CN108588106A

CN108588106A - A kind of lycopene superior strain, preparation method and application

Info

Publication number: CN108588106A
Application number: CN201810433054.5A
Authority: CN
Inventors: 郭美锦; 韦炎龙; 方宏清; 洪琦; 庄英萍; 储炬
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2018-05-08
Filing date: 2018-05-08
Publication date: 2018-09-28
Anticipated expiration: 2038-05-08
Also published as: CN108588106B

Abstract

The present invention relates to a kind of lycopene superior strain, preparation method and applications.The present inventor is transformed the heterologous metabolic pathway of Escherichia coli by the method for genetic engineering, and MVA downstream pathways and lycopene approach are further integrated into genome of E.coli different loci, obtains high yield lycopene engineering bacteria strain.

Description

A kind of lycopene superior strain, preparation method and application

Technical field

The invention belongs to synthetic biology field, more particularly it relates to the engineered strain of high yield lycopene, its Preparation method and application.

Background technology

Lycopene is a kind of natural, is a kind of C₄₀Terpenoid, natural origin is in plant or microorganism In.It has and improves the immunity of the human body, is anti-aging, anti-oxidant and other effects, be a kind of situation of selling well as nutriment needed by human Health products.Studies have shown that lycopene also has certain preventive effect to cancer.As harmless natural red Pigment, lycopene are also widely used for food, cosmetic industry.

Currently, lycopene industrialization production mainly passes through following three kinds of methods：Direct extraction method, chemical synthesis and micro- Biological synthesis process.Direct extraction method refers to utilizing ethyl acetate, and the organic solvents such as acetone or n-hexane are by lycopene from fresh It is extracted in tomato or dewatered tomato.But content of the lycopene in plant is low, which greatly enhances prepare tomato red The cost of plain product.Lycopene is produced using chemical synthesis, there is at low cost, the high advantage of yield.But due to by-product Object is more, and the residue that complicated, structure is unknown, can not be detached from is contained in lycopene product.Therefore, it is sent out using chemical synthesis The lycopene product of production is not suitable as food or health products to take for a long time.

Using Microbe synthesis method produce lycopene, have it is at low cost, yield is high, it is simple for process, be easy to amplification etc. it is excellent Point, and do not limited by season, weather conditions.Currently, Microbe synthesis method production lycopene mainly utilizes three spore Bradleys Family name mould.Yield is 0.93g (Tereshina, V.M. etc. after fermentation five days；Microbiology, 2010,79 (1):34- 39.).But Laplace fungus growth is not slow for three spores, fermentation period is long, and this considerably increases the costs of production lycopene.And Pattern microorganism Escherichia coli has the features such as growth is fast, and genetic background is clear, and molecular biology manipulations are simple, is ideal Host.But Escherichia coli itself do not produce lycopene, need the heterologous metabolic pathway for additionally importing expression lycopene. 2001, Kim and Keasling were host with Escherichia coli, passed through the life that enhanced endogenesis MEP approach increases lycopene precursor Produce (Kim, S.W. etc., Biotechnology and Bioengineering, 2001,72 (4):408-415.).They utilize PUC pUC is overexpressed the Mang ox base Mang ox base pyrophosphoric acid from Erwinia herbicola (E.herbicola) simultaneously (GGPP) 1-deoxy-D-xylulose -5- of synthase gene (crtE), crtB, crtI and the endogenous MEP approach of Escherichia coli Phosphate synthase gene (dxs), cultivate 54h after, lycopene fermentation level reach 22mg/L (Kim, S.W. etc., Biotechnology and Bioengineering, 2001,72 (4):408-415.).2003, Martin et al. took the lead in profit It is overexpressed method Buddhist nun's alkene pyrophosphoric acid (FPP) synthase gene (ispA), Isopentenyl diphosphate isomerase gene with Escherichia coli (idi), (atoB, HMGS are deleted for Amorpha-4,11-diene synthase gene (ADS) and MVA pathway genes from saccharomyces cerevisiae Type HMGR, ERG12, ERG8 and MVD1), successfully obtain antimalarial precursor --- amorpha-4,11-diene (Martin, V.J.J. Deng, Nature Biotechnology, 2003,21 (7):796-802.).Hereafter, it opens and utilizes the heterologous ways MVA of Escherichia coli Diameter improves the research of terpenoid precursor.The advantages of MVA metabolic pathways heterologous using Escherichia coli is：1) MVA approach is compared In MEP approach, it is found that earlier, research is more thorough.2) it can be controlled to avoid the endogenous metabolism regulation mechanism of host.2006, MVA approach is divided into upstream pathway and downstream pathway (Yoon, S.H. etc., 2006,94 (6) by Yoon et al.:1025-1032.). MVA upstream pathways are from acetyl coenzyme A to mevalonic acid, and downstream pathway is from mevalonic acid to IPP and DMAPP.They are with big Enterobacteria is host, and structure double-plasmid expression system loads MVA downstream pathways gene and lycopene route of synthesis gene respectively, Lycopene fermentation level is 102mg/L (Yoon, S.H. etc., Biotechnology and after shaking flask culture 72h Bioengineering, 2006,94 (6):1025-1032.).But the recombination bacillus coli is free of MVA upstream pathway genes, It must be using the mevalonic acid additionally added as precursor.Zhu et al. is improved acquisition improvement engineered strain on this basis, is not necessarily to Additional addition mevalonic acid (Zhu, F. etc., Process Biochemistry, 2015,50 (3), 341-346.), can be direct Lycopene is synthesized by precursor of the endogenous acetyl coenzyme A of host, yield of lycopene is 92.3mg/L after shaking flask culture 72h.But It is that the engineered strain has the following disadvantages：1) three pUC pUCs cause host to be extended down to the phase long；2) plasmid is there are unstability, (Tyo, K.E.J. etc., Nature is isolated including segregational instability, structural instability and allele Biotechnology, 2009,27 (8):760-765.)；3) need addition antibiotic that plasmid is maintained to exist in culture medium.The present invention People synthesizes MVA upstream pathways Expression element ES, MVA downstream pathway Expression element S1 and lycopene in research before Whole having arrived on genome of E.coli of approach Expression element GC, construct integrated bacterial strain DH411 (Wei, Y. etc., Bioresource Technology, 2018,250:382-389).But lycopene yield is extremely low, only 0.66mg/g DCW, the follow-up pUC pUC overexpression S1 and GC that relies on could realize that lycopene high yield, yield of lycopene maximum output are 68.5mg/L。

To sum up, it is also necessary to lycopene production technology further be optimized, to find with stable, productive Can, and the technology that production cost is low.

