CN114752587B

CN114752587B - Terpene synthase gene AlTPS1 for synthesizing elemene alcohol in rhizoma atractylodis lanceae, and coded product and application thereof

Info

Publication number: CN114752587B
Application number: CN202210351990.8A
Authority: CN
Inventors: 查良平; 吴君贤; 彭华胜; 胡健鹏; 管凤雅; 鲁继梅; 刘巍玮
Original assignee: Anhui University of Traditional Chinese Medicine AHUTCM
Current assignee: Anhui University of Traditional Chinese Medicine AHUTCM
Priority date: 2022-04-02
Filing date: 2022-04-02
Publication date: 2023-09-08
Anticipated expiration: 2042-04-02
Also published as: CN114752587A

Abstract

The invention discloses a terpene synthase gene AlTPS1 for synthesizing elemene from rhizoma atractylodis lanceae, and a coded product and application thereof. The terpene synthase gene AlTPS1 has a nucleotide sequence shown as SEQ ID NO.1, and a product coded by the terpene synthase gene AlTPS1 has an amino acid sequence shown as SEQ ID NO. 2; alternatively, the amino acid sequence of the product exhibits substitution, absence or addition of one or more amino acids but expresses the same function as the amino acid sequence shown in seq id No. 2. The terpene synthase gene AlTPS1 can be used for improving the content of atractylis lancea terpenoid substances by using a genetic engineering technology, and the terpene synthase gene AlTPS1 can also be applied to a path for preparing elemene by using FPP as a substrate. The technology can be used for producing the elemene in a large amount through a bacterial system in the follow-up process, and provides an effective method for meeting the huge market demands of terpenoid components.

Description

Terpene synthase gene AlTPS1 for synthesizing elemene alcohol in rhizoma atractylodis lanceae, and coded product and application thereof

Technical Field

The invention belongs to the field of medicinal plant genetic engineering, and in particular relates to a terpene synthase gene AlTPS1 for synthesizing elemene in rhizoma atractylodis lanceae, and a coded product and application thereof.

Background

The "chinese pharmacopoeia" 2020 discloses that rhizoma Atractylodis Atractylodes lancea (thunder.) dc, which is one of medicinal plant sources of rhizoma Atractylodis, has the effects of dispelling pathogenic wind, dispelling cold, eliminating dampness, invigorating spleen, improving eyesight, and can be used for treating damp obstruction of middle energizer, edema, rheumatalgia, night blindness, and eye dryness.

The terpenoid component has extremely high economic value and medical value. Terpenoid components such as hinokitiol, beta-eucalyptol, atractylone, elemene, guaifenesin, beta-caryophyllene and the like have been isolated from atractylis lancea. The terpene precursor isopentenyl pyrophosphate (Isopentenyl diphosphate, IPP) and its isomer dimethylpropenyl pyrophosphate (Dimethylallyl diphosphate, DMAPP) come mainly from two pathways, the mevalonate (Mevalonic acid pathway, MVA) pathway in the cytoplasm and the methylerythrose (Methylerythritol phosphate pathway, MEP) pathway in the plastids, respectively. The MVA pathway mainly synthesizes secondary metabolites such as sesquiterpenes, triterpenes and the like; the MEP pathway mainly synthesizes secondary metabolites such as monoterpenes, diterpenes, carotenoids and the like in plastids. Under the catalysis of different prenyltransferases, 1-3 IPPs are combined with 1 DMAPP molecule to generate precursors such as GPP, FPP, GGPP and the like, and then the precursors are catalyzed by different terpene synthases to form carbon skeleton structures such as monoterpenes, sesquiterpenes, diterpenes, triterpenes and the like.

At present, the atractylis lancea terpene synthase gene AlTPS1 gene has not been isolated and identified, and the application of the atractylis lancea terpene synthase gene AlTPS1 in the synthesis of elemene has not been shown.

Disclosure of Invention

Aiming at the problems, the invention discloses a terpene synthase gene AlTPS1 for synthesizing elemene in rhizoma atractylodis lanceae, which has a nucleotide sequence shown as SEQ ID NO. 1.

