 100 times of vitamin-E.Lyeopene also has function of anti-cancer and cancer prevention, enhancing body immunizing power and the anti-ageing physiological function of waiting for a long time, and at food, makeup and field of medicaments, has important use.Lyeopene can prevent the injury that meta-bolites " radical " causes human tissue organ, because it has anti-radical effect, therefore can be used as natural health care or medicine, occurred at present tens of kinds of protective foods and the medicines containing Lyeopene on European market.Containing the protective foods of Lyeopene, can prevent senile vision degeneration, anti-ageing and prevention cardiovascular diseases, Lyeopene also all has certain restraining effect to digestive tract cancer, cervical cancer, mammary cancer, skin carcinoma, bladder cancer etc.Lyeopene is nontoxic, and its adds in the food such as ice-creams, fruit syrup, hard candy, bread, biscuit, cake the same with β-carotene can be improved its nutritive value.The research and development of its related products in recent years have become the focus of new drug research in the world.
The production of Lyeopene mainly contains the methods such as natural extract, chemosynthesis, microorganism fermentation in the world at present.Content of lycopene in tomato is very low, only contains 20 grams of Lyeopenes in common tomato per ton; And natural extract method productive rate is low, expensive, cannot satisfy the demands.Though chemical synthesis cost declines to some extent but has certain insecurity.By contrast, microbe fermentation method is not subject to restriction, the production process of raw material green clean, has very large advantage.Along with the fast development of biotechnology, utilize microorganism fermentative production Lyeopene to become one of current study hotspot.
Microbe fermentation method divides again two kinds.One is to use wild strain to ferment.The microorganism that fermentative production Lyeopene is relatively commonly used is at present trispore Bruce mould (Blakesleatrispora), and output is in 1g/L left and right, but fermentation period is longer.Another kind is to build recombinant microorganism to ferment.Along with the development that metabolic engineering and synthesising biological learn a skill in recent years, the kind of the synthetic terpenoid of recombinant microorganism and output are in continuous lifting.Because intestinal bacteria (Escherichia coli) genome sequence is announced completely, genetic background and pathways metabolism are all perfectly clear, have that substratum requirement is simple, the advantage such as rapid of growing, and become the most frequently used recombinant microorganism.At present; a lot of research is all in intestinal bacteria, to introduce yak base yak base tetra-sodium (Geranyl-geranyldiphosphate; GGPP) synthase gene (crtE), phytoene desaturase gene (phytoenedesaturase; crtI); phytoene synthase gene (Phytoene synthase; crtB) gene, and then it is transformed to (Ajikumar et al., 2008; Das et al., 2007; Keasling, 2008; Lee et al., 2002).Fig. 1 is the route of synthesis that after introducing Lyeopene synthetic gene, intestinal bacteria generate Lyeopene.
The method of utilizing at present metabolic engineering to improve yield of lycopene is mainly to improve the expression intensity of pathways metabolism key gene, improve synthetic Lyeopene precursor substance isopentenylpyrophosphate (the Isopentenyl diphosphate of recombination bacillus coli, IPP) and dimethyl propylene thiazolinyl tetra-sodium (Dimethylallyl pyrophosphate, DMAPP) ability, thus Lyeopene synthesis capability improved.
The scheme that improves the synthetic IPP of recombination bacillus coli and DMAPP ability mainly contains two kinds: a kind of is the mevalonate pathway (Mevalonic Acid Pathway, MVA approach) of introducing external source, as the MVA approach of yeast saccharomyces cerevisiae (Martin et al., 2003; Yoon et al., 2007; Yoon et al., 2009); Another kind is by improving the methylerythritol phosphate(MEP of intestinal bacteria self) in approach key gene expression intensity and improve efficiency (Ajikumar et al., 2010 that the supply of MEP approach precursor compound glyceraldehyde 3-phosphate and pyruvic acid improves intestinal bacteria self MEP approach; Alper et al., 2005a; Alper et al., 2005b; Choi et al., 2010; Jin and Stephanopoulos, 2007; Yuan et al., 2006).The overexpression isopentenylpyrophosphate isomerase genes (idi) such as Wang and 1-deoxidation-xylulose-5-phosphate synthase gene (dxs), and by the glimmer crtE of ancient green-ball bacterium (Archaeoglobus.fulgidus) of orthogenesis optimization, the output of Lyeopene is improved largely (Wang et al., 2000).Kim etc. express idi gene by high copy number plasmid, and low copy plasmid expression Lyeopene synthetic gene, brings up to 260mg/L by the output of Lyeopene, and unit cell content reaches 5.7mg/g DCW(Kim et al., 2009).Yoon etc. are with the downstream part gene of the MVA approach of plasmid form overexpression streptococcus pneumoniae (Streptococcus pneumoniae), and add mevalonic acid as the middle precursor substance that produces Lyeopene, the output of Lyeopene is brought up to 102mg/L, unit cell content reaches 22mg/gDCW(Yoon et al., 2006).Kim etc. are with plasmid form overexpression idi and dxs gene, and introduced the 3-Hydroxymethylglutaryl list acyl CoA synthase gene (mvaS) from enterococcus faecalis (Enterococcus faecalis), 3-Hydroxymethylglutaryl list acyl CoA reductase gene (mvaA), from the Mevalonic kinase gene (mvaK1) of S.pneumoniae, Phosphomevalonic kinase gene (mvaK2) and bisphosphate mevalonic acid dehydrase gene (mvaD), take containing 10g/L glucose and 7.5g/L pectinose in the minimal medium of carbon source, high density fermentation, yield of lycopene reaches 1350mg/L, unit cell content reaches 32mg/g DCW(Kim et al., 2011).Cho etc. are introducing on the basis of crtEIB, in recombination bacillus coli, added the plasmid of mvaA, mvaS, mvaK1, a mvaK2 and mvaD5 foreign gene that carries MVA approach, Lyeopene unit cell content is brought up to 38.1mg/gDCW (Cho et al., 2010).
Up to the present, the intestinal bacteria of bibliographical information produce yield of lycopene and reach as high as 1350mg/L, and unit cell content is up to 38.1mg/g DCW.In order to reduce the cost of fermentative Production Lyeopene, also need further to improve output and the throughput rate of Lyeopene.
Summary of the invention
The object of this invention is to provide a strain and produce recombinant bacterium and the application thereof of Lyeopene.
The method that in described raising recombination bacillus coli, the enzyme of yak base yak base diphosphate synthase is lived is that the original controlling element of the yak base yak base diphosphate synthase gene crtE in described recombination bacillus coli is replaced with to artificial regulatory element 1;
The original controlling element of described yak base yak base diphosphate synthase gene crtE is as shown in SEQ ID No.10;
The nucleotide sequence of described artificial regulatory element 1 is as shown in SEQ ID No.11;
The construction process of described recombination bacillus coli is as follows:
(1) zeaxanthin glycosyltransferase gene crtX and lycopene beta cyclase gene crtY in β-carotene synthetic gene in intestinal bacteria CAR001 bunch are replaced to artificial RBS sequence;
The sequence of described zeaxanthin glycosyltransferase gene crtX is as shown in SEQ ID No.1;
The sequence of described lycopene beta cyclase gene crtY is as shown in SEQ ID No.2;
Described artificial RBS sequence is as shown in SEQ ID No.3;
Described β-carotene synthetic gene bunch is the gene cluster being comprised of yak base yak base diphosphate synthase gene crtE, zeaxanthin glycosyltransferase gene crtX, lycopene beta cyclase gene crtY, phytoene desaturase gene crtI and phytoene synthase gene crtB;
(2) in the recombination bacillus coli that raising step (1) obtains, the enzyme of ketoglurate dehydrogenase is lived;
The original controlling element that the method that in the recombination bacillus coli that described raising step (1) obtains, ketoglurate dehydrogenase enzyme is lived is specially the alph-ketoglutaric acid dehydrase gene sucAB in the recombination bacillus coli that described step (1) is obtained replaces with artificial regulatory element M1-46;
The original controlling element of described alph-ketoglutaric acid dehydrase gene sucAB is as shown in SEQ ID No.4;
(3) in the recombination bacillus coli that raising step (2) obtains, the enzyme of transaldolase is lived;
The original controlling element that the method that in the recombination bacillus coli that described raising step (2) obtains, the enzyme of transaldolase is lived is specially the transaldolase gene talB in the recombination bacillus coli that described step (2) is obtained replaces with artificial regulatory element M1-46;
The original controlling element of described transaldolase gene talB is as shown in SEQ ID No.6;
(4) in the recombination bacillus coli that raising step (3) obtains, the enzyme of succinate dehydrogenase is lived, and obtains object recombination bacillus coli;
The original controlling element that the method that in the recombination bacillus coli that described raising step (3) obtains, the enzyme of succinate dehydrogenase is lived is specially the succinate dehydrogenase gene sdhABCD in the recombination bacillus coli that described step (3) is obtained replaces with artificial regulatory element M1-46;
The original controlling element of described succinate dehydrogenase gene sdhABCD is as shown in SEQ ID No.7;
The nucleotide sequence of described artificial regulatory element M1-46 is as shown in SEQ ID No.5.