Invention content

The purpose of the present invention is to provide a kind of lycopene superior strain, preparation method and applications.

In the first aspect of the present invention, a kind of method improving yield of lycopene is provided, the method includes：

(1) it is exogenously introduced Expression element in Escherichia coli (E.coli), is allowed to exist：

Single copy ES elements, which includes acetyl coenzyme A-transacetylase/3-hydroxy-3-methylglutaric acid list acyl Coacetylase (HMG-CoA) reductase gene (mvaE) and 3-hydroxy-3-methylglutaric acid list acyl coenzyme A (HMG-CoA) synzyme base Because of (mvaS)；

Double or three copy S1 elements, which includes mevalonate kinase gene (mvk), phosphomevalonate kinase base Because of (mvaK2), mevalonate pyrophosphate decarboxylase gene (mvd1) and Isopentenyl diphosphate isomerase gene (fni)；

It is double, three or four copy GC elements, which includes difunctional short chain isopentenyl pyrophosphate synthase gene (idsA), phytoene synthase gene (crtB) and Phytoene dehydrogenase gene (crtI)；

(2) Escherichia coli for cultivating (1), produce lycopene.

There is heterologous mevalonic acid (MVA) approach (including upstreams MVA in a preference, in the Escherichia coli Approach, downstream pathway) and lycopene route of synthesis.

In another preferred example, in (1), following Expression element is exogenously introduced in engineering bacteria：Single copy ES elements, it is double to copy Shellfish S1 elements, three copy GC elements；Preferably, the Expression element is integrated in the genome of Escherichia coli.

In another preferred example, the S1 elements or GC elements are integrated into the nonessential region 58 of genome of E.coli Area, 44th area of nonessential region and/or the sites lpxM.

In another preferred example, the S1 elements or GC elements are integrated into the nonessential region 58 of genome of E.coli Area, to improve lycopene yield；Or the GC elements are integrated into the sites lpxM of genome of E.coli, to carry The growth ability of high e. coli strains.

In another preferred example, in (2), Fiber differentiation is carried out with L-arabinose；Preferably, the 8th of culture starting It is induced within~15 hours；More preferably it is being induced for the 12nd ± 1 hour in culture starting.

In another aspect of this invention, a kind of Escherichia coli of recombination are provided, including the following expression being exogenously introduced Element：

Single copy ES elements, which includes acetyl coenzyme A-transacetylase/3-hydroxy-3-methylglutaric acid list acyl Coacetylase (HMG-CoA) reductase gene (mvaE) and HMG-CoA synthase genes (mvaS)；

It is double, three or four copy GC elements, which includes difunctional short chain isopentenyl pyrophosphate synthase gene (idsA), phytoene synthase gene (crtB) and Phytoene dehydrogenase gene (crtI).

In a preference, the Escherichia coli of the recombination include the following Expression element being exogenously introduced：Singly copy Shellfish ES elements, double copy S1 elements, three copy GC elements；Preferably, the Expression element is integrated in the gene of Escherichia coli In group.

In another preferred example, the S1 elements or GC elements are integrated into the nonessential region 58 of genome of E.coli Area, 44th area of nonessential region, 8th area of nonessential region and/or the sites lpxM.

In another preferred example, the S1 elements or GC elements are integrated in the nonessential region 58 of genome of E.coli Area；Or the GC elements are integrated in 8th area of nonessential region and the sites lpxM of genome of E.coli.

In another aspect of this invention, a kind of kit for producing lycopene is provided, the kit includes The Escherichia coli of the recombination.

In another preferred example, further include in the kit：Escherichia coli culture medium, operation instructions etc..

The other aspects of the present invention are apparent to those skilled in the art due to this disclosure 's.

Description of the drawings

Fig. 1, it is plasmid pCC1E schematic diagrames.

Fig. 2, it is plasmid pCC1G schematic diagrames.

Fig. 3, it is plasmid pCC1ES schematic diagrames.

Fig. 4, it is plasmid pCC1EG schematic diagrames.

Fig. 5, it is plasmid pETI schematic diagrames.

Fig. 6, it is plasmid pETIG schematic diagrames.

Fig. 7, it is plasmid pKILG schematic diagrames.

Fig. 8, for controllable metabolic pathway copy number model schematic.

Fig. 9, the lycopene yield for engineered strain.Wherein, in grey black square digital representation corresponding gene copy number, 1： Single copy；2：Double copies；3：Three copies；4：Four copies.

Figure 10, for the lycopene yield and level of growth of genome multiple-sites integration policy optimization engineered strain.

Figure 11, the integration site being related to for genome multiple-sites integration strategy.

Figure 12, lycopene yield and level of growth for engineered strain D414S, D414SS, D414SG and DH416.

Figure 13, influence of the addition time to the lycopene fermentation level of bacterial strain DH416 for inducer L-arabinose.

Figure 14, the stability synthesized for engineered strain DH416 and D442SG lycopene.

Figure 15, the lycopene synthesis for being engineered strain DH416 in the 5L fermentation tanks and level of growth.

The schematic diagram of Figure 16, lycopene metabolic pathway.

Specific implementation mode

The yield that the present inventor is dedicated to improving biological production lycopene passes through genetic engineering by in-depth study Method the heterologous metabolic pathway of Escherichia coli is transformed, MVA downstream pathways and lycopene route of synthesis is further It is integrated into genome of E.coli different loci, obtains the engineered strain of high yield lycopene.