The invention also discloses a terpene synthase gene AlTPS1 coded product, which has an amino acid sequence shown as SEQ ID NO. 2; or alternatively, the process may be performed,

the amino acid sequence of the product exhibits substitution, absence or addition of one or more amino acids but expresses the same function as the amino acid sequence shown in SEQ ID NO. 2.

Further, the product is a polypeptide or a protein.

The invention also discloses a recombinant expression vector containing the terpene synthase gene AlTPS1.

Furthermore, the recombinant expression vector is obtained by taking a pET-21a expression vector as a starting vector and inserting the terpene synthase gene AlTPS1 between BamHI enzyme cutting sites of the pET-21a expression vector.

Further, the recombinant expression vector is constructed according to the following steps:

PCR amplification is carried out by taking cDNA of atractylis lancea terpene synthase gene AlTPS1 as a template and using primers shown as SEQ ID NO.3 and SEQ ID NO. 4;

and (3) carrying out single enzyme digestion on the PCR product and the pET-21a expression vector, recovering the cut gel, purifying, and then connecting and converting the mixture into escherichia coli to obtain the recombinant expression vector pET-21a-AlTPS1.

The invention also discloses recombinant engineering bacteria containing the terpene synthase gene AlTPS1.

The invention also discloses a host cell containing the terpene synthase gene AlTPS1.

The terpene synthase gene AlTPS1 disclosed by the invention can be applied to the production of terpene compounds elemene.

The recombinant expression vector can be applied to the production of the terpenoid elemene.

The host cell of the terpene synthase gene AlTPS1 can promote the synthesis of the terpene compound elemene.

The invention has the beneficial effects that:

the invention clones a terpene synthase gene AlTPS1 for synthesizing elemene from rhizoma atractylodis lanceae, and the enzyme can be applied to a path for preparing elemene by taking FPP as a substrate; the gene provided by the invention can improve the content of atractylis lancea terpenoid substances through a genetic engineering technology. The technology can be used for producing the elemene in a large amount through a bacterial system in the follow-up process, and provides an effective method for meeting the huge market demands of terpenoid components.

Additional features and advantages of the invention will be set forth in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objectives and other advantages of the invention may be realized and attained by the structure particularly pointed out in the written description and claims hereof as well as the appended drawings.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions of the prior art, the following description will briefly explain the drawings used in the embodiments or the description of the prior art, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the analysis of the prediction of the AlTPS1 domain of the atractylis lancea terpene synthase gene in the examples of the present invention;

FIG. 2 shows the secondary structure of the atractylis lancea terpene synthase gene AlTPS1 in example 2 of the present invention;

FIG. 3 shows the tertiary structure of the atractylis lancea terpene synthase gene AlTPS1 in example 2 of the present invention;

FIG. 4 shows a phylogenetic tree of the atractylis lancea terpene synthase gene AlTPS1 in example 2 of the present invention;

FIG. 5 shows an SDS-polyacrylamide gel electrophoresis of the atractylis lancea terpene synthase AlTPS1 protein of example 4 of the present invention;

FIG. 6a shows an ion flow diagram of empty pET-21a in example 5 of the present invention;

FIG. 6b shows a general ion flow diagram of the AlTPS1 protein catalyzed FPP product of example 5 of the present invention;

FIG. 6c shows a mass spectrum of the peak of idle pET-21a in example 5 of the present invention at retention time 28.486 min;

FIG. 6d shows a mass spectrum of the peak of the invention in example 5 with retention time 28.486min for the FPP product catalyzed by AlTPS1 protein.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The features and capabilities of the present invention are described in further detail below in connection with the examples. In the embodiment of the invention, the RNA Prep Pure Plant Kit kit is selected from Beijing Tiangen Biochemical technology Co., ltd, and the reverse transcription kit PrimeScript ^TM II 1st Strand cDNA Synthesis Kit from Takara Bio Inc.; cut gum recovery kit EasyPure Quick Gel Extraction Kit, e.coli Transetta (DE 3) purchased from beijing full gold biotechnology limited; restriction enzymes such as high fidelity enzyme Phusion, bamHI are purchased from Beijing Inc. of New England (NEB) Biotechnology; the primer is synthesized by Shanghai biological engineering Co., ltd; other reagents are imported or homemade analytically pure reagents.

