CN106544348B

CN106544348B - Isopentenyl pyrophosphate isomerase gene and application thereof

Info

Publication number: CN106544348B
Application number: CN201510613790.5A
Authority: CN
Inventors: 李春; 胡开蕾; 韩莉; 张莎莎; 赖小勤; 刘伟丰; 徐欣怡; 高珊; 陶勇
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2015-09-23
Filing date: 2015-09-23
Publication date: 2020-03-31
Anticipated expiration: 2035-09-23
Also published as: CN106544348A

Abstract

The invention relates to an isopentenyl pyrophosphate isomerase gene and application thereof, and aims to solve the technical problem of low efficiency of synthesizing terpenoids by using engineering bacteria. The invention can be widely applied to the field of preparation of terpenoid.

Description

Isopentenyl pyrophosphate isomerase gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an isopentenyl pyrophosphate isomerase gene and application thereof.

Background

Terpenoids are compounds having an isoprene structural unit (C)₅H₈)nThe compounds of the general formula and derivatives thereof containing oxygen and having different saturation degrees are terpenoids which are prepared by condensing their precursors isopentenyl pyrophosphoric acid (IPP) and their isomers dimethylallyl pyrophosphoric acid (DMAPP).

Terpenoids are widely found in nature, and higher plants, fungi, microorganisms, insects, and marine organisms can synthesize terpenoids. Lycopene, astaxanthin, carotene, vitamin A, coenzyme Q10, paclitaxel and artemisinin are all terpenoids. Terpenoids have many physiological activities, such as eliminating phlegm, relieving cough, dispelling pathogenic wind, inducing perspiration, expelling parasites, and relieving pain, and are important effective components of Chinese herbal medicines; meanwhile, the compounds can also be used as important natural spices and are indispensable raw materials in the cosmetic and food industries; terpenoids are also important industrial raw materials, being important raw materials in the automotive industry and the aircraft industry, such as isoprene long chain compound rubber.

The traditional production method of terpenoids is extraction from plants, microorganisms and animals, for example, but the yields are very low. The reason is as follows: first, most terpenoids accumulate only in small amounts in nature; second, donor organisms are generally not suitable for large-scale culture, which is necessary for large-scale commercial production of terpenoids; third, the extraction of terpenoids requires toxic solvents, which require special processing steps, and thus commercial production of terpenoids becomes more complicated.

From n to 1C₅H₈(isoprene) to n ═ n (C)₅H₈)_nThe synthetic route of the terpenoid of the natural rubber has two stages, wherein the first stage is the generation stage of an isoprene unit IPP, and the second stage is the generation and modification stage of the terpenoid. In the first stage, two different pathways exist in nature, eukaryotes rely primarily on the Mevalonate (MVA) pathway to convert acetyl-CoA (acetyl-CoA) to IPP, which is then isomerized to DMAPP by isopentenyl pyrophosphate isomerase (IDI), prokaryotes generally rely on the deoxyxylulose-5-phosphate (MEP) pathway to produce IPP, which is then isomerized to DMAPP by IDI, and plants can utilize this pathwayThe MVA pathway can in turn utilize the MEP pathway (Mendoza-Poudereux I et al. plant Physiol biochem.201595: 113-20). It can be seen that in any synthesis pathway, the same enzyme is required, namely isopentenyl pyrophosphate isomerase isomerizes IPP into DMAPP to enter the generation stage of terpenoids, so that the search for an efficient isopentenyl pyrophosphate isomerase is greatly helpful for enhancing terpenoids synthesis pathways.

The fact that isoprene released into the atmosphere by plants every year reaches 5Tg is reported, and isoprene is a synthetic unit of terpenoids, so that a strong terpenoid synthetic route is inferred to exist in the plants, and the plants with high release amount are selected and probably can be a good source of isopentenyl pyrophosphate isomerase genes.

Some progress has been made in the research of isopentenyl pyrophosphate isomerase gene using genetic engineering technology, and researchers isolated and identified a small amount of isopentenyl pyrophosphate isomerase gene, but mainly concentrated on bacteria (Hamano Yet. Biosci Biotechnol biochem. 200165 (7):1627-35), fungi (Wu FL et. int JMed Mushooms. 201315 (3):223-32), and less in plants (Tong Y. Biotechnol applied biochem.2015Aug 2.doi:10.1002/bab.1427), especially in poplar, there was no research report, and there was no poplar isopentenyl pyrophosphate isomerase gene in the gene bank.