The method that in described raising recombinant bacterium 1, the enzyme of 1-deoxidation-xylulose-5-phosphate synthase is lived is specially the original controlling element of the 1-deoxidation-xylulose-5-phosphate synthase gene dxs in described recombination bacillus coli is replaced with to artificial regulatory element 2;
The original controlling element of described 1-deoxidation-xylulose-5-phosphate synthase gene dxs is as shown in SEQ ID No.8;
The nucleotide sequence of described artificial regulatory element 2 is as shown in SEQ ID No.12.
The original controlling element of described isovaleryl tetra-sodium isomerase gene idi is as shown in SEQ ID No.5;
The nucleotide sequence of described artificial regulatory element X is as shown in SEQ ID No.9;
Described recombination bacillus coli is described recombinant bacterium 2.
The original controlling element of described isovaleryl tetra-sodium isomerase gene idi is as shown in SEQ ID No.5;
The nucleotide sequence of described artificial regulatory element 4 is as shown in SEQ ID No.13;
Described recombination bacillus coli is described recombinant bacterium 2.
The method of producing Lyeopene also belongs to protection scope of the present invention: comprise the steps:, by an above-mentioned arbitrary described recombinant bacterium fermentation culture, to obtain Lyeopene.
In aforesaid method, the every liter of composition of fermention medium in described fermentation culture is as follows:
10g glycerine, 1.7g citric acid, 10.5g KH
2pO
43H
2o, 6g (NH
4)
2hPO
4, 3.44g MgSO
47H
2o, 10ml trace element solution, surplus is water;
Every liter of composition of described trace element solution is as follows: 10g FeSO
47H
2o, 5.25g ZnSO
47H
2o, 3.0gCuSO
45H
2o, 0.5g MnSO
44H
2o, 0.23g Na
2b
4o
710H
2o, 2.0g CaC1
2, 0.1g (NH
4)
6mo
7o
24, surplus is water.
The condition of described fermentation is specially 30 ℃ of temperature, and air flow quantity is 4L/min, and dissolved oxygen is that 30%, pH is 7.0;
Described pH specifically regulates by ammoniacal liquor;
In described fermentation, glycerol concentration remains on below 0.2g/L, and the output of acetic acid maintains below 0.1g/L.
In above-mentioned arbitrary described method, described method also comprises the step of adding supplemented medium, and every liter of composition of described supplemented medium is as follows: 500g glycerine, 15g peptone, 30g yeast extract, 30g MgSO
47H
2o, surplus is water.
Above-mentioned arbitrary described recombinant bacterium also belongs to protection scope of the present invention in the application of producing in Lyeopene.
Bacterial strain yield of lycopene provided by the invention is high, has very high production application and is worth.
Accompanying drawing explanation
Fig. 1 is the approach that after introducing Lyeopene synthetic gene, intestinal bacteria generate Lyeopene.
Fig. 2 is Lyeopene bioassay standard curve.
Fig. 3 is the schematic diagram that two step homologous recombination techniques knock out crtXY gene.A is the first step homologous recombination, and B is second step homologous recombination.
Fig. 4 is used two step homologous recombination techniques to carry out after the regulation and control of RBS library the dxs gene of LYC005 bacterial strain, the variation of yield of lycopene.
Fig. 5 is used two step homologous recombination techniques to carry out after the regulation and control of RBS library the idi gene of LYC005 bacterial strain, the variation of yield of lycopene.
Fig. 6 is used two step homologous recombination techniques to carry out after the regulation and control of RBS library the crtE gene of LYC005 bacterial strain, the variation of yield of lycopene.
Fig. 7 is used two step homologous recombination techniques to carry out after the regulation and control of RBS library the dxs gene of LYC008 bacterial strain, the variation of yield of lycopene.
Fig. 8 is used two step homologous recombination techniques to carry out after the regulation and control of RBS library the idi gene of LYC009 bacterial strain, the variation of yield of lycopene.
Fig. 9 is that recombination bacillus coli LYC010 high density fermentation is produced Lyeopene.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Recombinant bacterial strain M1-46 and M1-93 disclosed in document " Lu; J.; J.Tang; et al. (2012) .Combinatorial modulation of galP and glkgene expression for improved alternative glucose utilization.ApplMicrobiolBiotechnol93 (6): 2455-2462. ", and the public can obtain from Tianjin Institute of Industrial Biotechnology.
Lyeopene is purchased from Sigma, and catalog number is L9879.
PXZ-CS plasmid disclosed in document " Tan Z; Zhu X; Chen J; Li Q; Zhang X (2013) Activating phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase in combination for improving succinate production.Appl Environ Microbiol79 (16): 4838-4844. ", and the public can obtain from Tianjin Institute of Industrial Biotechnology.
PKD46 plasmid is at document " Datsenko, wanner.One-step inactivation of chromosomalgenes in Escherichia coli K-12using PCR products.Proc Natl Acad Sci USA.2000.97 (12): 6640-6645; " in disclosed, the public can obtain from Tianjin Institute of Industrial Biotechnology.
Recombination bacillus coli CAR001 is to disclose in CN103087972A, the patent of invention of denomination of invention for " producing recombinant microorganism and the construction process of terpenoid " at publication number, and the public can obtain from Tianjin Institute of Industrial Biotechnology.The preparation method of recombination bacillus coli CAR001 see publication number be CN103087972A, denomination of invention in the patent of invention of " producing recombinant microorganism and the construction process of terpenoid " [0104] to [0244] section.
The preparation method of salt-free LB is as follows:
1.50% sucrose solution: take 500g sucrose, be dissolved in 1L ultrapure water, 115 ℃, sterilizing 20min.
2.10% salt-free sucrose LB substratum: take 5g yeast extract paste, 10g peptone in 800ml water, 115 ℃, sterilizing 20min.After sterilizing, add 50% the sucrose solution of 200ml.
3.6% salt-free sucrose LB substratum: take 5g yeast extract paste, 10g peptone, 15g agar powder, is dissolved in 880ml water, and 115 ℃, sterilizing 20min.After sterilizing, add 50% the sucrose solution of 120ml.
In embodiment, the concentration of paraxin, ammonia benzyl mycin, kantlex is 34 μ g/L, 50 μ g/L, 50 μ g/L respectively.
One, the drafting of Lyeopene typical curve
The standard substance 50mg that accurately takes Lyeopene adds 1ml methylene dichloride to dissolve, and solution is transferred in the brown volumetric flask of 250ml, is settled to 250ml with sherwood oil, is mixed with the storing solution (being stored in-80 ℃ of refrigerators) of 200 μ g/ml.During use with acetone carry out doubling dilution (2 ×, 4 ×, 8 ×, 16 ×, 32 ×), the filtering with microporous membrane of 0.45 μ m to HPLC sample injection bottle, carry out HPLC detection (adopt
c18 post (4.6 × 250mm, 5 μ are m); Column temperature: 30 ℃; Moving phase: methyl alcohol: acetonitrile: methylene dichloride=21:21:8(volume ratio); Flow velocity: 1ml/min; Sample size: 20 μ l; Sample injection time: 20min; DAD lamp detects; Detection wavelength is 480nm, and take standard substance peak area as ordinate zou, lycopene concentration (mg/L) is X-coordinate, obtains the typical curve of Lyeopene, as shown in Figure 2.
Two, the mensuration of recombination bacillus coli Lyeopene
By producing the recombination bacillus coli of Lyeopene, choose single bacterium colony (according to fermentation strain situation, add corresponding microbiotic or added with antibiotic not) in the test tube of the LB of 4ml substratum, 37 ℃ of 250rpm incubated overnight 24 hours; Then according to the inoculum size of volumn concentration 1%, the seed liquor of incubated overnight is transferred to containing in the little shaking flask of 10ml LB substratum (100ml), 37 ℃, 250rpm lucifuge are cultivated after 24h, sampling and measuring yield of lycopene.Measuring method is as follows:
Get the bacterium liquid of 0.5ml cultivation in the centrifugal 3min of 14000rpm, after sterile water wash, with 1ml acetone, suspend and precipitate, under 55 ℃ of dark conditions, extract 15 minutes, then by sample under 14000rpm centrifugal 10 minutes, supernatant took on a red color, and bacterial strain becomes white from redness after acetone extract, the supernatant that contains Lyeopene, after the filtering with microporous membrane of 0.45 μ m, is carried out to assay with HPLC; When HPLC checks, the appearance time in sample identical with the appearance time of Lyeopene in standard substance (appearance time is 11.3min).Each testing sample has respectively 3 Duplicate Samples, and experimental result is got three parallel mean values.
One, knocking out the crtX of recombination bacillus coli CAR001 and the gene constructed recombinant bacterium LYC001 of crtY recombinant bacterium LYC001 is that zeaxanthin glycosyltransferase gene crtX and the lycopene beta cyclase gene crtY that recombination bacillus coli CAR001 is replaced in described β-carotene synthetic gene bunch obtains.Zeaxanthin glycosyltransferase gene crtX is as shown in SEQ ID No.1, and lycopene beta cyclase gene crtY is as shown in SEQ ID No.2.Adopt the method for two step homologous recombination, knock out crtX and crtY gene, between yak base yak base diphosphate synthase gene crtE and Phytoene dehydrogenase gene crtI, insert the artificial RBS sequence (shown in SEQ ID No.3) that is applicable to genetic expression in intestinal bacteria simultaneously.By two pairs of general primers, utilize the method for PCR to amplify the fragment for two step homologous recombination.