As used herein, " external source " or " heterologous " refers to two or more pieces nucleic acid or protein from separate sources Relationship between sequence.For example, if the combination of promoter and objective gene sequence is not usually naturally occurring, promoter It is external source for the target gene.Particular sequence for the cell that it is inserted into or is " external source " for organism.

As used herein, " integrated bacterial strain " refers in the bacterial strain, and the gene of external source is not to be free on the state of genome In the presence of, but be integrated into the genome of bacterial strain, become a part for genome.

As used herein, " ES elements " includes that acetyl coenzyme A-transacetylase/3-hydroxy-3-methylglutaric acid list acyl is auxiliary Enzyme A (HMG-CoA) reductase gene (mvaE) and HMG-CoA synthase genes (mvaS).

As used herein, " S1 elements " includes mevalonate kinase gene (mvk), phosphomevalonate kinase gene (mvaK2), mevalonate pyrophosphate decarboxylase gene (mvd1) and Isopentenyl diphosphate isomerase gene (fni).

As used herein, " GC elements " includes difunctional short chain isopentenyl pyrophosphate synthase gene (idsA), octahydro Lycopene synthase gene (crtB) and Phytoene dehydrogenase gene (crtI).

As used herein, " sites lpxM " refers to the site of lpxM genes on genome, Genbank：NC_017625.1 1937085–1938013bp)。

As used herein, " acetyl coenzyme A-transacetylase/3-hydroxy-3-methylglutaric acid list acyl coenzyme A (HMG- CoA) reductase gene " is the enzyme of gene (mvaE) coding, this enzyme is catalyzed discontinuous two-step reaction in metabolic pathway.Its It can be catalyzed acetyl coenzyme A synthesis acetoacetyl-CoA, at this time referred to as acetyl coenzyme A-transacetylase；It can also be catalyzed HMG-CoA synthesizes mevalonic acid, at this time referred to as HMG-CoA reductase.

Therefore said gene, which is the identified gene in this field, can obtain and prepare these genes from public's approach. As the preferred embodiment of the present invention, mvaE and mvaS have sequence shown in GenBank accession number AF290092.1；fni、mvk、 The sequence of mvaK2 and mvd1 is referring to Wei, Y., Mohsin, A., Hong, Q., Guo, M., Fang, H., Enhanced production of biosynthesized lycopene via heterogenous MVA pathway based on chromosomal multiple position integration strategy plus plasmid systems in Escherichia coli.Bioresource Technology, 2018,250:382-389；The sequence of idsA, crtB and crtI Row are referring to Wei, Y., Deng, P., Mohsin, A., Yang, Y., Zhou, H., Guo, M., Fang, H..An electroporation-free method based on Red recombineering for markerless Deletion and genomic replacement in the Escherichia coli DH1genome.PloS One, 2017,12 (10):e0186891.

On the basis of above-mentioned preferred sequence, invention further relates to the variant or degeneracy form of the gene, coding with The identical polypeptide of amino acid sequence (enzyme) or its congenerous variant of wild type gene coding.The variant of the gene can be day The variant that the allelic variant or non-natural so occurred occurs.These nucleotide variants include substitution variants, missing change Allosome and insert variation.As known in the art, allelic variant is the alternative forms of a polynucleotides, it may be one Substitution, missing or the insertion of a or multiple nucleotide, but not from substantially change its encode polypeptide function；Or with Native sequences have about 70% or 80% or more homology, or have about 85%, 90%, 95%, 98%, 99% or more homology Polynucleotides.

The invention also includes the sequences for the gene, carry out the polynucleotide sequence formed after codon optimization, example Such as, codon optimization is carried out according to the preference of Escherichia coli.

The nucleotide full length sequence of gene of the present invention or its segment can usually use PCR amplification method, recombination method or Artificial synthesized method obtains.For PCR amplification method, can especially be opened according to related nucleotide sequence disclosed in this invention It puts reading frame sequence and carrys out design primer, the commercially available libraries cDNA are used in combination or by prepared by conventional method well known by persons skilled in the art The libraries cDNA as template, amplification and related sequence.

It is existing to synthesize lycopene or other terpenoids using the heterologous MVA approach of Escherichia coli, it is to utilize PUC pUC is expressed.But often there is unstability in this kind of expression system, limit its application.In order to increase tomato The yield of red pigment, the present inventor are extensively studied, and have found the means for being suitable for being improved.In the present invention, structure is whole Mould assembly high yield lycopene engineering bacteria strain, and include the optimisation strategy of engineered strain expression approach.

The present invention utilizes existing three Expression elements, and by optimizing copy number, (controllable metabolic pathway copies digital-to-analogue Type), site (the genome multiple-sites integration strategy of lycopene route of synthesis) is preferably also optimized and combined, constructs and relies on The colibacillus engineering strain of the integrated high yield lycopene of heterologous mevalonate pathway.External source introduces in the Escherichia coli Following Expression element：Single copy ES elements；Double or three copy S1 elements；It is double, three or four copy GC elements.

In a preferred embodiment of the present invention, Expression element ES includes deriving from the upstreams enterococcus faecalis (E.faecalis) MVA Acetyl coenzyme A-transacetylase/3-hydroxy-3-methylglutaric acid list acyl coenzyme A (HMG-CoA) reductase gene in approach (mvaE) and HMG-CoA synthase genes (mvaS)；Expression element S1 includes codon optimization from streptococcus pneumonia MVA Downstream pathway mevalonate kinase gene (mvk), phosphomevalonate kinase gene (mvaK2), mevalonate pyrophosphate decarboxylation Enzyme gene (mvd1) and isopentene group isomerase gene (fni)；Expression element GC includes the ancient from flicker of codon optimization The difunctional short chain isopentenyl pyrophosphate synthase gene (idsA) of green-ball bacterium (A.fulgidus) derives from pantoea agglomerans (P.agglomerans) phytoene synthase gene (crtB) and Phytoene dehydrogenase gene (crtI).

In a preferred embodiment of the present invention, the genetic engineering construction method uses λ-Red recombination methods, is metabolized work Journey optimisation strategy is controllable metabolic pathway copy number models coupling lycopene route of synthesis genome multiple-sites integration strategy. Optimal metabolic pathway copy number is determined using controllable metabolic pathway copy exponential model, utilizes genome multiple-sites integration strategy Suitable integration site is selected, efficiently synthesizing for lycopene is realized.