EXAMPLE 1 cloning of atractylis lancea terpene synthase Gene AlTPS1

The wild rhizoma Atractylodis (Atractylodes lancea) sample is obtained from Yuexi county of Anhui province, and total RNA of rhizoma Atractylodis (Atractylodes lancea rhizome) is extracted according to RNA Prep Pure Plant Kit kit operation instructions, and TaKaRa reverse transcription kit (PrimeScript) ^TM II 1st Strand cDNA Synthesis Kit) and carrying out reverse transcription to obtain the cDNA of the rhizoma atractylodis lanceae. AlTPS1 gene specific primers were designed using Primer Premier 5.0 software according to the Atractylodes lancea transcriptome database:

an upstream primer: p1:5'ATGAGCACCGTGCAAGAAAACGTGG 3';

a downstream primer: p2:5'TTAGGTGCTAATGCTATCCACAAAC 3'.

PCR amplification is carried out by taking the full-length sequence of the atractylis lancea terpene synthase gene AlTPS1 as a template.

The amplification system is as follows: 5 XBuffer 10. Mu.L, dNTP (2.5 mmol.L) ^-1 ) 4. Mu.L of primer-F and primer-R each 1. Mu.L, transStartFastPfu FlyDNA Polymerase. Mu.L, template 1. Mu.L, the remainder were made up with sterile double distilled water.

Reaction conditions: pre-denaturation at 95℃for 2min, denaturation at 95℃for 20s, annealing at 56℃for 20s, extension at 72℃for 30s, extension at 72℃for 5min after 40 cycles, and preservation at 4 ℃. After the reaction, cloning of atractylis lancea terpene synthase gene AlTPS1 is obtained.

Example 2 bioinformatics analysis of atractylis lancea terpene synthase Gene AlTPS1

The invention obtains the full-length sequence of the atractylis lancea terpene synthase gene AlTPS1, the length of an Open Reading Frame (ORF) of the AlTPS1 gene is 1644bp, and 547 amino acids are encoded. The detailed nucleotide sequence is shown as SEQ ID NO.1 in the sequence table, and the amino acid sequence is shown as SEQ ID NO.2 in the sequence table.

As can be seen from the protein domain analysis by NCBI CDD (Conserved Domain Database), alTPS1 belongs to the Isoprenoid-Biosyn-C1 superfamily and is an Isoprenoid biosynthetic enzyme, and the analysis results are shown in FIG. 1.

Protein secondary structure analysis was performed using an on-line tool PDBsu (http:// www.ebi.ac.uk/thorn-srv/databases/pdbs um/generator. Html), the secondary structure of which was composed mainly of an alpha-helix structure, as shown in FIG. 2, with an alpha-helix (alpha helix) of AlTPS of 55.39% in the polypeptide chain, an extended chain (extended strand) of 13.71% and a random coil (random coil) of 30.9%.

Modeling according to AlTPS1 amino acid sequence by using Swiss Model (http:// swissmodel. Expasy org /) program and PyMOL software, predicting the tertiary structure of the protein, wherein the obtained tertiary structure is shown in figure 3, the AlTPS1 protein Model 4gax.1.A is scored as 0.86, and the similarity of the protein sequences is 56.04%; the MEGA 6 software is used for constructing a Neighbor-joining system evolutionary tree, the repetition number of bootstrap is 1000, the obtained structure is shown in figure 4, and as can be seen from figure 4, the atractylis lancea sesquiterpene synthase gene AlTPS1 and beta-caryophyllene synthase are located at the same branch point, and the relationship is highest.

EXAMPLE 3 construction of atractylis lancea terpene synthase Gene AlTPS1 prokaryotic expression vector

The cDNA of AlTPS1 gene is used as a template, bamHI is selected as a single cleavage site, a specific upstream primer and a specific downstream primer (shown in Table 1) are designed, and PCR amplification reaction is carried out, wherein the scribing part of the primers is the cleavage site.

And (3) carrying out PCR amplification by taking the recombinant plasmid as a template. And (3) detecting the amplified product by 1% agarose gel electrophoresis, and performing gel cutting recovery on the amplified product. And (3) respectively carrying out BamH I enzyme digestion treatment on the products obtained after the gel cutting recovery and the prokaryotic expression vector pET-21a plasmid, and carrying out gel cutting recovery. And (3) connecting the target fragment after glue cutting recovery with an expression vector pET-21a by using a seamless splicing kit at 50 ℃ for 30min, converting the connection product into competent cells of escherichia coli Trans1-T1, and selecting a monoclonal to perform bacterial liquid PCR positive test, sequencing and extracting plasmids.