Utilize CrtE-taa-cat-f(to comprise to knock out 5 ' end of 50bp base and cat-sacB gene before gene locus to play 20bp homologous fragment) and CrtI-atg-cat-r(comprise knock out 3 ' of 50bp base and cat-sacB gene after gene locus and hold homologous fragment) amplify DNA fragmentation I, carry out the first step homologous recombination, will crtX be knocked out and crtY Gene Replacement be cat-sacB fragment, as shown in Figure 3A.
Utilize CrtEI-RBS-f(to comprise 20bp homologous fragment after crtE gene 3 ' end 50bp base, artificial RBS sequence and crtI gene start codon ATG) and CrtI-484-r primer, amplify DNA fragmentation II, carry out second step homologous recombination, cat-sacB fragment is replaced with to artificial RBS sequence (SEQ ID No.3), as shown in Figure 3 B.
Concrete steps are as follows:
(1), take pXZ-CS plasmid as template, with primer CrtE-taa-cat-f and the CrtI-atg-cat-r about 3500bpDNA fragment I that increases, this fragment is the DNA fragmentation I that contains chloromycetin gene and Polylevulosan sucrose transferase gene.
Primer sequence is:
CrtE-taa-cat-f：
5’-ACCATTTTGTTCAGGCCTGGTTTGAGAAAAAACTCGCTGCCGTCAGTTAATGTGACGGAAGATCACTTCGCA-3’；
CrtI-atg-cat-r：
5’-GCCAGAGCCAGACCACCAAAGCCTGCGCCAATTACTGTAGTTCTATTCATTTATTTGTTAACTGTTAATTGTCCT-3’。
With the preparation of the intestinal bacteria CAR001 of pKD46: preparation method is shown in that publication number is CN103087972A, denomination of invention in the patent of invention of " producing recombinant microorganism and the construction process of terpenoid " [0253].
By above-mentioned, obtain after the cleaning of pcr amplification product DNA fragmentation I PCR cleaning reagent box, DpnI processes, and then DNA fragmentation I electricity is gone to the intestinal bacteria CAR001 with pKD46.The bacterium liquid of getting 200 μ l conversions is coated on the LB flat board that contains paraxin and ammonia benzyl, after 30 ℃ of incubated overnight, on the dull and stereotyped LB flat board with containing kantlex of the LB that contains paraxin and ammonia benzyl, screen respectively, obtain on kantlex LB flat board not long, the clone of length on paraxin and ammonia benzyl LB flat board, use primer cat-up and CrtI-484-r to carry out bacterium colony PCR checking, result recombinant bacterium is correct, the pcr amplified fragment and the bacterium generation homologous recombination that import, by crtX and crtY gene knockout, make in bacterium in the middle of crtE and crtI gene with cat-sacB gene, by this recombinant bacterium called after cat-sacB-CAR001, this bacterium can be used for second step homologous recombination.
Checking primer sequence is:
cat-up：5’-TGTGACGGAAGATCACTTCGCA-3’；
CrtI-484-r：5’-GCCTGAAGTTTTGCCAGCTG-3’。
(2) take the genomic dna of recombinant bacterial strain CAR001 as template, take CrtEI-RBS-f and CrtI-484-r as primer, carry out pcr amplification, obtain DNA fragmentation II.
Primer sequence is:
CrtEI-RBS-f：
5’-ACCATTTTGTTCAGGCCTGGTTTGAGAAAAAACTCGCTGCCGTCAGTTAACTAAGGAGATATACCATGAATAGAACTACAGTAAT-3’；
CrtI-484-r：5’-GCCTGAAGTTTTGCCAGCTG-3’。
DNA fragmentation II electricity goes to step the cat-sacB-CAR001 that () obtains.Transformed bacteria liquid is proceeded in the salt-free LB+10% sucrose medium of 50ml, and 37 ℃, 250rpm concussion are cultivated after 24h, and at the flat lining out of salt-free LB+6% sucrose, 41 ℃ of incubated overnight, remove pKD46 plasmid.Dull and stereotyped at the LB that contains paraxin and containing on antibiotic LB flat board, do not screen respectively, obtain, containing not long clone on the LB flat board of paraxin, carrying out PCR checking, use primer crtE-540-f and CrtI-484-r to verify.
crtE-540-f：5’-TGACGCCATTCTGATGACCA-3’；
CrtI-484-r：5’-GCCTGAAGTTTTGCCAGCTG-3’。
By bacterial strain called after LYC001 correct sequence verification.
Two, recombination bacillus coli LYC001 fermentative production Lyeopene
Recombination bacillus coli LYC001 is chosen to single bacterium colony in the test tube of the LB of 4ml substratum, 37 ℃, 250rpm incubated overnight; Then according to the inoculum size of volumn concentration 1%, the seed liquor of incubated overnight is transferred in the 100ml triangular flask containing 10ml LB nutrient solution, 37 ℃, 250rpm lucifuge are cultivated after 24h, sampling and measuring yield of lycopene, and each sample does three repetitions.According to the method for embodiment 1, measure the yield of lycopene of LYC001.
The yield of lycopene that the results are shown in Table 1, LYC001 reaches 10.49mg/L, and Lyeopene accounts for dry cell weight and reaches 6.52mg/g.
The expression intensity of the alph-ketoglutaric acid dehydrase gene of embodiment 3, raising recombination bacillus coli LYC001
One, improve the expression intensity structure recombination bacillus coli LYC002 of the alph-ketoglutaric acid dehydrase gene of recombination bacillus coli LYC001
Recombinant bacterium LYC002 changes the original controlling element of the sucAB gene of LYC001 into artificial regulatory element M1-46 to obtain, and the original controlling element of sucAB gene is as shown in SEQ ID No.4, and artificial regulatory element M1-46 is as shown in SEQ IDNo.5.
According to the two step homologous recombination methods similar to embodiment 2, change the original controlling element of sucAB gene in LYC001 into artificial regulatory element M1-46, concrete grammar is as follows:
(1) take pXZ-CS plasmid as template, SucAB-cat-up and SucAB-cat – down are primer, and PCR obtains the DNA fragmentation I of 3400bp left and right; Then DpnI goes to the intestinal bacteria LYC001 with pKD46 by DNA fragmentation I electricity after processing.The bacterium liquid of getting 200 μ l conversions is coated on the LB flat board that contains paraxin and ammonia benzyl, after 30 ℃ of incubated overnight, on the dull and stereotyped LB flat board with containing kantlex of the LB that contains paraxin ammonia benzyl, screen respectively, obtain on kantlex LB flat board not long, the clone of length on paraxin ammonia benzyl LB flat board, use the primer cat-up(sequence identical with embodiment 2) and sucAB-r enter bacterium colony PCR and verify, result recombinant bacterium is correct, this recombinant bacterium is the intestinal bacteria LYC001 with cat-sacB before sucAB gene, by its called after cat-sacB-LYC001, this bacterium can be used for second step homologous recombination.
(2) take the genomic dna of M1-46 as template, amplimer is SucAB-up-P/SucAB-RBS-down, and pcr amplification obtains the DNA fragmentation II of 200bp left and right; DNA fragmentation II electricity go to step that (one) obtain containing in the cat-sacB-LYC001 of pKD46.Transformed bacteria liquid is proceeded in the salt-free LB+10%surcose substratum of 50ml, and 37 ℃, 250rpm concussion are cultivated after 24h, and at the flat lining out of salt-free LB+6%surcose, 41 ℃ of incubated overnight, remove pKD46 plasmid.Dull and stereotyped at the LB that contains paraxin and containing on antibiotic LB flat board, do not screen respectively, obtain, containing not long clone on the LB flat board of paraxin, carrying out PCR checking, use primer P-up and sucAB-r to verify.Obtain correct recombination bacillus coli LYC002.
The primer sequence of amplification is as follows:
SucAB-cat-up：5’-GGTAGTATCCACGGCGAAGTAAGCATAAAAAAGATGCTTAAGGGATCACGTGTGACGGAAGATCACTTCGCA-3’；
SucAB-cat–down：5’-CCAGAGAGGTAAGAAGAGTCCAACCAGGCTTTCAAAGCGCTGTTCTGCATTTATTTGTTAACTGTTAATTGTCCT-3’。
sucAB-up-P：5’-GGTAGTATCCACGGCGAAGTAAGCATAAAAAAGATGCTTAAGGGATCACGTTATCTCTGGCGGTGTTGAC-3’；
sucAB-RBS-down：
5’-CCAGAGAGGTAAGAAGAGTCCAACCAGGCTTTCAAAGCGCTGTTCTGCATAGCTGTTTCCTGGTT-3’。
The PCR primers designed sequence of above-mentioned restructuring is:
P-up：5’-TTATCTCTGGCGGTGTTGAC-3’；
sucAB-r：5’-GAAATATTCACGCGTTTGAG-3’。
PCR is verified to correct bacterial strain send order-checking, and after sequence verification is correct, the controlling element that obtains the sucAB gene of LYC001 changes the bacterial strain of artificial regulatory element M1-46 into, by its called after recombination bacillus coli LYC002.