Disclosure of Invention

The invention aims to solve the technical problem of low efficiency of synthesizing terpenoid by using engineering bacteria, and provides the engineering bacteria with a stronger terpenoid synthesis path and application thereof.

To achieve the above object, an isopentenyl pyrophosphate isomerase gene is a gene represented by the following (a) or (b): (a) the nucleotide sequence of the gene cDNA is shown as SEQ ID No.1 of the sequence table; (b) the gene is a gene encoding the following proteins: the protein which is derived from the protein consisting of the amino acid sequence shown in the SEQ ID No.2 of the sequence table and has the activity of isopentenyl pyrophosphate isomerase after the amino acid sequence shown in the SEQ ID No.2 of the sequence table is substituted, deleted or added with one or more amino acids.

The invention also provides a protein expressed by the isopentenyl pyrophosphate isomerase gene, which is the protein of the following (a) or (b): (a) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table; (b) a protein derived from (a) by substituting, deleting or adding one or more amino acids in the amino acid sequence in (a) and having isopentenyl pyrophosphate isomerase activity; the protein composed of the amino acid sequence shown in the sequence 2 of the sequence table is coded by the base sequence shown in the sequence 1 of the sequence table.

The invention also provides a prokaryotic expression vector of the isopentenyl pyrophosphate isomerase gene.

The invention also provides an isoprene-producing engineering bacterium of the isopentenyl pyrophosphate isomerase gene prokaryotic expression vector.

The invention also provides the application of the isoprene producing engineering bacteria in the preparation of isoprene.

The invention also provides a terpenoid of the prenyl pyrophosphate isomerase gene prokaryotic expression vector, in particular to lycopene engineering bacteria.

The invention also provides the application of the lycopene-producing engineering bacteria in the preparation of lycopene.

The invention has the beneficial effects that: according to the release rate of isoprene in the nature of plants, the invention selects the poplar isopentenyl pyrophosphate isomerase gene with higher release amount to carry out separation, identification and cloning, successfully constructs an isoprene production strain and a terpenoid production strain, and finds a high-efficiency isopentenyl pyrophosphate isomerase for producing terpenoids by a biological method. The invention utilizes a genetic engineering means to clone a populus alba gene Paidi, and the gene Paidi is applied to escherichia coli, the capacity of the escherichia coli for producing isoprene and lycopene is obviously improved compared with that of the original strain, and the invention provides an efficient enzyme for large-scale industrial production of terpenoids by using microorganisms.

Drawings

FIG. 1 shows the result of agarose electrophoresis of total RNA of Populus alba;

FIG. 2 is a gas chromatography result of an isoprene standard;

FIG. 3 shows the results of gas phase detection of Paidi gene in E.coli isoprene engineering bacteria;

FIG. 4 is the full wavelength scan of a lycopene standard;

FIG. 5 shows the full-wavelength scanning result of 8h transformation of Paidii gene of Populus alba in lycopene engineering bacteria of Escherichia coli;

FIG. 6 shows the result of full-wavelength scanning of Paidi gene of Populus alba transformed in lycopene engineering bacterium of Escherichia coli for 24 h.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the examples described below, E.coli BW25113(Baba T et al. mol Syst biol.2006; 2:2006.0008.) is a non-pathogenic bacterium, with clear genetic background, short generation time, easy culture and inexpensive medium raw materials. Coli BW25113 is publicly available from the institute of microbiology, academy of sciences, and the above-mentioned biomaterials are used only for repeating the relevant experiments of the present invention, and are not used for other purposes.

Example 1: obtaining of Gene fragments

1. Extraction of total RNA from leaves of Populus alba

Populus tremula leaves are collected, total RNA of the Populus tremula leaves is extracted by using an RNeasy Plant Mini Kit (Qiagen company), the total RNA is extracted according to a Kit specification method, electrophoresis (figure 1) is carried out to verify the RNA extraction quality, the integrity of the RNA is good, and subsequent experiments can be carried out.