In a specific embodiment of the present invention, the present inventor constructs the bacterial strain of a variety of different expression-forms, preferred true The factor of raising lycopene fermentation level is determined, it is found that Expression element S1 and GC need to carry out reinforcing appropriate.Secondly, the present invention Expression element GC is integrated into the 8 area (Genbank of nonessential region of bacterial strain DH411 by people：NC_017625.1 413909– 430258bp), bacterial strain DH412 is obtained.Further the single copy plasmid for loading Expression element S1 and GC is transformed into bacterial strain, It was found that most preferred metabolic pathway copy number is the Expression element ES of 1 copy, the GC of the copies of S1 and 3 of 2 copies.

In a specific embodiment of the present invention, the present inventor Expression element GC is integrated into the non-of bacterial strain DH411 respectively must Need 44 area (Genbank of area：3033115-3048652bp of NC_017625.1), 58 area (Genbank：NC_017625.1 4184313-4200717bp) and the sites lpxM (Genbank：1936099-1939071bp of NC_017625.1), then turn respectively Makeup carries single progress lycopene synthesis after copying plasmid of Expression element S1 and GC.Constructed engineered strain is copied containing 1 The Expression element ES of shellfish, the GC of the copies of S1 and 3 of 2 copies.The GC engineered strains for being integrated into the acquisition of 58th area there is into highest tomato Red pigment yield；The GC engineered strains for being integrated into the sites lpxM had into best growth ability.Specifically, lycopene way is utilized Diameter genome multiple-sites integration policy optimization lycopene synthesizes.

The present inventor simultaneously deletes site DNA sequence dna when integrating operon.Although 8th area and 44th area are long, This 2 areas do not influence host growth after being deleted.

The present inventors have additionally discovered that the addition time of inducer L-arabinose and the yield of lycopene are also closely related. Preferably, being induced for the 8th~15 hour in culture starting；More preferably it is being lured for the 12nd ± 1 hour in culture starting It leads.

The strain stability of the present invention is good, and can realize scale culture in the bioreactor and production lycopene. The lycopene yield of currently preferred bacterial strain is 53.5 times higher than its starting strain.

The present invention also provides the kits for building production lycopene engineering bacteria strain.In addition, wherein may also include Escherichia coli culture medium, lycopene separation or detection reagent, operation instructions etc..

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brookers etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, the condition described in 2002, or According to the normal condition proposed by manufacturer.

The present invention is to build mutant on the basis of bacterial strain DH411, true using controllable metabolic pathway copy exponential model Determine the optimal copy number of metabolic pathway, and then combines genome multiple-sites integration strategy, it is whole to construct high yield lycopene Mould assembly bacterial strain.

Bacterial strain E.coli DH411, Expression element ES, Expression element S1, the culture of bacterial strain, lycopene synthesis condition, kind Lycopene detection, plasmid pETE, pETG, pETS, pCC1S, pCC1SS, pCC1SG, pKILE, pBDC-Li, pKIS are referring to document Wei, Y., Mohsin, A., Hong, Q., Guo, M., Fang, H., Enhanced production of biosynthesized lycopene via heterogenous MVA pathway based on chromosomal multiple position integration strategy plus plasmid systems in Escherichia coli.Bioresource Technology, 2018,250:382-389.The method of homologous recombination needed for the structure of Expression element GC, DH411 mutant strain, Integration site information, plasmid pCNA, pSNA, pSNK, pBDC-23ri, pBDC-44i, pBDC-58i referring to Wei, Y., Deng, P., Mohsin, A., Yang, Y., Zhou, H., Guo, M., Fang, H..An electroporation-free method based on Red recombineering for markerless deletion and genomic replacement In the Escherichia coli DH1genome.PloS One, 2017,12 (10):e0186891.Plasmid pCC1FOS purchases From Epicentre companies, plasmid pET3b is purchased from Novagen companies.

Bacterial strain DH411 construction methods：Host is that E.coli genomes delete type bacterial strain DH06, the Component of bacterial strain DH06 Diligent, the Yu Jian referring to document Zhu Mei, perimeter woods, a kind of new large intestines based on Red recombinations and I-Sec I vivo excisions of the macro clear in side Bacillus gene group is seamless to delete method bioengineering journals, 2016,32 (1):114–126.First, by the Expression element GC inverse times Needle is integrated into 23 area (Genbank of DH06 genomes nonessential region：NC_017625.1 1,487,032–1,496,241bp).With Afterwards, Expression element S1 is integrated into 64 area (Genbank of nonessential region clockwise：NC_017625.14,575,092–4,587, 316bp).Then, Expression element ES is integrated into 57 area (Genbank of nonessential region clockwise：NC_017625.1 4,090, 884–4,104,502).Finally, the T7RNA that E.coli BL21 (AI) genome will be derived from using methods of homologous recombination is polymerize Enzyme gene is integrated into the sites araB of host.

Engineered strain condition of culture is as follows：

Picking single bacterium drops down onto in the test tube containing 5mL liquid Luria-Bertani (LB) culture medium, in 30 DEG C, 220rpm Under the conditions of cultivate 12h.Next day is forwarded to containing 5mL FMGAT culture mediums (peptone 9g, yeast powder 7.2g, NaH₂PO₄·2H₂O 1.8g, K₂HPO₄·3H₂O 4.2g, NaCl 1.5g, Tween 80 3g, glycerine 6g, MgSO₄0.3g, glucose 1.2g, L- Ah Uncle sugar 1.2g is drawn, in constant volume to 0.6L deionized waters) Boiling tube in cultivate, make initial OD_600nmBe 0.05,30 DEG C, It is cultivated for 24 hours under the conditions of 220rpm.

When carrying out the optimization of L-arabinose addition time, other conditions are constant, but L- is not added in initial medium Arabinose, and the different time addition after culture originates.