Two, recombination bacillus coli LYC002 produces Lyeopene
Recombination bacillus coli LYC002 is carried out to fermentation culture, measures yield of lycopene according to the method for embodiment 1.The results are shown in Table 1, recombination bacillus coli LYC002 produces yield of lycopene and reaches 15.36mg/L, unit cell content reaches 10.67mg/g, and after the original regulating and controlling sequence of the sucAB to LYC001 is replaced, the unit cell content of the Lyeopene of the LYC002 obtaining has improved 64% with respect to LYC001.
The expression intensity of the alph-ketoglutaric acid dehydrase gene of embodiment 4, combinatorial regulation recombination bacillus coli LYC002 and transaldolase gene (talB)
One, the expression intensity of the alph-ketoglutaric acid dehydrase gene of combinatorial regulation recombination bacillus coli LYC002 and transaldolase gene builds recombination bacillus coli LYC003
Recombination bacillus coli LYC003 changes the original controlling element of the talB gene of LYC002 into artificial regulatory element M1-46, and the original controlling element of talB gene is as shown in SEQ ID No.6; Artificial regulatory element M1-46 is as shown in SEQ IDNo.5.
According to the two step homologous recombination methods similar to embodiment 2, concrete grammar is as follows:
The amplification template of the first step homologous recombination is pXZ-CS plasmid, and primer is talB-cat-up and talB-cat – down, and checking primer is cat-up and talB-300-down.
The amplimer sequence of homologous recombination is:
talB-cat-up：5’-AGTCTCGCCTGGCGATAACCGTCTTGTCGGCGGTTGCGCTGACGTTGCGTCGTGTGTGACGGAAGATCACTTCGCA-3’；
talB-cat–down：5’-TCATGATAGTATTTCTCTTTAAACAGCTTGTTAGGGGGATGTAACCGGTCTGCTTATTTGTTAACTGTTAATTGTCCT-3’。
After PCR product D pnI processes, electricity goes to the intestinal bacteria LYC002 with pKD46.The bacterium liquid of getting 200 μ l conversions is coated on the LB flat board that contains paraxin ammonia benzyl, after 30 ℃ of incubated overnight, on the dull and stereotyped LB flat board with containing kantlex of the LB that contains paraxin ammonia benzyl, screen respectively, obtain on kantlex LB flat board not long, the clone of length on paraxin ammonia benzyl LB flat board, use primer cat-up and talB-300-down to carry out bacterium colony PCR checking, result recombinant bacterium is correct, this recombinant bacterium is the intestinal bacteria LYC002 with cat-sacB before talB gene, and this bacterium can be used for second step homologous recombination.
The amplification template of second step homologous recombination is the genomic dna of M1-46, take talB-up-P and talB-RBS-down as primer, and amplification second step homology band.
The amplimer sequence of homologous recombination is:
talB-up-P：5’-AGTCTCGCCTGGCGATAACCGTCTTGTCGGCGGTTGCGCTGACGTTGCGTCGTGTTATCTCTGGCGGTGTTGAC-3’；
talB-RBS-down：5’-AGTGTCGGCCACTACGGTGGTGTACTGACGAAGGGAGGTCAATTTGTCCGTCATAGCTGTTTCCTGGTT-3’。
The primers designed of above-mentioned second step homologous recombination is P-up and talB-300-down.
talB-300-down:5’-GACGCTTCGGTGTCATAGGAAAG-3’；
PCR product is the DNA fragmentation II of 200bp left and right; DNA fragmentation II electricity go to step that (one) obtain containing in bacterial strain in the middle of the first step gained of pKD46.Transformed bacteria liquid is proceeded in the salt-free LB+10% sucrose medium of 50ml, and 37 ℃, 250rpm concussion are cultivated after 24h, and at the flat lining out of salt-free LB+6% sucrose, 41 ℃ of incubated overnight, remove pKD46 plasmid.Dull and stereotyped at the LB that contains paraxin and containing on antibiotic LB flat board, do not screen respectively, obtain, containing not long clone on the LB flat board of paraxin, carrying out PCR checking, use primer P-up and talB-300-down to verify.After recombinant bacterium sequence verification that second step obtains is correct, the original controlling element of the talB gene of LYC002 is changed into the bacterial strain called after recombination bacillus coli LYC003 of artificial regulatory element M1-46.
Two, recombination bacillus coli LYC003 produces Lyeopene
Recombination bacillus coli LYC003 is carried out to fermentation culture, measures yield of lycopene according to the method for embodiment 1.
The results are shown in Table 1, recombination bacillus coli LYC003 unit cell content reaches 11.03mg/g, and after the sucAB to LYC001 and talB combinatorial regulation, the unit cell content of the Lyeopene of the LYC003 obtaining has improved 70% with respect to LYC001.
The expression intensity of the succinate dehydrogenase gene (sdhABCD) of embodiment 5, combinatorial regulation recombination bacillus coli LYC003
One, the structure of recombination bacillus coli LYC005
Recombination bacillus coli LYC005 replaces with artificial regulatory element M1-46 by the original controlling element of the sdhABCD gene of recombination bacillus coli LYC003, and the original controlling element of sdhABCD gene is as shown in SEQ ID No.7.Artificial regulatory element M1-46 is as shown in SEQ ID No.5.
According to the two step homologous recombination methods similar to embodiment 2, concrete grammar is as follows:
The amplification template of the first step homologous recombination is pXZ-CS plasmid, and primer is SdhABCD-cat-up and SdhABCD-cat – down, and checking primer is cat-up and sdhABCD-230-down.
Homologous recombination primer:
SdhABCD-cat-up：5’-ACTTTGTTGAATGATTGTCAAATTAGATGATTAAAAATTAAATAAATGTT?TGTGACGGAAGATCACTTCGCA-3’；
SdhABCD-cat–down：5’-TTAACAGGTCTTTGTTTTTTCACATTTCTTATCATGAATAACGCCCACATTTATTTGTTAACTGTTAATTGTCCT-3’。
After PCR product D pnI processes, electricity goes to the intestinal bacteria LYC003 with pKD46.The bacterium liquid of getting 200 μ l conversions is coated on the LB flat board that contains paraxin and ammonia benzyl, after 30 ℃ of incubated overnight, on the dull and stereotyped LB flat board with containing kantlex of the LB that contains paraxin ammonia benzyl, screen respectively, obtain on kantlex LB flat board not long, the clone of length on paraxin ammonia benzyl LB flat board, use primer cat-up and sdhABCD-230-down to enter bacterium colony PCR checking, result recombinant bacterium is correct, this recombinant bacterium is the intestinal bacteria LYC003 with cat-sacB before sdhABCD gene, and this bacterium can be used for second step homologous recombination.
The genomic dna that the template of second step homologous recombination amplification is M1-46, take SdhABCD-up-P and SdhABCD-RBS-down as primer, amplification second step homology band.
Homologous recombination primer:
SdhABCD-up-P：5’-ACTTTGTTGAATGATTGTCAAATTAGATGATTAAAAATTAAATAAATGTT?TTATCTCTGGCGGTGTTGAC-3’；
SdhABCD-RBS-down:5’-TTAACAGGTCTTTGTTTTTTCACATTTCTTATCATGAATAACGCCCACATAGCTGTTTCCTGGTT-3’。
In the primers designed of above-mentioned two steps, sdhABCD-230-down sequence is as follows:
sdhABCD-230-down：5’-AATTTGACGAAGAAGCTGC-3’；
Template bacterial strain is that recombinant bacterial strain M1-46, amplimer are SdhABCD-up-P/SdhABCD-RBS-down, obtains the DNA fragmentation II of 200bp left and right; DNA fragmentation II electricity goes to containing in bacterial strain in the middle of the first step gained of pKD46.Transformed bacteria liquid is proceeded in the salt-free LB+10%surcose substratum of 50ml, and 37 ℃, 250rpm concussion are cultivated after 24h, and at the flat lining out of salt-free LB+6%surcose, 41 ℃ of incubated overnight, remove pKD46 plasmid.Dull and stereotyped at the LB that contains paraxin and containing on antibiotic LB flat board, do not screen respectively, obtain containing not long clone on the LB flat board of paraxin, carry out PCR checking, use primer P-up and sdhABCD-230-down to verify, the fragment that obtains 320bp left and right is positive.After recombinant bacterium sequence verification that second step obtains is correct, the controlling element of the sdhABCD gene of LYC003 is replaced with to the bacterial strain called after recombination bacillus coli LYC005 of artificial regulatory element M1-46.
Two, recombination bacillus coli LYC005 produces Lyeopene
Recombination bacillus coli LYC005 is carried out to fermentation culture, measures yield of lycopene according to the method for embodiment 1.
The results are shown in Table 1, recombination bacillus coli LYC005 unit cell content reaches 11.53mg/g DCW, after sucAB, talB to LYC003 and sdhABCD assortment of genes regulation and control, the unit cell content of the Lyeopene of the LYC005 obtaining has improved 76% with respect to LYC001.