In the embodiment, easyPure Quick Gel Extraction Kit is adopted as a gel cutting recovery kit; the seamless splice kit adopts pEASY-Uni Seamless Cloningand Assembly Kit.

EXAMPLE 4 Induction of expression of engineering strains

E.coli Transetta (DE 3) competent cells were transformed with the recombinant expression vector pET-21a-AlTPS1 of example 3, and positive strains were screened by culture. The strain contains high-efficiency expression capable of inducing AlTPS1 recombinant genes.

The transformed expression bacterial liquid is added into LB culture liquid containing Amp (ampicillin) resistance according to the proportion of 1:100, the culture is carried out at 37 ℃ under shaking at 200rpm until A600=0.4-0.6, 0.4mM IPTG (isopropyl thiogalactoside) with the final concentration is added for low-temperature induction at 16 ℃ for overnight, and pET-21a empty load is treated under the same conditions to be used as a blank control. Taking 1mL of bacterial liquid, centrifuging to obtain sediment as whole bacteria, centrifuging the rest bacterial liquid to remove supernatant to obtain thalli, adding 3-5mL of PBS, re-suspending, placing in an ultrasonic crusher, and performing ultrasonic crushing for 5min (5 s interval) with an ultrasonic efficiency of 25%, and inserting a centrifuge tube into a beaker filled with ice (the whole process is operated on ice). Ultrasonically crushing the lysate, and centrifuging at 4 ℃ for 15min to obtain the supernatant and precipitate of AlTPS1 protein.

The result of SDS-polyacrylamide gel electrophoresis of the atractylis lancea terpene synthase gene AlTPS1 protein is shown in figure 5, and the electrophoresis result shows that an obvious specific protein expression band appears at the molecular weight of about 63kDa and is consistent with the theoretical value; in FIG. 5, lane M is Protein Ruler Marker (protein rule marker); lane 1 is the whole non-induced AlTPS1 bacteria; lane 2 is induced AlTPS1 whole bacteria; lane 3 is the induced alpps 1 supernatant; lane 4 is induced AlTPS1 pellet; lane 5 is E.collaransetta (DE 3) whole bacteria containing pET-21a empty vector.

Example 5 in vitro enzyme function validation

Experimental conditions: mu.L of the reaction system (430. Mu.L of crude enzyme solution, 50. Mu.L of 100mM Tris-HCl, 10. Mu.L of famesyl tri-ammonium pyrophosphate, 5. Mu.L each of 10mM MgCl2 and 1mM DTT) was prepared in a 1.5mL centrifuge tube, vortexed and centrifuged, and water-bath at 30℃for 2 hours. Then 500. Mu.L of n-hexane was added, vortexed and centrifuged to suck the upper n-hexane extract, and the above steps were repeated 3 times to combine the extracts. Concentrated to dryness in vacuo, reconstituted with 200 μl of n-hexane, transferred to an inner cannula, and the catalytic product detected by gas chromatography-mass spectrometry (GC-MS).

The specific detection conditions are as follows:

the GC-MS instrument was a 7890B-7000B triple quadrupole gas chromatograph-mass spectrometer (Agilent, USA) and the column was DB-5MS (60 mX0.25 mm X0.25 μm with a helium flow rate of 1mL/min.

Chromatographic conditions: kept at 50℃for 5min, and expanded at 10℃/min to 240℃for 10min.

Mass spectrometry conditions: ion source temperature 150 ℃, interface temperature 250 ℃, electron energy 70eV, scanning mass range 50-300aum.

The catalytic products are detected according to the conditions, the obtained total ion flow diagram of the sample is shown in fig. 6, wherein fig. 6a is an ion flow diagram of an empty load pET-21a, fig. 6c is a mass spectrum diagram of a peak with retention time of 28.486min, fig. 6b is a total ion flow diagram of an AlTPS1 protein catalytic FPP product, fig. 6d is a mass spectrum diagram of a peak with retention time of 28.486min of the AlTPS1 protein catalytic FPP product, the sample has a characteristic peak with retention time of 28.486min, and the result shows that the corresponding compound is elemene alcohol through NIST MS database retrieval and comparison. Therefore, when FPP is taken as a substrate, the in-vitro enzyme catalytic reaction product of pET-21a-AlTPS1 is identified as the terpenoid elemene through mass spectrum, which proves that the enzyme generated by encoding the AlTPS1 gene is a single-function enzyme gene capable of catalyzing FPP to generate terpenoid.

In conclusion, the invention clones the encoding gene (AlTPS 1) of the terpene synthase from rhizoma atractylodis lanceae. AlTPS1 gene is transferred into cells, alTPS1 is expressed in host cells, and the synthesis of terpene compound elemene alcohol is promoted. The technology can be used for subsequent mass production of elemene through thalli, and provides an effective method for meeting the huge market demands faced by terpenoid components. The gene provided by the invention can improve the content of atractylis lancea terpenoid elemene through genetic engineering technology.

It should be understood that, in the embodiments of the present invention, one skilled in the art may replace, delete or add one or several amino acids according to the amino acid sequence of the coding product of the gene AlTPS1 disclosed in the present invention without affecting the activity thereof, to obtain a mutant sequence of the coding product, which also falls within the scope of the present invention.

SEQ ID NO.1 sequence is as follows:

atgagcaccgtgcaagaaaacgtggtgcgcgcgaccgcgagctttccgctggatatttggggcgatcagtttctggtgtgcgatcagcaagaagaacaagatgaagtggaacaagtggtggaggatctgaaagaagaagtgcgcaaagaaattctggcggcgctgaacgtgccggcggaacataccaatctgctgaaactggtggacgcgattcagcgcctgggcattgcgtattattttgaagaggaaattaacgaagtgctgaaacatatttatgtgagcaacggcgataactggaccggcggttgcccgagcctgtggtttcgcttactgcgtcagcaaggcttttttgtgagttgcgatatttttaacaactataaagataaagatggtagctttaaagagtgcctggcgaacgatgtgcaaggcctgctggatctgtatgaagcggcgtatatgcgcgtgcaaggcgaagatatcctggatgatgcgctggtgtttacccgcacccgcctggatgatattagcaaagatccactgcgcggcaccaacaccgatagcacgcagattcaagaagcgctgaaacagccactgctgaaacgcctgccgcgcctggaagccctgcgctatattccgttttatcagcaacaagcgagccataacaaatatctgctgaaactggccaaactgggctttaaccaagtgcagagcctgcataaaaaagaactgagtcagctgagcaaatggtggaaaggctatgatgtgaccaacaactttccgtatgcgcgcaaccgcctggttgagtgctatttttgggcgcaaggcgtgtattttgaaccgaaatatagtcagagccgcatttttctggcgaaaaacctggcgaccgcgagtattctggatgatacctatgatgcgtatggcacctatgaagaactgaaaatttttaccgaggcgattcagcgctggagcattacgtgcctggatatgttaccggaatatatgaaaccgctgtatcagatggtgattgatgtgtataaagaaatggaagaaattatggcggatgaagaaaaagcgtattatctgaacaacgcgattgaaagcatgaaagaatttattggtagctatatgaccgaagcgaaatggggcaacgaaggctatattccgaccaccgaagaacatattagcgtggcgttaattagtagcggcaccaaacatctggtgaccacgagctttgtgggcatgaacgatatgattaccgaagagagctttaaatgggtgagcaccaacccgccgctgattaaagcggccgcggcggtgggccgctttgtggatgatattgtgagccataaagaagaacaagaacgcaaacatgtggcgagcgtggtggagtgctatatggaacagtttgatgtgaccgaagatcatgtgtatgatctggtgaacaaaaaaatcgatcaagcgtggaaagaaattgtgcgcgaaagcctgatgtgcaaagatgtgccgatggccttaattatgcgcgcgattaactttgcgcgcggcatggaagtgatgtataaaggccaagataactatacccacatgggcgatgaaatgattaaccatattaaaagcctgtttgtggatagcattagcacctaa

SEQ ID NO.2 sequence is as follows:

MetSerThrValGlnGluAsnValValArgAlaThrAlaSerPheProLeuAspIleTrpGlyAspGlnPheLeuValCysAspGlnGlnGluGluGlnAspGluValGluGlnValValGluAspLeuLysGluGluValArgLysGluIleLeuAlaAlaLeuAsnValProAlaGluHisThrAsnLeuLeuLysLeuValAspAlaIleGlnArgLeuGlyIleAlaTyrTyrPheGluGluGluIleAsnGluValLeuLysHisIleTyrValSerAsnGlyAspAsnTrpThrGlyGlyCysProSerLeuTrpPheArgLeuLeuArgGlnGlnGlyPhePheValSerCysAspIlePheAsnAsnTyrLysAspLysAspGlySerPheLysGluCysLeuAlaAsnAspValGlnGlyLeuLeuAspLeuTyrGluAlaAlaTyrMetArgValGlnGlyGluAspIleLeuAspAspAlaLeuValPheThrArgThrArgLeuAspAspIleSerLysAspProLeuArgGlyThrAsnThrAspSerThrGlnIleGlnGluAlaLeuLysGlnProLeuLeuLysArgLeuProArgLeuGluAlaLeuArgTyrIleProPheTyrGlnGlnGlnAlaSerHisAsnLysTyrLeuLeuLysLeuAlaLysLeuGlyPheAsnGlnValGlnSerLeuHisLysLysGluLeuSerGlnLeuSerLysTrpTrpLysGlyTyrAspValThrAsnAsnPheProTyrAlaArgAsnArgLeuValGluCysTyrPheTrpAlaGlnGlyValTyrPheGluProLysTyrSerGlnSerArgIlePheLeuAlaLysAsnLeuAlaThrAlaSerIleLeuAspAspThrTyrAspAlaTyrGlyThrTyrGluGluLeuLysIlePheThrGluAlaIleGlnArgTrpSerIleThrCysLeuAspMetLeuProGluTyrMetLysProLeuTyrGlnMetValIleAspValTyrLysGluMetGluGluIleMetAlaAspGluGluLysAlaTyrTyrLeuAsnAsnAlaIleGluSerMetLysGluPheIleGlySerTyrMetThrGluAlaLysTrpGlyAsnGluGlyTyrIleProThrThrGluGluHisIleSerValAlaLeuIleSerSerGlyThrLysHisLeuValThrThrSerPheValGlyMetAsnAspMetIleThrGluGluSerPheLysTrpValSerThrAsnProProLeuIleLysAlaAlaAlaAlaValGlyArgPheValAspAspIleValSerHisLysGluGluGlnGluArgLysHisValAlaSerValValGluCysTyrMetGluGlnPheAspValThrGluAspHisValTyrAspLeuValAsnLysLysIleAspGlnAlaTrpLysGluIleValArgGluSerLeuMetCysLysAspValProMetAlaLeuIleMetArgAlaIleAsnPheAlaArgGlyMetGluValMetTyrLysGlyGlnAspAsnTyrThrHisMetGlyAspGluMetIleAsnHisIleLysSerLeuPheValAspSerIleSerThr

although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Sequence listing

<110> university of Anhui traditional Chinese medicine

<120> terpene synthase gene AlTPS1 for synthesizing elemene in Atractylodes lancea and encoded product and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1644

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgagcaccg tgcaagaaaa cgtggtgcgc gcgaccgcga gctttccgct ggatatttgg 60

ggcgatcagt ttctggtgtg cgatcagcaa gaagaacaag atgaagtgga acaagtggtg 120

gaggatctga aagaagaagt gcgcaaagaa attctggcgg cgctgaacgt gccggcggaa 180

cataccaatc tgctgaaact ggtggacgcg attcagcgcc tgggcattgc gtattatttt 240

gaagaggaaa ttaacgaagt gctgaaacat atttatgtga gcaacggcga taactggacc 300

ggcggttgcc cgagcctgtg gtttcgctta ctgcgtcagc aaggcttttt tgtgagttgc 360

gatattttta acaactataa agataaagat ggtagcttta aagagtgcct ggcgaacgat 420

gtgcaaggcc tgctggatct gtatgaagcg gcgtatatgc gcgtgcaagg cgaagatatc 480

ctggatgatg cgctggtgtt tacccgcacc cgcctggatg atattagcaa agatccactg 540

cgcggcacca acaccgatag cacgcagatt caagaagcgc tgaaacagcc actgctgaaa 600

cgcctgccgc gcctggaagc cctgcgctat attccgtttt atcagcaaca agcgagccat 660

aacaaatatc tgctgaaact ggccaaactg ggctttaacc aagtgcagag cctgcataaa 720

aaagaactga gtcagctgag caaatggtgg aaaggctatg atgtgaccaa caactttccg 780

tatgcgcgca accgcctggt tgagtgctat ttttgggcgc aaggcgtgta ttttgaaccg 840

aaatatagtc agagccgcat ttttctggcg aaaaacctgg cgaccgcgag tattctggat 900

gatacctatg atgcgtatgg cacctatgaa gaactgaaaa tttttaccga ggcgattcag 960

cgctggagca ttacgtgcct ggatatgtta ccggaatata tgaaaccgct gtatcagatg 1020

gtgattgatg tgtataaaga aatggaagaa attatggcgg atgaagaaaa agcgtattat 1080

ctgaacaacg cgattgaaag catgaaagaa tttattggta gctatatgac cgaagcgaaa 1140

tggggcaacg aaggctatat tccgaccacc gaagaacata ttagcgtggc gttaattagt 1200

agcggcacca aacatctggt gaccacgagc tttgtgggca tgaacgatat gattaccgaa 1260

gagagcttta aatgggtgag caccaacccg ccgctgatta aagcggccgc ggcggtgggc 1320

cgctttgtgg atgatattgt gagccataaa gaagaacaag aacgcaaaca tgtggcgagc 1380

gtggtggagt gctatatgga acagtttgat gtgaccgaag atcatgtgta tgatctggtg 1440

aacaaaaaaa tcgatcaagc gtggaaagaa attgtgcgcg aaagcctgat gtgcaaagat 1500

gtgccgatgg ccttaattat gcgcgcgatt aactttgcgc gcggcatgga agtgatgtat 1560

aaaggccaag ataactatac ccacatgggc gatgaaatga ttaaccatat taaaagcctg 1620

tttgtggata gcattagcac ctaa 1644

<210> 2

<211> 547

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Ser Thr Val Gln Glu Asn Val Val Arg Ala Thr Ala Ser Phe Pro

1 5 10 15

Leu Asp Ile Trp Gly Asp Gln Phe Leu Val Cys Asp Gln Gln Glu Glu

20 25 30

Gln Asp Glu Val Glu Gln Val Val Glu Asp Leu Lys Glu Glu Val Arg

35 40 45

Lys Glu Ile Leu Ala Ala Leu Asn Val Pro Ala Glu His Thr Asn Leu

50 55 60

Leu Lys Leu Val Asp Ala Ile Gln Arg Leu Gly Ile Ala Tyr Tyr Phe

65 70 75 80

Glu Glu Glu Ile Asn Glu Val Leu Lys His Ile Tyr Val Ser Asn Gly

85 90 95

Asp Asn Trp Thr Gly Gly Cys Pro Ser Leu Trp Phe Arg Leu Leu Arg

100 105 110

Gln Gln Gly Phe Phe Val Ser Cys Asp Ile Phe Asn Asn Tyr Lys Asp

115 120 125

Lys Asp Gly Ser Phe Lys Glu Cys Leu Ala Asn Asp Val Gln Gly Leu

130 135 140

Leu Asp Leu Tyr Glu Ala Ala Tyr Met Arg Val Gln Gly Glu Asp Ile

145 150 155 160

Leu Asp Asp Ala Leu Val Phe Thr Arg Thr Arg Leu Asp Asp Ile Ser

165 170 175

Lys Asp Pro Leu Arg Gly Thr Asn Thr Asp Ser Thr Gln Ile Gln Glu

180 185 190

Ala Leu Lys Gln Pro Leu Leu Lys Arg Leu Pro Arg Leu Glu Ala Leu

195 200 205

Arg Tyr Ile Pro Phe Tyr Gln Gln Gln Ala Ser His Asn Lys Tyr Leu

210 215 220

Leu Lys Leu Ala Lys Leu Gly Phe Asn Gln Val Gln Ser Leu His Lys

225 230 235 240

Lys Glu Leu Ser Gln Leu Ser Lys Trp Trp Lys Gly Tyr Asp Val Thr

245 250 255

Asn Asn Phe Pro Tyr Ala Arg Asn Arg Leu Val Glu Cys Tyr Phe Trp

260 265 270

Ala Gln Gly Val Tyr Phe Glu Pro Lys Tyr Ser Gln Ser Arg Ile Phe

275 280 285

Leu Ala Lys Asn Leu Ala Thr Ala Ser Ile Leu Asp Asp Thr Tyr Asp

290 295 300

Ala Tyr Gly Thr Tyr Glu Glu Leu Lys Ile Phe Thr Glu Ala Ile Gln

305 310 315 320

Arg Trp Ser Ile Thr Cys Leu Asp Met Leu Pro Glu Tyr Met Lys Pro

325 330 335

Leu Tyr Gln Met Val Ile Asp Val Tyr Lys Glu Met Glu Glu Ile Met

340 345 350

Ala Asp Glu Glu Lys Ala Tyr Tyr Leu Asn Asn Ala Ile Glu Ser Met

355 360 365

Lys Glu Phe Ile Gly Ser Tyr Met Thr Glu Ala Lys Trp Gly Asn Glu

370 375 380

Gly Tyr Ile Pro Thr Thr Glu Glu His Ile Ser Val Ala Leu Ile Ser

385 390 395 400

Ser Gly Thr Lys His Leu Val Thr Thr Ser Phe Val Gly Met Asn Asp

405 410 415

Met Ile Thr Glu Glu Ser Phe Lys Trp Val Ser Thr Asn Pro Pro Leu

420 425 430

Ile Lys Ala Ala Ala Ala Val Gly Arg Phe Val Asp Asp Ile Val Ser

435 440 445

His Lys Glu Glu Gln Glu Arg Lys His Val Ala Ser Val Val Glu Cys

450 455 460

Tyr Met Glu Gln Phe Asp Val Thr Glu Asp His Val Tyr Asp Leu Val

465 470 475 480

Asn Lys Lys Ile Asp Gln Ala Trp Lys Glu Ile Val Arg Glu Ser Leu

485 490 495

Met Cys Lys Asp Val Pro Met Ala Leu Ile Met Arg Ala Ile Asn Phe

500 505 510

Ala Arg Gly Met Glu Val Met Tyr Lys Gly Gln Asp Asn Tyr Thr His

515 520 525

Met Gly Asp Glu Met Ile Asn His Ile Lys Ser Leu Phe Val Asp Ser

530 535 540

Ile Ser Thr

545

<210> 3

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

aggccatggc tgatatcgga atgagcaccg tgcaagaaaa cgtgg 45

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

cgacggagct cgaattcgga ttaggtgcta atgctatcca caaac 45

Claims

1.A terpene synthase gene AlTPS1 for synthesizing elemene from rhizoma atractylodis lanceae is characterized by having a nucleotide sequence shown as SEQ ID No. 1.

2. A product encoded by the terpene synthase gene alpps 1 according to claim 1, characterized in that said product has an amino acid sequence as shown in SEQ ID No. 2.

3. The product of claim 2, wherein the product is one of a polypeptide or a protein.

4. A recombinant expression vector comprising the terpene synthase gene alpps 1 according to claim 1.

5. The recombinant expression vector of the terpene synthase gene AlTPS1 according to claim 4,

the recombinant expression vector is obtained by taking a pET-21a expression vector as a starting vector and inserting the terpene synthase gene AlTPS1 between BamHI enzyme cutting sites of the pET-21a expression vector.

6. The recombinant expression vector of the terpene synthase gene AlTPS1 according to claim 5,

the recombinant expression vector is constructed according to the following steps:

7. A recombinant engineering bacterium comprising the terpene synthase gene alpps 1 according to claim 1.

8. E.coli Transetta (DE 3) cells containing the terpene synthase gene AlTPS1 according to claim 1.

9. The use of the terpene synthase gene AlTPS1 according to claim 1, for the production of the terpene compound elemene.

10. Use of a recombinant expression vector according to any one of claims 4-6 for the production of the terpenoid elemene.

11. Use of a host cell comprising the terpene synthase gene AlTPS1 according to claim 8 for promoting the synthesis of the terpene compound elemene.