Embodiment 1, plasmid construction

One, the structure of plasmid pCC1E

1, PCR amplification is carried out to plasmid pETE using primer BI5/BI3, obtains the DNA fragmentation containing Expression element ES ESCC (about 4,100bp).

2, using plasmid pCC1FOS as template, RP5/FP3 is primer, and skeleton CC1 is obtained by PCR.

3, segment ESCC and skeleton CC1 are subjected to vitro recombination, obtain recombinant plasmid pCC1E (structural schematic diagram is shown in Fig. 1).

Primer sequence is as follows：

BI5：GTTTTCCCAGTCACGACAAGGAGATGGCGCCCAA(SEQ ID NO:1)；

BI3：CCATGATTACGCCAAGCCGGATATAGTTCCTCCTTT(SEQ ID NO:2)；

RP5：CTTGGCGTAATCATGGTCAT(SEQ ID NO:3)；

FP3：GTCGTGACTGGGAAAACC(SEQ ID NO:4).

High fidelity PCR reaction kit used in the present invention isGXL archaeal dna polymerases (TaKaRa), purchase In company of precious bioengineering (Dalian) Co., Ltd.Amplification reaction system：ddH₂33 μ L of O, 5 × buffer solution 10 μ L, dNTP 4 μ L of Mixture, 1 μ L of primer 1 (10 μM), primer 2 (10 μM) 1 μ L, 0.5 μ L of template,GXL DNA polymerizations 0.5 μ L of enzyme.

Pcr amplification reaction condition：94 DEG C of pre-degeneration 5min, { 98 DEG C of denaturation 10s, 60 DEG C of renaturation 10s, 72 DEG C of extension (1kb/ Min) } × 10 cycle, { 98 DEG C of denaturation 10s, 55 DEG C of renaturation 10s, 72 DEG C extend (1kb/min) } × 10 cycles, 72 DEG C are prolonged Stretch 10min.

The small extraction reagent kit of plasmid is purchased from healthy and free from worry life science (Wujiang) Co., Ltd；Quick Ago-Gel DNA recycling examinations Agent box is century bio tech ltd purchased from health；Recombinant clone kit only praises the limited public affairs of biotechnology purchased from Nanjing promise Department.

Two, the structure of plasmid pCC1G

1, PCR amplification is carried out to plasmid pETG using primer BI5/BI3, obtains the DNA fragmentation containing Expression element GC GCCC (about 3,900bp).

2, segment GCCC and skeleton CC1 are subjected to vitro recombination, obtain recombinant plasmid pCC1G (structural schematic diagram is shown in Fig. 2).

Three, the structure of plasmid pCC1ES

1, PCR amplification is carried out to plasmid pETE using primer BI5/LP3, obtains the DNA fragmentation ESX containing Expression element ES (about 4,100bp).

2, PCR amplification is carried out to plasmid pETS using primer LP5/BI3, obtains the DNA fragmentation XS1 containing element S1 (about 4,500bp)。

3, using plasmid pCC1FOS as template, RP5/FP3 is primer, and skeleton CC1 is obtained by PCR.

4, segment ESX, XS1 and skeleton CC1 are subjected to vitro recombination.Obtaining recombinant plasmid pCC1ES, (structural schematic diagram is shown in Fig. 3).

Primer sequence is as follows：

LP5：CAAGGTCCAAATCATCCAAGGAGATGGCGCCCAA(SEQ ID NO:5)；

LP3：GGATGATTTGGACCTTGGGCAATTTCTATGCGCACCC(SEQ ID NO:6).

Four, the structure of plasmid pCC1EG

1, PCR amplification is carried out to plasmid pETG using primer LP5/BI3, obtains the DNA fragmentation XGC containing Expression element GC (about 3,900bp).

2, segment ESX, XGC and skeleton CC1 are subjected to vitro recombination.Obtaining recombinant plasmid pCC1EG, (structural schematic diagram is shown in Fig. 4).

Five, the structure of plasmid pETI

1, using restriction enzyme Sca I/EcoR I digested plasmid pET3b, the DNA fragmentation PET of about 4,100bp is recycled (SE)。

2, using PET (SE) segments as template, T7IS5/T7IS3 is primer, and containing T7 by PCR amplification about 800bp starts The DNA fragmentation T7IS of son and I-SceI recognition sites.

3, using EcoR I/Sph I endonuclease bamhi T7IS, T7IS (ES) is obtained.Segment T7IS (ES) is inserted into plasmid The EcoR I/Sph I sites of pET3b obtain plasmid pETI (structural schematic diagram is shown in Fig. 5).

Six, the structure of plasmid pETIG

1, it using restriction enzyme Nde I/BamH I digested plasmid pETG, obtains about 3,400bp and contains Expression element The DNA fragmentation GC (NB) of GC.

Segment GC (NB) 2, is inserted into the Nde I/BamH I sites of plasmid pETI, obtains plasmid pETIG (structural representations Figure is shown in Fig. 6).

Seven, the structure of plasmid pKILG

1, using plasmid pKILE as template, PKR5/PKL3 is primer, and going out about 5,000bp using PCR amplification contains The DNA fragmentation KIL of pBR322ori, f1ori, kan, I-SceI sites and the sites lpxM homologous region.

2, segment KIL and GCCC are subjected to vitro recombination, obtain plasmid pKILG (structural schematic diagram is shown in Fig. 7).

The structure of embodiment 2, recombinant bacterium

1, the structure of bacterial strain DH412

Using Escherichia coli DH411 as starting strain, Expression element GC is integrated into 8th area of nonessential region and (is corresponded to Genbank：NC_017625.1,413909-430258bp), obtain bacterial strain DH412.Plasmid is used in first step homologous recombination PCNA and pBDC-23ri；Second step recombination plasmid used is pSNK and pETIG.Recon is carried out using primer 8-0/8-1 PCR identifies that the positive colony of first step recombination is about 2,300bp, and feminine gender is without band；Second step positive colony is about 4,900bp, Feminine gender is about 2,300bp.

Primer sequence is as follows：

8-0：GTGGTCAGGTACTGGCTAA(SEQ ID NO:7)；

8-1：GAAACGCCGTCTTCTGTG(SEQ ID NO:8).