The dxs genetic expression intensity of embodiment 6, two-step approach regulation and control recombination bacillus coli LYC005 improves Lyeopene and produces
One, the dxs genetic expression intensity of two-step approach regulation and control recombination bacillus coli LYC005
According to the two step homologous recombination methods similar to embodiment 2, the original artificial regulatory element of the dxs gene M1-37 of recombination bacillus coli LYC005 is replaced with to RBS controlling element library.The sequence of M1-37 is as shown in SEQ ID No.8.The sequence in RBS controlling element library is as shown in SEQ ID No.9.
Concrete grammar is as follows:
The amplification template of the first step homologous recombination is pXZ-CS plasmid, and primer is dxs-cat-up and dxs-cat – down, and checking primer is cat-up and dxs-381-down.
Homologous recombination primer:
dxs-cat-up：5’-ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAATAGGCCCCTGTGTGACGGAAGATCACTTCGCA-3’；
dxs-cat-down：5’-GTGGAGTCGACCAGTGCCAGGGTCGGGTATTTGGCAATATCAAAACTCATTTATTTGTTAACTGTTAATTGTCCT-3’；
After PCR product D pnI processes, electricity goes to the intestinal bacteria LYC005 with pKD46.The bacterium liquid of getting 200 μ l conversions is coated on the LB flat board that contains paraxin and ammonia benzyl, after 30 ℃ of incubated overnight, on the dull and stereotyped LB flat board with containing kantlex of the LB that contains paraxin ammonia benzyl, screen respectively, obtain on kantlex LB flat board not long, the clone of length on paraxin ammonia benzyl LB flat board, use primer cat-up and dxs-381-down to carry out bacterium colony PCR checking, result recombinant bacterium is correct, this recombinant bacterium is the intestinal bacteria LYC005 with cat-sacB before dxs gene, and this bacterium can be used for second step homologous recombination.
The genomic dna that the template of second step homologous recombination amplification is M1-93, homologous recombination primer is dxs-up-P and dxs-RBSL-down, and upstream primer dxs-up-P comprises 50bp base and the M1-93(SEQ ID No.10 outside the original promotor of dxs gene to be regulated and controled) 5 ' end of artificial regulatory element play 20bp homologous fragment.Downstream primer dxs-RBSL-down comprises that 3 ' end of the degenerate primer fragment (5 '-CAGGAGRNNNNNN-3 ') in 50bp base after regulating and controlling the initiator codon of dxs gene (gene+1 to+50 district), RBS district and the artificial regulatory element of M1-93 plays 20bp homologous fragment.This can amplify Yi Zu RBS district to primer is the artificial regulatory element that annexs sequence, by this set of pieces, carries out second step homologous recombination, can obtain dxs library.
Second step homologous recombination primer sequence is as follows:
dxs-up-P：5’-ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAATAGGCCCCTGTTATCTCTGGCGGTGTTGAC-3’；
dxs-RBSL-down：
5’-GTGGAGTCGACCAGTGCCAGGGTCGGGTATTTGGCAATATCAAAACTCATNNNNNNYCTCCTGGTTTAAACGTACATG-3’；
In the primers designed of above-mentioned two steps, the sequence of dxs-381-down is:
dxs-381-down：5’-GATGGAGGTTGATGAATGC-3’；
With the genomic dna template of M1-93 bacterial strain, pcr amplification goes out RBS and mixes fragment, and electricity after this fragment purification is proceeded in the competent cell of the first step obtained strains, in 250mL triangular flask (containing the salt-free sucrose medium of 50mL), cultivates 12h.Then bacterium liquid is diluted, is applied on 2 salt-free sucrose flat boards 37 ℃ of incubated overnight.Each flat board obtains 300 left and right recons, and totally 600 left and right recons, are dxs library.Random 100 of pickings are cloned in and on paraxin flat board, carry out primary dcreening operation, more than 90% all for reassemble into merit bacterial strain (can not grow) on paraxin flat board.Select at random 5 bacterial strain order-checkings, the sequence in RBS region is different, shows that the diversity in storehouse is abundanter.
30 mono-clonals of random choose, carry out PCR checking with primer p-up/dxs-381-down, after homologous recombination, identify that for the second time the fragment obtaining about 470bp is positive, selects 15 and verifies correct, the redder clone's called after dxs1-dxs15 of color, for measuring yield of lycopene.
Two, the 15 strain dxs library bacterial strains that recombination bacillus coli LYC005 sets out are produced Lyeopene
By the dxs1-dxs15 obtaining totally 15 strain recombination bacillus colis according to the method for embodiment 1, carry out fermentation culture, measure yield of lycopene, simultaneously take LYC005 as contrast, the Lyeopene fractional yield result of 15 strain bacterium as shown in Figure 4.
Fig. 4 shows, LYC005 is after the controlling element of dxs gene replaces with artificial regulatory element, 0.73 to 1.13 times of the yield of lycopene that the yield of lycopene of the 15 strain bacterium that obtain is LYC005, wherein there is the yield of lycopene of 6 strain bacterium higher than the yield of lycopene of contrast LYC005, the yield of lycopene of the bacterial strain dxs8 that output is the highest is 18.34mg/L, and unit cell content reaches 13.08mg/g.
The idi genetic expression intensity of embodiment 7, two-step approach regulation and control recombination bacillus coli LYC005 improves Lyeopene and produces
One, according to two step homologous recombination methods similar to Example 6, the original artificial regulatory element of the idi gene M1-46 (SEQ ID No.5) of recombination bacillus coli LYC005 is replaced with to the RBS controlling element library described in embodiment 6 (SEQ ID No.9).
The amplification template of the first step homologous recombination is pXZ-CS plasmid, and primer is idi-cat-up and idi-cat-down, and checking primer is cat-up and idi-483-down.
Homologous recombination primer:
idi-cat-up：5’-TCACTTGGTTAATCATTTCACTCTTCAATTATCTATAATGATGAGTGATCTGTGACGGAAGATCACTTCGCA-3’；
idi-cat-down：5’-CCCGTGGGAACTCCCTGTGCATTCAATAAAATGACGTGTTCCGTTTGCATTTATTTGTTAACTGTTAATTGTCCTTG-3’；
After product D pnI processes, electricity goes to the intestinal bacteria LYC005 with pKD46.The bacterium liquid of getting 200 μ l conversions is coated on the LB flat board that contains paraxin and ammonia benzyl, after 30 ℃ of incubated overnight, on the dull and stereotyped LB flat board with containing kantlex of the LB that contains paraxin ammonia benzyl, screen respectively, obtain on kantlex LB flat board not long, the clone of length on paraxin ammonia benzyl LB flat board, use primer cat-up and idi-483-down to enter bacterium colony PCR checking, result recombinant bacterium is correct, this recombinant bacterium is the intestinal bacteria LYC005 with cat-sacB before idi gene, and this bacterium can be used for second step homologous recombination.
The genomic dna that the template of second step homologous recombination amplification is M1-93, homologous recombination primer is idi-u
p-P and idi-RBSL-down, this can amplify Yi Zu RBS district to primer is the promoter element that annexs sequence, by this set of pieces, carries out second step homologous recombination, can obtain idi library.
Second step homologous recombination primer sequence is as follows:
idi-up-P：
5’-TCACTTGGTTAATCATTTCACTCTTCAATTATCTATAATGATGAGTGATCTTATCTCTGGCGGTGTTGAC-3’；
idi-RBSL-down：
5’-CCCGTGGGAACTCCCTGTGCATTCAATAAAATGACGTGTTCCGTTTGCATNNNNNNYCTCCTGGTTTAAACGTACATG-3’；
In the checking primer of above-mentioned two steps, idi-483-down sequence is:
idi-483-down：5’-CGTGGCATCAATACCGTGTA-3’；
With the genomic dna template of M1-93 bacterial strain, pcr amplification goes out RBS and mixes fragment, and electricity after this fragment purification is proceeded in the competent cell of the first step obtained strains, in 250mL triangular flask (containing the salt-free sucrose medium of 50mL), cultivates 12h.Then bacterium liquid is diluted, is applied on 2 salt-free sucrose flat boards 37 ℃ of incubated overnight.Each flat board obtains 300 left and right recons, and totally 600 left and right recons, are idi library.Random 100 of pickings are cloned in and on paraxin flat board, carry out primary dcreening operation, more than 90% all for reassemble into merit bacterial strain (can not grow) on paraxin flat board.Select at random 5 bacterial strain order-checkings, the sequence in RBS region is different, shows that the diversity in storehouse is abundanter.
30 mono-clonals of random choose, carry out PCR checking with primer p-up/idi-483-down, after homologous recombination, identify that for the second time the fragment obtaining about 570bp is positive, selects 15 and verifies correct, the redder clone's called after idi1-idi15 of color, for measuring yield of lycopene.
Two, the 15 strain idi library bacterial strains that recombination bacillus coli LYC005 sets out are produced Lyeopene
By the idi1-idi15 obtaining totally 15 strain recombination bacillus colis according to the method for embodiment 1, carry out fermentation culture, measure yield of lycopene, simultaneously take LYC005 as contrast, the Lyeopene fractional yield result of 15 strain bacterium as shown in Figure 5.