Preparation of RACE-Ready cDNA

The reverse transcription system for the first strand of RACE-Ready cDNA was as follows:

the method for obtaining the full length of cDNA is SMARTer-RACE, and uses

PCR cDNA Synthesis Kit (Clontech) and the primers and reagents used below except for GSP

PCR cDNA Synthesis kit in accordance with the kit instructions.

3. design of gene-specific primers:

according to the conservative area of IDI amino acid sequence of microorganism such as colibacillus, saccharomyces cerevisiae and the like and plants such as gum tree, cacao, badam and the like, a Gene Specific Primer (GSP) is designed by referring to the nucleic acid sequence of all known IDI genes, RACE-Ready cDNA is used as a template, GSP and a Universal Primer (Universal Primer Mix, UPM) are used as primers for amplification, and a 3 '-RACE cDNA fragment and a 5' -RACE cDNA fragment can be obtained.

A total of 5 GSP sequences, as shown in the following table:

example 2: obtaining the full Length of coding region of Paidi Gene

1.3' -obtaining of RACE cDNA terminal sequences

Amplifying by using 3' -RACE-Ready cDNA of populus alba as a template and UPM and GSP as primers

Reaction system:

reaction conditions are as follows:

3 '-RACE agarose gel detection shows that a single bright poplar DNA amplification band is connected with a T vector, competent cells are transformed, and a positive clone Sanger is selected for sequencing to obtain a 3' end cDNA sequence.

2.5' -obtaining of RACE cDNA terminal sequences

5' -RACE-Ready cDNA of Populus alba is used as a template, and UPM and GSP are used as primers for amplification.

Reaction system:

reaction conditions are as follows:

and 5 '-RACE agarose gel detection to obtain a single bright amplification band, selecting one of the amplification bands to be connected with a T vector, transforming competent cells, and selecting a positive clone Sanger for sequencing to obtain a 5' -end cDNA sequence.

3. Obtaining full-Length sequence

According to the sequencing results of 3 '-RACE and 5' -RACE, the sequence comparison is carried out to obtain the full-length sequence of the cDNA (sequence shown in SEQ ID No. 1) of the gene, and the DNA and amino acid sequences are analyzed: the gene has 705bp, codes 234 amino acids, and has ATG start codon and TGA stop codon, which indicates the integrity of the gene; the result of homology comparison in NCBI by using BLAST software shows that the gene is Nudix _ hydroscale member, the functional region is defined as Idi, and the homology with poplar (Populus eupatica) isopentyl-diphosphate Delta-isomerase I reaches 98%; it was found that the gene encoding PAIDI protein (sequence shown in SEQ ID No. 2) obtained isopentenyl pyrophosphate isomerase, abbreviated to Paidi gene, which had 98% homology to IPP isomerase family protein of Populus trichocarpa (Populus trichocarpa) and 92% homology to isopentenyl-diphosphate Delta-isomerase of rubber tree (Hevea brasiliensis) (Populus trichocarpa).

Example 3: construction of Escherichia coli isoprene-producing Strain

1. Construction of E.coli expression vector p2-0

The full-length primer sequences are as follows:

MB-F and MB-R are used as primers, a p2 plasmid is used as a template, the obtained gene fragment MB is subjected to double enzyme digestion of SalI and PstI (TAKARA company), the pSB1c expression vector (constructed in the laboratory, arabinose-inducible promoter, sequence of which is shown as SEQ ID No. 3) is subjected to double enzyme digestion of XhoI and PstI, the MB gene fragment is connected to the pSB1c vector to obtain p2-0, the p2-0 is transformed into trans5 α competent cells, a positive clone is selected for sequencing, and the nucleotide sequence of p2-0 is SEQ ID No. 4.

2. Construction of E.coli expression vector p2-paidi

The full-length primers PAFa and PARa have the following sequences:

PAFa：5'ATCGGctgcagATGGGTGACGCTCCTGATGC 3'

PARa：5'ATCCGctgcagTCAAGTCAGCTTGTGAATCGC 3'

the Paidi gene fragment obtained by using the primers PAFa and PARa is subjected to PstI (TAKARA company) single enzyme digestion, the PstI of the p2-0 expression vector is subjected to single enzyme digestion, the Paidi gene fragment is connected to a pat-0 vector to obtain p 2-paiidi, the p 2-paiidi is transformed into trans5 α competent cells, positive clones are selected for sequencing, and the nucleotide sequence of the p 2-paiidi is SEQ ID No. 5.

3. Construction of isoprene producing Strain MV/Paidi

The constructed p2-paidi, plasmid p1 and pBAD-SkispS were co-transformed into BW25113 host to obtain isoprene producing strain MV/paidi.

And constructing a control strain MV/ecidi by cotransforming p2, plasmid p1 and pBAD-SkispS into BW25113 host to obtain the idi gene control strain MV/ecidi of the escherichia coli.

In the method for constructing the isoprene producing bacteria, p1 and p2 contain genes in the isoprene synthetic pathway-Mevalonate (MVA) pathway. Wherein p1 is composed of MvaE (acetyl coenzyme A acetyltransferase) gene, MvaS (HMG-acetyl coenzyme A synthetase) gene and MVK (mevalonate kinase) gene, said MvaE gene encoding a protein consisting of the amino acid sequence shown in SEQ ID No. 6; the MvaS gene codes a protein consisting of an amino acid sequence shown in SEQ ID No. 7; the MVK gene codes protein consisting of an amino acid sequence shown in SEQ ID No. 8. p2 is composed of PMK (phosphomevalonate kinase) gene, MVD (mevalonate decarboxylase pyrophosphate) gene and idi (isoprene pyrophosphate isomerase) gene, the PMK gene encodes a protein composed of amino acid sequence shown in SEQ ID No. 9; the MVD gene codes a protein consisting of an amino acid sequence shown in SEQ ID No. 10; the idi gene encodes a protein consisting of an amino acid sequence shown in SEQ ID No. 11.

Wherein p1 is a streptomycin resistant arabinose inducible expression vector, the nucleotide sequence of p1 is SEQ ID No.12, comprising an MVA upstream pathway gene expression cassette, the nucleotide sequence of the MVA upstream pathway gene expression cassette is 1307-5821 of SEQ ID No.12, the 89-964 of SEQ ID No.12 is an arabinose promoter, the 5930-6087 of SEQ ID No.12 is a TrrnB terminator, the 1307-3729 of SEQ ID No.12 is a coding sequence of an MvaE gene, the 3730-4904 of SEQ ID No.12 is a coding sequence of an Mvas gene, and the 4905-5821 of SEQ ID No.12 is a coding sequence of an MVK gene.

P2 is a chloramphenicol resistant arabinose inducible expression vector, the nucleotide sequence of P2 is SEQ ID No.13, comprises an MVA downstream pathway gene expression cassette, the nucleotide sequence of the MVA downstream pathway gene expression cassette is 1309-4442 th of SEQ ID No.13, the 89-964 th of SEQ ID No.13 is an arabinose promoter, the 4569-4726 th of SEQ ID No.13 is a TrrnB terminator, the 1309-2661 th of SEQ ID No.13 is a PMK gene coding sequence, the 2677-3864 th of SEQ ID No.13 is an MVD gene coding sequence, and the 3894-4442 th of SEQ ID No.13 is an idi gene coding sequence.

pBAD-SkispS is an ampicillin-resistant arabinose-inducible expression vector, has a sequence shown in SEQ ID No.20, and comprises a weeping willow isoprene synthetase gene so that Escherichia coli has the capacity of producing isoprene.

Example 4: application of Paidi gene in escherichia coli isoprene engineering bacteria

1. Detection of Escherichia coli fermentation product

The method for fermenting the engineering bacteria MV/pacifi and the control bacteria MV/pacifi of the escherichia coli comprises the following steps: the engineering bacteria are transferred into 30mL (500mL triangular flask) of arabinose self-induced medium (ZYM) containing streptomycin, chloramphenicol and ampicillin resistance in a percent inoculation amount, and cultured for 20 hours at 30 ℃ and 280 rpm. The bacterial liquid is collected centrifugally at 4 ℃ and 4000rpm, resuspended to 60OD bacterial concentration by using M9 culture medium containing 4% glucose, 1mL of the resuspended bacterial liquid is placed in a 20mL headspace bottle, and shake culture is carried out at 37 ℃ and 280rpm for 30 h.

The formula of the self-induction culture medium ZYM containing streptomycin, chloramphenicol and ampicillin is as follows: 100mL A +2mL B +2mL C + 200. mu. L D + 100. mu. L E (in the following, the concentrations are in mass percent);

a, ZY: 1% tryptone, 0.5% yeast powder;

b.50 × M: 1.25M Na2HPO4, 1.25M KH2PO4, 2.5M NH4Cl, and 0.25M Na2SO 4;

c.50 × 5052: 25% glycerol, 2.5% glucose, 10% lactose;

D.1M MgSO4；

e.1000 × microelements: 50mM FeCl3, 20mM CaCl2, 10mM MnCl2, 10mM ZnSO4, CoCl2, NiCl2, Na2Mo4, Na2SeO3 and H3BO3 each at 2 mM;

streptomycin with a final concentration of 50mg/L, chloramphenicol with a final concentration of 34mg/L, and ampicillin with a final concentration of 100 mg/L.

The formulation of the M9 medium is shown in molecular cloning, a laboratory Manual (scientific Press), third edition, page 1595.

After the reaction, Gas Chromatography (GC) analysis was carried out using Agilent 7890AGC Sysysyytem and Agilent7697A head space Sampler, and HP-5 as a gas separation column. The headspace sampling method is as follows, Time: GC cycle time 20min, visual equib time 6 min; temperature (. degree. C.): oven51, Loop/Valve 55, Transfer line 60. The GC method was as follows: flow rate: 2mL/min, 0 min-4 min 50 ℃, 4 min-8.5 min 50-280 ℃, 8.5 min-10.6 min 280 ℃.

According to the method, the peak-off time of an isoprene standard (Sigma company) is 1.75min (figure 2), and GC chromatograms of an engineering bacterium MV/paidi of escherichia coli and a negative control bacterium MV/ecidi (figure 3) show that the yield of MV/paidi is improved by 3.71 times compared with the yield of MV/ecidi, and the yield of 7.8g/L is achieved.

Example 5: construction of Escherichia coli lycopene-producing Strain

1. Construction of E.coli expression vector pSB1 s-pacifi

The full-length primers PAFa and PARa have the following sequences:

PAFa：5'atCGGctgcagATGGGTGACGCTCCTGATGCT 3'

PARa：5'atCCGctgcagTCAAGTCAGCTTGTGAATCGC 3'

the Paidi gene obtained by using primers PAFa and PARa poplar cDNA as templates is subjected to PstI (TAKARA company) single enzyme digestion of the obtained fragment, the pSB1s expression vector is subjected to PstI single enzyme digestion, the Paidi gene fragment is connected to the pSB1s vector to obtain pSB1 s-paiidi, the pSB1 s-paiidi is transformed into trans5 α competent cells, positive clones are selected for sequencing, and the nucleotide sequence of the pSB1 s-paiidi is SEQ ID No. 14.

2. Construction of E.coli expression vector pSB1s-ecidi

The full-length primers ECFa and ECRa have the following sequences:

ECFa：5'ATCGGCTGCAGAAGGAGATATAATGCAAACGG 3'

ECRa：5'ATCCGCTGCAGTTATTTAAGCTGGGTAAATG 3'

the ECFa and ECRa are used as primers, escherichia coli BW25113 bacterial liquid is used as a template, the obtained Ecidi gene is amplified, the obtained fragment is subjected to PstI (TAKARA company) single enzyme digestion, the pSB1s expression vector is subjected to PstI single enzyme digestion, the Paidi gene fragment is connected to the pSB1s vector to obtain pSB1s-Ecidi, the pSB1s-Ecidi is transformed into trans5 α competent cells, positive clones are selected for sequencing, and the nucleotide sequence of pSB1s-Ecidi is SEQ ID No. 15.

3. Construction of lycopene-producing Strain BW/Paidi

The constructed pSB1s-paidi and plasmid pL10-2 are co-transformed into BW25113 host to obtain the lycopene production strain BW/paidi 10.

And a control strain BW/ecidi is constructed by cotransforming pSB1s-ecidi and a plasmid pL10-2 into a BW25113 host to obtain an escherichia coli idi control strain BW/ecidi 10.

In the construction method of the lycopene producing strain, the pL10-2 nucleotide sequence is shown as SEQ ID No. 19. Comprising genes of the lycopene synthesis pathway. The lycopene synthesis related gene comprises crtE (cage for animals Coco-tyrosol pyrophosphate synthetase) gene, crtI (phytoene dehydrogenase) gene and crtB (phytoene synthase) gene; the crtE gene codes protein consisting of an amino acid sequence shown in SEQ ID No. 16; the crtI gene codes protein consisting of an amino acid sequence shown in SEQ ID No. 17; the crtB gene encodes a protein consisting of an amino acid sequence shown in SEQ ID No. 18.

In the construction method of the recombinant bacterium producing the streptosporine, the coding sequence of the crtE gene is the 1995-2906 th site of SEQ ID No. 19; the coding sequence of the crtI gene is 2924-4402 of SEQ ID No. 19; the coding sequence of the crtB gene is position 4420-5349 of SEQ ID No. 19.

Application of Paidi gene in production of lycopene by escherichia coli

(1) Fermentation and transformation of lycopene-producing engineering bacteria

The Escherichia coli engineering bacteria BW/pacifi 10 and the control bacteria BW/pacifi 10 are fermented by the following method: the engineering bacteria are transferred into 30mL (500mL triangular flask) of arabinose self-induced culture medium (the formula is the same as the above) containing streptomycin and chloramphenicol according to one percent of inoculation amount, and the culture is carried out for 20h at 30 ℃ and 280 rpm. The bacterial liquid is collected centrifugally at 4 ℃ and 4000rpm, resuspended to 1OD thallus concentration by using M9 culture medium containing 4% glucose, 2mL of the resuspended bacterial liquid is placed in a 20mL triangular flask, shake-cultured for 24h at 37 ℃ and 280rpm, and the samples are respectively sampled for 8h and 24 h.

The sampling method is as follows: take 1X 10⁸Adding 1ml of acetone into cfu thallus for extraction, standing at 4 ℃ for 3 hours, centrifuging to obtain supernate, obtaining a sample to be detected, and scanning at a wavelength of 474 nm. The experiment was repeated three times, each time in 3 20ml triangular flasks for each strain were subjected to the above glucose conversion.

(2) Determination of lycopene yield of lycopene-producing engineering bacteria

The content of lycopene in the sample to be tested is quantitatively analyzed by using lycopene (Sigma company) as a standard substance and adopting a standard curve method (external standard method). The standard substance has the highest peak at 474nm after wavelength scanning (figure 4), the two engineering bacteria samples for producing lycopene both have the highest peak at 474nm, figure 5 is the full wavelength scanning result of lycopene after 8h of conversion, and figure 6 is the full wavelength scanning result of lycopene after 24h of conversion.

Quantitative analysis of lycopene production in E.coli showed that as shown in Table 1, the production of BW/pacifi 10 lycopene was significantly higher than control BW/pacifi 10, the production at 8 hours was 3.48 times that of the control, and the production at 24 hours was 3.06 times that of the control.

TABLE 1

Claims

1. An isopentenyl pyrophosphate isomerase gene characterized by the following gene (a) or (b):

(a) the nucleotide sequence of the gene cDNA is shown as a sequence 1 in a sequence table;

(b) the gene is a gene encoding the following proteins: a protein consisting of an amino acid sequence shown in a sequence 2 of a sequence table.

2. The protein expressed by the isopentenyl pyrophosphate isomerase gene of claim 1, which is characterized by the following proteins:

(a) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;

the protein consisting of the amino acid sequence shown in the sequence 2 of the sequence table is coded by a base sequence shown in the sequence 1 of the sequence table.

3. A prokaryotic expression vector comprising the isopentenyl pyrophosphate isomerase gene of claim 1.

4. An engineered isoprene-producing bacterium containing the prenyl pyrophosphate isomerase gene prokaryotic expression vector of claim 3.

5. An engineered bacterium for producing lycopene comprising the prenyl pyrophosphate isomerase gene prokaryotic expression vector as described in claim 3.

6. The use of the engineered bacterium producing isoprene of claim 4 in the preparation of isoprene.

7. Use of the lycopene-producing engineering bacteria of claim 5 in the preparation of lycopene.