2, the structure of bacterial strain DH422

Using DH411 as starting strain, Expression element GC is integrated into 44th area of nonessential region and (corresponds to Genbank：NC_ 017625.1 3033115-3048652bp), obtain bacterial strain DH422.Plasmid used in first step homologous recombination is pCNA and pBDC- 44i；Second step recombination plasmid used is pSNK and pETIG.Using primer 44-0/44-1 to recon carry out PCR identifications, first It is about 2,300bp to walk recombinant clone, and feminine gender is without band；Second step positive colony is about 4,900bp, feminine gender about 2, 300bp。

Primer sequence is as follows：

44-0：CCTGAAAGAACTGGCTGAC(SEQ ID NO:9)；

44-1：AAGCGTTGTCGCTGGTGT(SEQ ID NO:10).

3, the structure of bacterial strain DH432

Using DH411 as starting strain, Expression element GC is integrated into 58th area of nonessential region and (corresponds to Genbank：NC_ 017625.1 4184313-4200717bp), obtain bacterial strain DH432.Plasmid used in first step homologous recombination is pCNA and pBDC- 58i；Second step recombination plasmid used is pSNK and pETIG.Using primer 58-0/58-1 to recon carry out PCR identifications, first It is about 2,300bp to walk recombinant clone, and feminine gender is without band；Second step positive colony is about 4,900bp, feminine gender about 2, 300bp。

Primer sequence is as follows：

58-0：ACCGAGAAACCTTGTGCCA(SEQ ID NO:11)；

58-1：CACGGACGGGGAAGATGA(SEQ ID NO:12).

4, the structure of bacterial strain DH442

Using DH411 as starting strain, Expression element GC is integrated into the sites lpxM, obtains bacterial strain DH442.The first step is homologous Recombination plasmid used is pCNA and pBDC-Li；Second step recombination plasmid used is pSNA and pKILG.Use primer ES-0/ES-1 PCR identifications are carried out to the recon of the first step, positive colony is about 2,700bp, feminine gender about 1,800bp；Use primer M-0/ M-1 carries out PCR identifications to the recon of second step, and positive colony is about 5,900bp, feminine gender about 3,900bp.

Primer sequence is as follows：

ES-0：ACGCTGAACCTGACTGCT(SEQ ID NO:13)；

ES-1：GAAGTGGTGGTTGCCAAAC(SEQ ID NO:14)；

M-0：AGACATTAAGACTGCGGCGT(SEQ ID NO:15)；

M-1：ATATCACCCAACTGGCTGCGGC(SEQ ID NO:16).

5, the structure of bacterial strain DH414

Using DH412 as starting strain, Expression element GC is integrated into the sites lpxM, obtains bacterial strain DH414.Homologous recombination institute With plasmid and positive band size with the structure of bacterial strain DH442.

6, the structure of bacterial strain DH416

Using DH414 as starting strain, Expression element S1 is integrated into 58th area of nonessential region, obtains bacterial strain DH416.The first step Plasmid used in homologous recombination is pCNA and pBDC-58i；Second step recombination plasmid used is pSNA and pKIS.Use primer 58-0/ 58-1 carries out PCR identifications to recon, and first step recombinant clone is about 2,300bp, and feminine gender is without band；Positive gram of second step Grand about 5,500bp, feminine gender about 2,300bp.

Embodiment 3, the structure integrated engineered strain of high yield lycopene

1, rate-limiting step is sought

Starting strain is 411 bacterial strains, wherein containing the Expression element mvaE and mvaS (ES) that singly copy, the expression singly copied Element mvk, mvaK2, mvd1, fni (S1), Expression element idsA, crtB and the crtI (GC) singly copied.

Single copy plasmid pCC1E, pCC1S, pCC1G, pCC1ES, pCC1EG and pCC1SG of different metabolic approach will be loaded It is transformed into respectively in bacterial strain DH411, obtains following engineered strain：

D411E：It is transferred to pCC1E, there are double copy ES, single to copy S1, list copies GC.

D411S：It is transferred to pCC1S, there are single copy ES, double copy S1, it is single to copy GC.

D411G：It is transferred to pCC1G, there is single copy ES, it is single to copy S1, double copy GC.

D411ES：It is transferred to pCC1E and pCC1S, there are double copy ES, double copy S1, it is single to copy GC.

D411EG：It is transferred to pCC1E and pCC1G, there are double copy ES, it is single to copy S1, double copy GC.

D411SG：It is transferred to pCC1S and pCC1G, there is single copy ES, double copy S1, double copy GC.

If aforementioned engineered strain condition of culture is cultivated, investigates lycopene and synthesize situation.

Such as Fig. 8, generates 7 kinds of metabolic pathways and copy exponential model.Engineered strain D411SG is model 7, lycopene yield It is obviously improved, is 19.66mg/g DCW, is 30 times (Fig. 9) of DH411.

The result shows that the overexpression of MVA downstream pathways and lycopene route of synthesis operon is conducive to high yield tomato red Element.

2, the multiple-sites integration of lycopene approach

To further increase lycopene production capacity, plasmid pCC1SS and pCC1SG are transformed into bacterial strain DH412 respectively In, obtain engineered strain D412SS and D412SG.

D412SS：It is transferred to pCC1SS in DH412, there is single copy ES, three copy S1, double copy GC.

D412SG：It is transferred to pCC1SG in DH412, there is single copy ES, double copy S1, three and copy GC.

As Fig. 8, D412SS and D412SG respectively more than D411SG 1 copy Expression element S1 and GC.Such as Figure 10, although D412SS (model 8) obtains higher growth ability, OD_600nmIt is 6.03, but engineered strain D412SG (model 9) has more High lycopene yield is 36.68mg/g DCW, is 1.87 times and 1.52 times of D411SG and S412SS respectively.

Then, it is optimized using genome multiple-sites integration strategy.Plasmid pCC1SG is transformed into bacterial strain respectively In DH422, DH432 and DH442, engineering bacteria D422SG, D432SG and D442SG that three plants of metabolic pathways are model 9 are obtained.

D422SG：It is transferred to pCC1SG in DH422, there is single copy ES, double copy S1, three and copy GC.

D432SG：It is transferred to pCC1SG in DH432, there is single copy ES, double copy S1, three and copy GC.

D442SG：It is transferred to pCC1SG in DH442, there is single copy ES, double copy S1, three and copy GC.

This three plants of engineering bacterias are identical as the metabolic pathway copy number of D412SG, only difference is that there is the expression member of 1 copy Part GC has been integrated into different loci (Figure 11).The lycopene yield and growth energy of bacterial strain D422SG, D432SG and D442SG Power has significant difference (Figure 10) compared to D412SG.The lycopene yield and growth ability of bacterial strain D422SG is below D412SG.And D432SG has highest lycopene yield, is 38.05mg/g DCW, and 3.7% has been higher by than D411SG.To the greatest extent The lycopene yield ratio D412SG low 5.1% of pipe D442SG, but D442SG has higher level of growth, OD_600nm=5.91, It is 1.88 times of D412SG.

3, integrated engineered strain is built

Plasmid pCC1S, pCC1SS and pCC1SG are transformed into bacterial strain DH414 respectively, obtain engineered strain D414S (moulds Type 9), D414SS (model 10) and D414SG (model 11).

D414S：It is transferred to pCC1S in DH414, there is single copy ES, double copy S1, three and copy GC.

D414SS：It is transferred to pCC1SS in DH414, there is single copy ES, three copy S1, three copy GC.

D414SG：It is transferred to D414SG in DH414, there is single copy ES, double copy S1, four and copy GC.

Such as Figure 12, the lycopene yield highest of the engineered strain D414S of model 9.Therefore, inventors believe that metabolism way It is optimal that diameter, which copies exponential model 9,.Show simultaneously and the higher the copy number of non-genomic the more advantageous.

Further, the present inventor constructs integrated bacterial strain DH416, is using DH414 as starting strain, by expression member Part S1 is integrated into 58th area of nonessential region and obtains, and there is single copy ES, double copy S1, three copy GC.As a result, it has been found that in shaking flask water On flat, the lycopene yield of the bacterial strain is 35.34mg/g DCW, OD_600nmIt is 7.09, lycopene fermentation level reaches 92.66mg/L。

In conclusion changing the copy number of some metabolic pathway genes in bacterial strain, there is pole for the yield of lycopene Big change.With lycopene relevant approach such as Figure 16 of heterologous metabolism, be arranged in bacterial strain the Expression element mvaE singly copied and MvaS (ES), Expression element mvk, mvaK2, mvd1, fni (S1) of double copies, three copy Expression element idsA, crtB and CrtI (GC) is, it can be achieved that lycopene fermentation level is greatly improved.

Embodiment 4, optimization derivant add the time

In the present embodiment, bacterial strain is produced using integrated bacterial strain DH416 as lycopene.

Such as aforementioned engineered strain condition of culture, other condition of culture are constant, only change inducer L-arabinose addition Add the time.

As a result, it has been found that when the derivant addition time is 12h (L-arabinose is added within the 12nd hour in culture, and first It is not added in beginning culture medium；And preceding embodiment 3 the result is that the 0th hour is added in initial medium), lycopene fermentation Horizontal highest is 393.2mg/L (Figure 13).According to diagram, also show in derivant 8~15 hours time of addition have it is relatively high Lycopene levels.

The research of embodiment 5, engineered strain DH416 stability

The engineered strain DH416 glycerol stocks of preservation are coated with LB tablets, is inverted in 30 DEG C of constant incubators and places about 20h.Picking single bacterium drops down onto in the Boiling tube containing 5mL LB liquid mediums, cultivates 12h under the conditions of 30 DEG C, 200rpm, is denoted as 0th generation.It draws 50 μ L 1st generation bacterium solutions to be forwarded in the Boiling tube containing 5mL LB liquid mediums, in 30 DEG C, 200rpm conditions Lower culture 12h, is denoted as 1st generation.Switching bacterium solution amount is 50 μ L every time, and so operation is until obtaining for the 21st generation.Period, switching the The expression of lycopene is carried out in 1 generation, the 11st generation and the 21st generation bacterium solution to FMGAT culture mediums.As a result such as Figure 14, lycopene obtain Significant change does not occur for rate, illustrates that engineered strain DH416 stability is fine.

Cultivated using bacterial strain D442SG, bacterial strain D442SG contains the plasmid of chloramphenicol (Cm) resistance, operating method with DH416 is similar.First, D442SG is coated with the solid LB tablets containing Cm.LB culture mediums are also answered used in the acquisition of 0th generation bacterium solution Contain Cm.Since 1st generation, carries out while passing on using two kinds of LB liquid mediums, one kind containing Cm, and another kind does not contain Cm.1st generation, the 11st generation and the bacterium solution in the 21st generation of equally transferring respectively are adding Cm and are not adding the FMGAT culture mediums of Cm respectively Middle synthesis lycopene.The inventors discovered that being passed on to engineered strain D442SG addition chloramphenicol (Cm), lycopene obtains Rate does not have significant change (Figure 14).But antibiotic is not added, engineered strain lycopene yield is decreased obviously (Figure 14).Cause This, the engineered strain containing single copy pUC pUC must add the stability that antibiotic maintains plasmid.On the one hand, this can increase Toxigenic capacity, on the other hand, large-scale use antibiotic is unfavorable for environment.

Culturing engineering bacterial strain DH416 in embodiment 6, fermentation tank

Picking single bacterium drops down onto in the shaking flask containing 240mL LB liquid mediums, and 12h is incubated overnight at 30 DEG C, 220rpm (2 bottles).2 bottles of overnight bacterium solutions respectively take 120mL, are forwarded in 5L fermentation tanks.

Fermentation tank primary condition：Containing 2.6L FMGT culture mediums (on FMGAT medium bases, be free of L-arabinose, Containing glucose 120g).

Fermentation culture conditions：Using ammonium hydroxide control ph 7.0 or so；Rotating speed is 500rpm；Temperature is controlled at 37 DEG C；It is empty Gas velocity is 3L/h.After fermented and cultured 7.5h, add L-arabinose 12g, is cooled to 33 DEG C.Then, the Portugals 0.234g are mended per 120s Grape sugar.After fermented and cultured 12h, L-arabinose 6g is added again.

The results show that when culture 20h, the yield of lycopene of engineered strain DH416 is very high, is 1.28g/L (Figure 15).

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To be made various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>East China University of Science

<120>A kind of lycopene superior strain, preparation method and application

<130> 182082

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 34

<212> DNA

<213>Primer (Primer)

<400> 1

gttttcccag tcacgacaag gagatggcgc ccaa 34

<210> 2

<211> 36

<212> DNA

<213>Primer (Primer)

<400> 2

ccatgattac gccaagccgg atatagttcc tccttt 36

<210> 3

<211> 20

<212> DNA

<213>Primer (Primer)

<400> 3

cttggcgtaa tcatggtcat 20

<210> 4

<211> 18

<212> DNA

<213>Primer (Primer)

<400> 4

gtcgtgactg ggaaaacc 18

<210> 5

<211> 34

<212> DNA

<213>Primer (Primer)

<400> 5

caaggtccaa atcatccaag gagatggcgc ccaa 34

<210> 6

<211> 37

<212> DNA

<213>Primer (Primer)

<400> 6

ggatgatttg gaccttgggc aatttctatg cgcaccc 37

<210> 7

<211> 19

<212> DNA

<213>Primer (Primer)

<400> 7

gtggtcaggt actggctaa 19

<210> 8

<211> 18

<212> DNA

<213>Primer (Primer)

<400> 8

gaaacgccgt cttctgtg 18

<210> 9

<211> 19

<212> DNA

<213>Primer (Primer)

<400> 9

cctgaaagaa ctggctgac 19

<210> 10

<211> 18

<212> DNA

<213>Primer (Primer)

<400> 10

aagcgttgtc gctggtgt 18

<210> 11

<211> 19

<212> DNA

<213>Primer (Primer)

<400> 11

accgagaaac cttgtgcca 19

<210> 12

<211> 18

<212> DNA

<213>Primer (Primer)

<400> 12

cacggacggg gaagatga 18

<210> 13

<211> 18

<212> DNA

<213>Primer (Primer)

<400> 13

acgctgaacc tgactgct 18

<210> 14

<211> 19

<212> DNA

<213>Primer (Primer)

<400> 14

gaagtggtgg ttgccaaac 19

<210> 15

<211> 20

<212> DNA

<213>Primer (Primer)

<400> 15

agacattaag actgcggcgt 20

<210> 16

<211> 22

<212> DNA

<213>Primer (Primer)

<400> 16

atatcaccca actggctgcg gc 22

Claims

1. a kind of method improving yield of lycopene, which is characterized in that the method includes：

(1) it is exogenously introduced Expression element in Escherichia coli, is allowed to exist：

Single copy ES elements, which includes acetyl coenzyme A-transacetylase/3-hydroxy-3-methylglutaric acid list acyl coenzyme A reductase genes and 3-hydroxy-3-methylglutaric acid list acyl-CoA synthetase gene；

Double or three copy S1 elements, which includes mevalonate kinase gene, phosphomevalonate kinase gene, first hydroxyl penta Sour pyrophosphoric acid decarboxylase gene and Isopentenyl diphosphate isomerase gene；

It is double, three or four copy GC elements, which includes difunctional short chain isopentenyl pyrophosphate synthase gene, octahydro kind Lycopene synthase gene and Phytoene dehydrogenase gene；

(2) Escherichia coli for cultivating (1), produce lycopene.

2. the method as described in claim 1, which is characterized in that (1) in, following Expression element is exogenously introduced in engineering bacteria： Single copy ES elements, double copy S1 elements, three copy GC elements；Preferably, the Expression element is integrated in Escherichia coli In genome.

3. method as claimed in claim 2, which is characterized in that the S1 elements or GC elements is integrated into bacillus coli gene 58th area of nonessential region of group, 44th area of nonessential region and/or the sites lpxM.

4. method as claimed in claim 2, which is characterized in that the S1 elements or GC elements are integrated into Escherichia coli base Because of 58th area of nonessential region of group, to improve lycopene yield；Or the GC elements are integrated into genome of E.coli The sites lpxM, to improve the growth ability of Escherichia coli.

5. method as claimed in claim 4, which is characterized in that (2) in, Fiber differentiation is carried out with L-arabinose；Preferably, In being induced for the 8th~15 hour for culture starting；More preferably it is being induced for the 12nd ± 1 hour in culture starting.

6. a kind of Escherichia coli of recombination, which is characterized in that including the following Expression element being exogenously introduced：

Single copy ES elements, which includes acetyl coenzyme A-transacetylase/3-hydroxy-3-methylglutaric acid list acyl coenzyme A reductase genes and HMG-CoA synthase genes；

It is double, three or four copy GC elements, which includes difunctional short chain isopentenyl pyrophosphate synthase gene, octahydro kind Lycopene synthase gene and Phytoene dehydrogenase gene.

7. the Escherichia coli recombinated as claimed in claim 6, which is characterized in that including the following expression member being exogenously introduced Part：Single copy ES elements, double copy S1 elements, three copy GC elements；Preferably, the Expression element is integrated in Escherichia coli Genome in.

8. the Escherichia coli recombinated as claimed in claim 7, which is characterized in that the S1 elements or GC elements is integrated into greatly 58th area of nonessential region of enterobacteria genome, 44th area of nonessential region, 8th area of nonessential region and/or the sites lpxM.

9. the Escherichia coli recombinated as claimed in claim 6, which is characterized in that the S1 elements or GC elements is integrated in greatly 58th area of nonessential region of enterobacteria genome；Or the GC elements be integrated in genome of E.coli 8th area of nonessential region and The sites lpxM.

10. a kind of kit for producing lycopene, which is characterized in that the kit includes claim 5~10 The Escherichia coli of any recombination.