Fig. 5 shows, in selected 15 bacterial strains, there is the yield of lycopene of 8 strain bacterium all higher than the yield of lycopene that contrasts LYC005, the yield of lycopene of 15 bacterial strains is between 0.67 times to 1.13 times of LYC005, wherein the yield of lycopene of idi9 is the highest, and output is that 18.28mg/L, unit cell content reach 13.01mg/g.
The crtE genetic expression intensity of embodiment 8, two-step approach regulation and control recombination bacillus coli LYC005 improves Lyeopene and produces
One, according to two step homologous recombination methods similar to Example 6, the original artificial regulatory element of the crtE gene M1-93 (SEQ ID No.10) of recombination bacillus coli LYC005 is replaced with to the RBS controlling element library described in embodiment 6 (SEQ ID No.9).
The amplification template of the first step homologous recombination is pXZ-CS plasmid, and primer is ldhA-up-cat and crtE-sacB-down, and checking primer is cat-up and crtE-340-down.
Homologous recombination primer
ldhA-up-cat：
5’-ATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGTGATTCATGTGACGGAAGATCACTTCGCA-3’；
crtE-sacB-down：5’-GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACCGTCATCATTTATTTGTTAACTGTTAATTGTCCTTG-3’；
After product D pnI processes, electricity goes to the intestinal bacteria LYC005 with pKD46.The bacterium liquid of getting 200 μ l conversions is coated on the LB flat board that contains paraxin and ammonia benzyl, after 30 ℃ of incubated overnight, on the dull and stereotyped LB flat board with containing kantlex of the LB that contains paraxin ammonia benzyl, screen respectively, obtain on kantlex LB flat board not long, the clone of length on paraxin ammonia benzyl LB flat board, use primer cat-up and crtE-sacB-down to enter bacterium colony PCR checking, result recombinant bacterium is correct, this recombinant bacterium is the intestinal bacteria LYC005 with cat-sacB before crtE gene, and this bacterium can be used for second step homologous recombination.
The genomic dna that the template of second step homologous recombination amplification is M1-93, homologous recombination primer is ldhA-up-P and crtE-RBSL-down, this can amplify Yi Zu RBS district to primer is the promoter element that annexs sequence.
Second step homologous recombination primer sequence is as follows:
ldhA-up-P：5’-TTCAATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGTGATTCA?TTATCTCTGGCGGTGTTGAC-3’；
crtE-RBSL-down：5’-GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACCGTCATCATNNNNNNYCTCCTGGTTTAAACGTACATG-3’；
In the primers designed of above-mentioned two steps, crtE-340-down sequence is:
crtE-340-down：5’-CGACATGTTCACCATACTG-3’；
With the genomic dna template of M1-93 bacterial strain, pcr amplification goes out RBS and mixes fragment, and electricity after this fragment purification is proceeded in the competent cell of the first step obtained strains, in 250mL triangular flask (containing the salt-free sucrose medium of 50mL), cultivates 12h.Then bacterium liquid is diluted, is applied on 2 salt-free sucrose flat boards 37 ℃ of incubated overnight.Each flat board obtains 300 left and right recons, and totally 600 left and right recons, are crtE library.Random 100 of pickings are cloned in and on paraxin flat board, carry out primary dcreening operation, more than 90% all for reassemble into merit bacterial strain (can not grow) on paraxin flat board.Select at random 5 bacterial strain order-checkings, the sequence in RBS region is different, shows that the diversity in storehouse is abundanter.
30 mono-clonals of random choose, carry out PCR checking with primer p-up/crtE-340-down, after homologous recombination, identify that for the second time the fragment obtaining about 420bp is positive, selects 15 and verifies correct, the redder clone's called after crtE1-crtE15 of color, for measuring yield of lycopene.
Two, the 15 strain crtE library bacterial strains that recombination bacillus coli LYC005 sets out are produced Lyeopene
According to the selected crtE1-crtE15 of method fermentation culture of embodiment 1 totally 15 strain bacterial strains, simultaneously take LYC005 as contrast, and measure the fractional yield of Lyeopene, result is as shown in Figure 6.
Fig. 6 shows, 0.88 times to 1.14 times of the selected crtE1-crtE15 yield of lycopene that the yield of lycopene of totally 15 strain bacterial strains is LYC005, there is the yield of lycopene of 3 strain bacterium higher than the yield of lycopene of LYC005, wherein crtE9 yield of lycopene is the highest, output is 20.9mg/L, unit cell content reaches 13.2mg/g, by this bacterial strain called after LYC008.In LYC008, the artificial RBS controlling element sequence of crtE is as shown in SEQ ID No.11.
The dxs of embodiment 9, artificial RBS controlling element storehouse regulation and control recombination bacillus coli LYC008 and the expression intensity of idi gene improve Lyeopene and produce
Embodiment 6 to embodiment 8 shows, from LYC005, regulates and controls after dxs, idi and crtE gene separately respectively, and yield of lycopene all improves to some extent, and three genes are built to storehouse regulation and control at same bacterial strain, must obtain higher output yield.
One, the present embodiment is from recombination bacillus coli LYC008, in strict accordance with the RBS controlling element library regulation and control dxs gene described in embodiment 6 for method of embodiment 6, obtain recombinating successfully and the correct bacterial strain of sequence verification, select at random 15 strains the promotor of the dxs gene of LYC008 to be changed into the bacterial strain of artificial RBS controlling element, respectively by its called after crtE9-dxs1, crtE9-dxs2, crtE9-dxs3, crtE9-dxs4, crtE9-dxs5, crtE9-dxs6, crtE9-dxs7, crtE9-dxs8, crtE9-dxs9, crtE9-dxs10, crtE9-dxs11, crtE9-dxs12, crtE9-dxs13, crtE9-dxs14, crtE9-dxs15.
Above-mentioned 15 strain bacterium are carried out to fermentation culture according to the method for embodiment 1, and measure yield of lycopene, measure LYC005 and LYC008(crtE9 simultaneously) yield of lycopene, result is as shown in Figure 7.After the dxs gene regulating of LYC008, the yield of lycopene of 15 strain bacterium is 0.77 to 1.15 times of yield of lycopene of LYC005, the bacterial strain that output is the highest is crtE9-dxs12, its yield of lycopene reaches 24.34mg/L, unit cell content reaches 13.30mg/g, with respect to LYC005, has improved 15%, with respect to LYC001, has improved 104%, by this bacterial strain called after LYC009, wherein the controlling element sequence of dxs is as shown in SEQ ID No.12.
Two, from LYC009, in strict accordance with the method for embodiment 7, with artificial RBS controlling element library regulation and control idi gene, obtain recombinating successfully and the correct bacterial strain of sequence verification, select at random 15 strains to be distinguished called after crtE9-dxs12-idi1, crtE9-dxs12-idi2, crtE9-dxs12-idi3, crtE9-dxs12-idi4, crtE9-dxs12-idi5, crtE9-dxs12-idi6, crtE9-dxs12-idi7, crtE9-dxs12-idi8, crtE9-dxs12-idi9, crtE9-dxs12-idi10, crtE9-dxs12-idi11, crtE9-dxs12-idi12, crtE9-dxs12-idi13, crtE9-dxs12-idi14, crtE9-dxs12-idi15.
15 strain bacterium are carried out to fermentation culture according to the method for embodiment 1, and measure yield of lycopene, measure LYC005, LYC008(crtE9 simultaneously) and yield of lycopene LYC009(crtE9-dxs12), result is as shown in Figure 8.Fig. 8 shows, after the idi gene regulating of LYC009, the yield of lycopene of 15 strain bacterium is 1.05 times to 1.32 times of yield of lycopene of LYC005, the bacterial strain that output is the highest is crtE9-dxs12-idi7, and its output reaches 26.33mg/L, and unit cell content reaches 15.22mg/g, yield of lycopene with respect to LYC005 has improved 32%, with respect to LYC001, improved 133%, by this bacterial strain called after LYC010, wherein shown in the controlling element sequence SEQ ID No.13 of idi.
Three, LYC010 is through being accredited as colon bacillus (Escherichia coli), this bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 23rd, 2013 and (is called for short CGMCC, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), preserving number is CGMCC No.8238.
The high density fermentation of embodiment 10, recombination bacillus coli LYC010
By recombination bacillus coli LYC010 at 7L fermentor tank (Labfors4; InforsBiotechnoligy Co.Ltd.) in carry out high density fermentation.Method is as follows:
One, choose single bacterium colony in the LB of 4ml substratum, 37 ℃, 250rpm incubated overnight.
Two, the inoculum size that is 1% according to volumn concentration, the bacterium liquid being about in 500 μ l test tubes is transferred in the 250ml triangular flask containing 50mlLB nutrient solution, and 37 ℃, 250rpm cultivates 12h, and the bacterium liquid obtaining is the seed liquor of high density fermentation.
Three, the 7L canned 3L fermention medium that ferments, 300ml seed liquor, adopts synthetic medium to carry out high density fermentation to it.
Fermention medium: by glycerine, citric acid, KH
2pO
43H
2o, (NH
4)
2hPO
4, MgSO
47H
2o, trace element solution and water composition; The content of each component is as follows: 10g/L glycerine, 1.7g/L citric acid, 10.5g/L KH
2pO
43H
2o, 6g/L (NH
4)
2hPO
4, 3.44g/L MgSO
47H
2o, 10ml/L trace element solution, surplus is water.
Trace element solution: by FeSO
47H
2o, ZnSO
47H
2o, CuSO
45H
2o, MnSO
44H
2o, Na
2b
4o
710H
2o, CaC1
2, (NH
4)
6mo
7o
24form with water; The content of each component is as follows: 10g/L FeSO
47H
2o, 5.25g/LZnSO
47H
2o, 3.0g/L CuSO
45H
2o, 0.5g/L MnSO
44H
2o, 0.23g/L Na
2b
4o
710H
2o, 2.0g/LCaC1
2, 0.1g/L (NH
4)
6mo
7o
24, surplus is water.
30 ℃ of leavening temperatures, air flow quantity 4L/min, dissolved oxygen is controlled at 30%.In order to make dissolved oxygen be controlled at 30%, rotating speed need with dissolved oxygen coupling, rotating speed remains on 400-1200rpm, dissolved oxygen bounce-back (primary carbon source has utilized) afterwards rotating speed raise gradually, reach and remain on 1200rpm always.Use 5M ammoniacal liquor that the pH of fermentation is controlled to 7.0.
Supplemented medium: by glycerine, peptone, yeast extract, MgSO
47H
2o composition; The content of each component is as follows: 500g/L glycerine, 15g/L peptone, 30g/L yeast extract, 30g/L MgSO
47H
2o, surplus is water.When being soon finished, the glycerine in fermention medium adds supplemented medium.
What fermentation adopted is simulation index flow feeding mode, and whole fermenting process remains on below 0.2g/L glycerol concentration, and the output of acetic acid is maintained below 0.1g/L, and average feed supplement speed is 25ml/h.Whole fermenting process is feed supplement 2.56L altogether, and 5M ammoniacal liquor consumes 500ml, and in fermented liquid, the final volume of substratum is 6.2L.
From fermentation, start after 10h, every 6h, get 2ml fermented liquid, in the centrifugal 3min of 14000rpm, with aqua sterilisa cleaning, by supernatant evacuation, be stored in-20 ℃ of refrigerators, survey in content of lycopene forward direction sample and add 1ml acetone, under 55 ℃ of dark conditions, extract 15min, the centrifugal 10min of 14000rpm, get supernatant and use HPLC(Agilent Technologies high performance liquid chromatograph 1260Infinity) survey content of lycopene, concrete grammar is as embodiment 1.
As shown in Figure 9, the high density fermentation cycle is 116h to fermentation results, and cell enters stationary phase at 90h, the highest OD
600be 192.5, dry cell weight is 73g/L DCW.Yield of lycopene increases always, finally reaches 3.517g/L, and unit cell content reaches 50.57mg/g.
Table 1 recombination bacillus coli is produced Lyeopene
Claims (9)
1. recombinant bacterium builds according to the method comprising the steps: the enzyme that improves yak base yak base diphosphate synthase in recombination bacillus coli is lived;
The method that in described raising recombination bacillus coli, the enzyme of yak base yak base diphosphate synthase is lived is that the original controlling element of the yak base yak base diphosphate synthase gene crtE in described recombination bacillus coli is replaced with to artificial regulatory element 1;
The original controlling element of described yak base yak base diphosphate synthase gene crtE is as shown in SEQ ID No.10;
The nucleotide sequence of described artificial regulatory element 1 is as shown in SEQ ID No.11;
The construction process of described recombination bacillus coli is as follows:
(1) zeaxanthin glycosyltransferase gene crtX and lycopene beta cyclase gene crtY in β-carotene synthetic gene in intestinal bacteria CAR001 bunch are replaced to artificial RBS sequence;
The sequence of described zeaxanthin glycosyltransferase gene crtX is as shown in SEQ ID No.1;
The sequence of described lycopene beta cyclase gene crtY is as shown in SEQ ID No.2;
Described artificial RBS sequence is as shown in SEQ ID No.3;
Described β-carotene synthetic gene bunch is the gene cluster being comprised of yak base yak base diphosphate synthase gene crtE, zeaxanthin glycosyltransferase gene crtX, lycopene beta cyclase gene crtY, phytoene desaturase gene crtI and phytoene synthase gene crtB;
(2) in the recombination bacillus coli that raising step (1) obtains, the enzyme of ketoglurate dehydrogenase is lived;
The original controlling element that the method that in the recombination bacillus coli that described raising step (1) obtains, ketoglurate dehydrogenase enzyme is lived is specially the alph-ketoglutaric acid dehydrase gene sucAB in the recombination bacillus coli that described step (1) is obtained replaces with artificial regulatory element M1-46;
The original controlling element of described alph-ketoglutaric acid dehydrase gene sucAB is as shown in SEQ ID No.4;
(3) in the recombination bacillus coli that raising step (2) obtains, the enzyme of transaldolase is lived;
The original controlling element that the method that in the recombination bacillus coli that described raising step (2) obtains, the enzyme of transaldolase is lived is specially the transaldolase gene talB in the recombination bacillus coli that described step (2) is obtained replaces with artificial regulatory element M1-46;
The original controlling element of described transaldolase gene talB is as shown in SEQ ID No.6;
(4) in the recombination bacillus coli that raising step (3) obtains, the enzyme of succinate dehydrogenase is lived, and obtains object recombination bacillus coli;
The original controlling element that the method that in the recombination bacillus coli that described raising step (3) obtains, the enzyme of succinate dehydrogenase is lived is specially the succinate dehydrogenase gene sdhABCD in the recombination bacillus coli that described step (3) is obtained replaces with artificial regulatory element M1-46;
The original controlling element of described succinate dehydrogenase gene sdhABCD is as shown in SEQ ID No.7;
The nucleotide sequence of described artificial regulatory element M1-46 is as shown in SEQ ID No.5.
2. recombinant bacterium builds according to the method comprising the steps: the enzyme that improves 1-deoxidation-xylulose-5-phosphate synthase in recombinant bacterium 1 claimed in claim 1 is lived;
The method that in described raising recombinant bacterium 1 claimed in claim 1, the enzyme of 1-deoxidation-xylulose-5-phosphate synthase is lived is specially the original controlling element of the 1-deoxidation-xylulose-5-phosphate synthase gene dxs in described recombinant bacterium 1 claimed in claim 1 is replaced with to artificial regulatory element 2;
The original controlling element of described 1-deoxidation-xylulose-5-phosphate synthase gene dxs is as shown in SEQ ID No.8;
The nucleotide sequence of described artificial regulatory element 2 is as shown in SEQ ID No.12.
3. recombinant bacterium builds according to the method comprising the steps: the original controlling element of the isovaleryl tetra-sodium isomerase gene idi in recombination bacillus coli is replaced with to artificial regulatory element X, obtain object recombinant bacterium 3;
The original controlling element of described isovaleryl tetra-sodium isomerase gene idi is as shown in SEQ ID No.5;
The nucleotide sequence of described artificial regulatory element X is as shown in SEQ ID No.9;
Described recombination bacillus coli is recombinant bacterium 2 claimed in claim 2.
4. recombinant bacterium builds according to the method comprising the steps: the original controlling element of the isovaleryl tetra-sodium isomerase gene idi in recombination bacillus coli is replaced with to artificial regulatory element 4;
The original controlling element of described isovaleryl tetra-sodium isomerase gene idi is as shown in SEQ ID No.5;
The nucleotide sequence of described artificial regulatory element 4 is as shown in SEQ ID No.13;
Described recombination bacillus coli is recombinant bacterium 2 claimed in claim 2.
5. this bacterium of recombinant bacterium is that deposit number is the intestinal bacteria of CGMCC No.8238.
6. produce the method for Lyeopene: comprise the steps:, by an arbitrary claim 1-5 described recombinant bacterium fermentation culture, to obtain Lyeopene.
7. method according to claim 6, is characterized in that: the every liter of composition of fermention medium in described fermentation culture is as follows:
10g glycerine, 1.7g citric acid, 10.5g KH
2pO
43H
2o, 6g (NH
4)
2hPO
4, 3.44g MgSO
47H
2o, 10ml trace element solution, surplus is water;
Every liter of composition of described trace element solution is as follows: 10g FeSO
47H
2o, 5.25g ZnSO
47H
2o, 3.0gCuSO
45H
2o, 0.5g MnSO
44H
2o, 0.23g Na
2b
4o
7210H
2o, 2.0g CaC1
2, 0.1g (NH
4)
6mo
7o
24, surplus is water.
The condition of described fermentation is specially 30 ℃ of temperature, and air flow quantity is 4L/min, and dissolved oxygen is that 30%, pH is 7.0;
Described pH specifically regulates by ammoniacal liquor;
In described fermentation, glycerol concentration remains on below 0.2g/L, and the output of acetic acid maintains below 0.1g/L.
8. according to the method described in claim 6 or 7, it is characterized in that: described method also comprises the step of adding supplemented medium, every liter of composition of described supplemented medium is as follows: 500g glycerine, 15g peptone, 30g yeast extract, 30g MgSO
47H
2o, surplus is water.
9. the arbitrary described recombinant bacterium of claim 1-5 is in the application of producing in Lyeopene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410029600.0A CN103740633B (en) | 2014-01-22 | 2014-01-22 | Recombinant bacterium and the application thereof of Lyeopene are produced in one strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410029600.0A CN103740633B (en) | 2014-01-22 | 2014-01-22 | Recombinant bacterium and the application thereof of Lyeopene are produced in one strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103740633A true CN103740633A (en) | 2014-04-23 |
| CN103740633B CN103740633B (en) | 2016-01-20 |
Family
ID=50497700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410029600.0A Active CN103740633B (en) | 2014-01-22 | 2014-01-22 | Recombinant bacterium and the application thereof of Lyeopene are produced in one strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103740633B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087408A (en) * | 2015-09-10 | 2015-11-25 | 武汉生物技术研究院 | Yeast strain for producing beta-carotene and application of yeast strain |
| CN105969709A (en) * | 2016-03-28 | 2016-09-28 | 中国科学院微生物研究所 | Recombinant escherichia coli strain and method for preparing lycopene by adopting same |
| CN106434506A (en) * | 2016-09-29 | 2017-02-22 | 中国科学院天津工业生物技术研究所 | Building method for producing lycopene recombinant bacteria and application |
| CN106544348A (en) * | 2015-09-23 | 2017-03-29 | 中国科学院微生物研究所 | Isopentenyl diphosphate isomerase gene and its application |
| CN107164254A (en) * | 2016-09-13 | 2017-09-15 | 湖北广济药业股份有限公司 | Microorganism and application thereof |
| CN108588106A (en) * | 2018-05-08 | 2018-09-28 | 华东理工大学 | A kind of lycopene superior strain, preparation method and application |
| CN112646764A (en) * | 2020-12-18 | 2021-04-13 | 山东大学 | Recombinant lactococcus lactis for producing lycopene and application thereof |
| CN112779295A (en) * | 2020-12-31 | 2021-05-11 | 广东博沃特生物科技有限公司 | High-density fermentation culture medium for producing lycopene saccharomyces cerevisiae |
| CN112852694A (en) * | 2020-10-26 | 2021-05-28 | 中国科学院天津工业生物技术研究所 | Construction and application of astaxanthin synthetic strain |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103087972B (en) * | 2013-02-01 | 2014-11-05 | 中国科学院天津工业生物技术研究所 | Recombinant microorganism for generating terpenoid and construction method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286517A (en) * | 2011-06-10 | 2011-12-21 | 天津工业生物技术研究所 | Method for regulating expression strength of gene in chromosome of microbe by using artificial regulatory element and library of artificial regulatory element |
| CN103087972A (en) * | 2013-02-01 | 2013-05-08 | 天津工业生物技术研究所 | Recombinant microorganism for generating terpenoid and construction method thereof |
| CN103131663A (en) * | 2013-03-07 | 2013-06-05 | 天津工业生物技术研究所 | Recombinant bacteria for increasing yield of succinic acid and construction method thereof |
-
2014
- 2014-01-22 CN CN201410029600.0A patent/CN103740633B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286517A (en) * | 2011-06-10 | 2011-12-21 | 天津工业生物技术研究所 | Method for regulating expression strength of gene in chromosome of microbe by using artificial regulatory element and library of artificial regulatory element |
| CN103087972A (en) * | 2013-02-01 | 2013-05-08 | 天津工业生物技术研究所 | Recombinant microorganism for generating terpenoid and construction method thereof |
| CN103131663A (en) * | 2013-03-07 | 2013-06-05 | 天津工业生物技术研究所 | Recombinant bacteria for increasing yield of succinic acid and construction method thereof |
Non-Patent Citations (2)
| Title |
|---|
| JIAO LU 等: "Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization", 《APPL MICROBIOL BIOTECHNOL》, vol. 93, 13 December 2011 (2011-12-13), pages 2455 - 2462 * |
| 赵婧 等: "多个调控元件调控萜类合成途径基因表达提高β-胡萝卜素的生产", 《生物工程学报》, vol. 29, no. 1, 25 January 2013 (2013-01-25), pages 41 - 45 * |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087408B (en) * | 2015-09-10 | 2018-08-21 | 武汉生物技术研究院 | A kind of yeast strain producing beta carotene and its application |
| CN105087408A (en) * | 2015-09-10 | 2015-11-25 | 武汉生物技术研究院 | Yeast strain for producing beta-carotene and application of yeast strain |
| CN106544348A (en) * | 2015-09-23 | 2017-03-29 | 中国科学院微生物研究所 | Isopentenyl diphosphate isomerase gene and its application |
| CN106544348B (en) * | 2015-09-23 | 2020-03-31 | 中国科学院微生物研究所 | Isopentenyl pyrophosphate isomerase gene and application thereof |
| CN105969709A (en) * | 2016-03-28 | 2016-09-28 | 中国科学院微生物研究所 | Recombinant escherichia coli strain and method for preparing lycopene by adopting same |
| CN107164254B (en) * | 2016-09-13 | 2020-05-15 | 湖北广济药业股份有限公司 | Microorganisms and uses thereof |
| CN107164254A (en) * | 2016-09-13 | 2017-09-15 | 湖北广济药业股份有限公司 | Microorganism and application thereof |
| CN106434506B (en) * | 2016-09-29 | 2019-12-31 | 中国科学院天津工业生物技术研究所 | Construction method and application of recombinant bacterium for producing lycopene |
| CN106434506A (en) * | 2016-09-29 | 2017-02-22 | 中国科学院天津工业生物技术研究所 | Building method for producing lycopene recombinant bacteria and application |
| CN108588106A (en) * | 2018-05-08 | 2018-09-28 | 华东理工大学 | A kind of lycopene superior strain, preparation method and application |
| CN108588106B (en) * | 2018-05-08 | 2022-03-11 | 华东理工大学 | Lycopene high-yield strain, preparation method and application thereof |
| CN112852694A (en) * | 2020-10-26 | 2021-05-28 | 中国科学院天津工业生物技术研究所 | Construction and application of astaxanthin synthetic strain |
| CN112646764A (en) * | 2020-12-18 | 2021-04-13 | 山东大学 | Recombinant lactococcus lactis for producing lycopene and application thereof |
| CN112779295A (en) * | 2020-12-31 | 2021-05-11 | 广东博沃特生物科技有限公司 | High-density fermentation culture medium for producing lycopene saccharomyces cerevisiae |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103740633B (en) | 2016-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103740633B (en) | Recombinant bacterium and the application thereof of Lyeopene are produced in one strain | |
| CN103087972B (en) | Recombinant microorganism for generating terpenoid and construction method thereof | |
| Wang et al. | Biotechnology advances in β-carotene production by microorganisms | |
| CN102453691B (en) | Escherichia coli engineering bacteria capable of realizing high yield of L-tryptophan | |
| Becker et al. | Systems metabolic engineering of Escherichia coli for the heterologous production of high value molecules—a veteran at new shores | |
| CN110229772B (en) | Recombinant bacillus subtilis for increasing yield of hepta-menadione and application thereof | |
| CN112961878B (en) | Application of lactobacillus plantarum gene in folic acid biological generation | |
| CN106434506B (en) | Construction method and application of recombinant bacterium for producing lycopene | |
| CN104651432B (en) | A kind of feed process improving abamectin fermented level | |
| CN101948794A (en) | Engineering lactobacilli for producing plant flavonoid to synthesize related enzymes, construction and application thereof | |
| CN104004678A (en) | Construction of corynebacterium glutamicum engineering bacteria for high-yielding production of L-valine and method for fermentation production of L-valine | |
| CN101113409B (en) | Method for cultivating antler mythic fungus by using bacterium glass | |
| CN110195023A (en) | A kind of Wine brewing yeast strain and its application | |
| Zhuang et al. | Recent developments in astaxanthin production from Phaffia rhodozyma and its applications | |
| KR101677899B1 (en) | Mutant strain having over-production ability for carotinoid, and method for preparing carotinoid using the same | |
| CN101709297A (en) | Mutagenic screening method of strain mortierella alpina for generating arachidonic acid | |
| CN108642041A (en) | A method of improving recombination bacillus coli fermenting production l-Alanine ability | |
| CN106434507B (en) | Recombinant microorganism for producing beta-carotene and construction method and application thereof | |
| CN114561304B (en) | Fermentation process for improving astaxanthin production by rhodozyma strain | |
| CN106635945A (en) | Recombinant strain and preparation method thereof and method for producing L-threonine | |
| CN105861411B (en) | A method of improving Miyarisan Fermentative growth efficiency | |
| CN109055417A (en) | A kind of recombinant microorganism, preparation method and its application in production Co-Q10 | |
| CN105969709A (en) | Recombinant escherichia coli strain and method for preparing lycopene by adopting same | |
| CN103911333B (en) | One strain is produced the bacterial strain of high yield phenylalanine and is produced the method for phenylalanine | |
| Wang et al. | Effects of heavy‐ion beam irradiation on avermectin B1a and its analogues production by Streptomyces avermitilis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |