CN102286517B - Utilize the method for Gene expression intensities on artificial regulatory element and library regulating and controlling microbial chromosome thereof - Google Patents

Abstract

The invention discloses and utilize the method for Gene expression intensities on artificial regulatory element and library regulating and controlling microbial chromosome thereof.Provided by the present invention the method for Gene expression intensities on artificial regulatory element and library regulating and controlling microbial chromosome thereof is utilized to comprise the following steps: to amplify section of DNA fragment by the method for PCR, it includes treating one section of the controlling gene original regulation and control region upstream sequence homology fragment containing 40 3000 bases on microbial chromosomal, resistant maker gene, artificial regulatory element library or an artificial regulatory element with particular expression intensity, with the one section of fragment containing 40 3000 bases treating controlling gene start codon downstream sequence homology on microbial chromosomal；This DNA fragmentation electricity is transformed in microbial body, the original regulation and control region that microbial chromosomal is treated controlling gene is replaced with artificial regulatory element library or an artificial regulatory element with particular expression intensity.

Description

Utilize gene expression on artificial regulatory element and library regulating and controlling microbial chromosome thereof strong The method of degree

Technical field

The present invention relates to the use of the side of Gene expression intensities on artificial regulatory element and library regulating and controlling microbial chromosome thereof Method.

Background technology

Gene expression regulation technology is one of core technology of metabolic engineering.Target product is improved at present in transformation microorganism During synthesis capability, conventional a kind of strategy is that the expression of gene is regulated and controled by the method by plasmid process LAN, improves certain Or the activity of certain several key enzyme, thus strengthen the metabolic flux of Microbe synthesis target product.During plasmid process LAN, generally make Be all inducible promoter (such as promoteres such as lac, trc, ara) expression that carrys out controlling gene.But, this method has three Big drawback.First, owing to needing to add the expensive derivant such as lactose, IPTG, arabinose to induce the table of these promoteres Reach, use these inducible promoters to be not economically feasible when producing bulk chemical.Second, table based on plasmid Reach and have a lot of drawback: host cell can be caused the biggest metabolic burden, the plasmid of the highest copy by the maintenance of plasmid；A lot The hereditary stability of plasmid is bad；The only duplication of low-copy-number plasmid and the breeding of cell synchronizes to carry out, the most only Them are had to keep consistent copy number in all of cell；The synthesis of a lot of compounds needs to construct one in cell again Miscellaneous metabolic pathway, it is therefore desirable to introduce and comprise the length dna fragment of multiple gene, and major part plasmid all compares and difficult carries length DNA fragmentation.3rd, in order to make the metabolic fluxes of Microbe synthesis target product reach maximum, it is necessary to accurately control in route of synthesis The expression intensity of each gene, makes them reach the state of coordinate expression.Its intensity of now widely used inducible promoter It is all fixing, it is impossible to meet the demand of accuracy controlling Gene expression intensities.Therefore, necessary acquisition is a series of has difference The controlling element of expression intensity, can carry out accuracy controlling to the expression of gene.

Had the artificial regulatory element of different expression intensity by use, the expression to gene is carried out the most on chromosome Accuracy controlling, can solve the problem that above-mentioned plasmid process LAN is brought well.Prokaryote is mainly at transcriptional level pair Gene expression is controlled, and therefore promoter is topmost controlling element.In the last few years, scientists developed multiple structure The technology in constitutive promoter library gene expression is regulated and controled (Jenson, 1998, WO 98/07846；Peter wears Shandong Er Jiansen, 1999, CN 1233287A；Alper et al., 2005, PNAS, 102:12678-12683；Hartner et Al., 2008, Nucleic Acids Res, 36:e76；Rud et al., 2006, Microbiology, 152:1011-1019； Meynial-Salles et al., 2005, Appl EnvironMicrobiol, 71:2140-2144).A kind of technology is to pass through The intervening sequence in transformation promoter-10 and-35 regions control promoter power (Jenson, 1998, WO 98/07846；That The letter of get Lu Dell is gloomy, 1999, CN 1233287A)；Another kind of technology is by using fallibility PCR (error-prone PCR) technology causes random mutation (Alper et al., 2005, PNAS, 102:12678-in original promoter sequence 12683).Both technology are all obtained in that one group of promoter library that Gene expression intensities is widely different, these promoteres with After can be transferred on chromosome from plasmid, thus realize regulation and control to gene expression on chromosome.Another kind of structure starts The method of sublibrary is to utilize the chromosomal dna fragment of random cutting.Ingram research group utilizes zymomonas mobilis to contaminate The Sau3AI endonuclease bamhi of colour solid DNA constructs promoter library, can express Irving very well for screening in klebsiella The promoter of Salmonella endoglucanase, thus improve cell factory and convert cellulose into ability (the Zhou et of ethanol Al., 2001, Appl Environ Microbiol, 67:6-14).

The expression intensity of gene, except being regulated and controled by promoter, is also activated sub-upstream sequence, messenger RNA stable region Sequence and the impact of ribosome binding site sequence.Currently, with respect to building promoter upstream, messenger RNA stable region and ribose The report of body binding site controlling element is the most fewer.

Summary of the invention

It is an object of the present invention to provide one and utilize gene on the regulating and controlling microbial chromosome of artificial regulatory element library The method of expression intensity.

Provided by the present invention utilize the side of Gene expression intensities on the regulating and controlling microbial chromosome of artificial regulatory element library Method, comprises the following steps:

The original regulation and control region treating controlling gene on microbial chromosomal is replaced with artificial regulatory element library.

Treat on described microbial chromosomal that controlling gene is the endogenous gene on microbial chromosomal and is incorporated into microorganism Exogenous gene on chromosome.

Described artificial regulatory element library is the messenger RNA between promoter library, promoter and ribosome binding site One or more in library, stable region, ribosome binding site library, promoter upstream library.

Described promoter library is one section of DNA sequence containing randomized bases, and it includes one containing 6 particular bases or 6 Promoter-35 nucleus of individual randomized bases, one containing 6 particular bases or promoter-10 core space of 6 randomized bases Territory, one between-35 and-10 nucleuses containing 10-20 particular bases or the zone line of 10-20 randomized bases, One containing the promoter upstream of particular bases, one containing the messenger RNA stable region of particular bases, the core containing particular bases Sugar body binding site.

Library, described messenger RNA stable region is one section of DNA sequence containing randomized bases, and it includes one containing particular bases Promoter upstream, one containing the promoter of particular bases, one between promoter and ribosome binding site containing 5- The messenger RNA stable region of 50 randomized bases, a ribosome binding site containing particular bases.

Described ribosome binding site library is one section of DNA sequence containing randomized bases, and it includes one containing specific alkali The promoter upstream of base, one containing the promoter of particular bases, one containing the messenger RNA stable region of particular bases, one contain The ribosome binding site of 6-20 randomized bases.

Described promoter upstream library is one section of DNA sequence containing randomized bases, and it includes one in promoter-35 The region containing 5-1000 randomized bases of nucleus upstream, one containing the promoter of particular bases, one containing particular bases Messenger RNA stable region, a ribosome binding site containing particular bases.

The sequence of described promoter library is the sequence 1 in sequence table and sequence 2.

The sequence in library, described messenger RNA stable region is the sequence 9 in sequence table.

The sequence in described ribosome binding site library is the sequence 18 in sequence table.

The sequence in described promoter upstream library is the sequence 17 in sequence table.

Described the original regulation and control region treating controlling gene on microbial chromosomal is replaced with artificial regulatory element library, also Comprise the following steps:

Amplifying section of DNA fragment by the method for PCR, it includes treating the original tune of controlling gene on microbial chromosomal Control one section of region upstream sequence homology is containing the fragment (as left homology arm) of 40-3000 base, resistant maker gene, manually One section of controlling gene start codon downstream sequence homology is treated containing 40-3000 on controlling element library and microbial chromosomal The fragment (as right homology arm) of individual base.The method using homologous recombination, will treat the former of controlling gene on microbial chromosomal Begin to regulate and control region and replace with resistant maker gene and artificial regulatory element library.

Described resistant maker gene be ampicillin resistance gene, card receive mycin resistant gene, chloramphenicol resistance gene, One or more in tetracycline resistance gene, apramycin resistance gene.

Described microorganism is colon bacillus (Escherichia coli).

Beta-galactosidase gene (lacZ), 1-that controlling gene is colon bacillus is treated on described microbial chromosomal Deoxidation-xylulose 5-phosphate synthase gene (dxs).

It is a further object to provide the construction method of a kind of artificial regulatory element.

The construction method of artificial regulatory element provided by the present invention comprises the following steps:

The original regulation and control region of marker gene on microbial chromosomal is replaced with artificial regulatory element library, it is thus achieved that one is Row have the artificial regulatory element of different regulation and control intensity.By measuring the activity of this marker gene encoding proteins, determine each individual The intensity of work controlling element.

On described microbial chromosomal, marker gene is the endogenous gene on microbial chromosomal and is incorporated into microorganism dye Exogenous gene on colour solid.

Described microorganism is colon bacillus (Escherichia coli).

On described microbial chromosomal, marker gene is the beta-galactosidase gene (lacZ) of colon bacillus.

A further object of the present invention is to provide a kind of utilization and has the artificial regulatory element regulating and controlling microbial of certain strength The method of Gene expression intensities on chromosome.

The utilization that the present invention provides has gene expression on the artificial regulatory element regulating and controlling microbial chromosome of certain strength The method of intensity, comprises the following steps:

The original regulation and control region treating controlling gene on microbial chromosomal is replaced with artificial regulatory element.

Treat on described microbial chromosomal that controlling gene is the endogenous gene on microbial chromosomal and is incorporated into microorganism Exogenous gene on chromosome.

Described artificial regulatory element is one section of DNA sequence containing particular bases, and it has specific expression intensity, including Promoter upstream, promoter, messenger RNA stable region and ribosome binding site.

The sequence of described artificial regulatory element is the sequence 3 in sequence table, sequence 4, sequence 5, sequence 6, sequence 7, sequence 8, sequence 10, sequence 11, sequence 12, sequence 13, sequence 14, sequence 15, sequence 16, sequence 19.

Described being replaced with in the original regulation and control region treating controlling gene on microbial chromosomal has particular expression intensity Artificial regulatory element, comprises the following steps:

Amplifying section of DNA fragment by the method for PCR, it includes treating the original tune of controlling gene on microbial chromosomal Control one section of region upstream sequence homology containing the fragment (as left homology arm) of 40-3000 base, resistant maker gene, one Have on the artificial regulatory element of particular expression intensity and microbial chromosomal treat controlling gene start codon downstream sequence with One section of the source fragment (as right homology arm) containing 40-3000 base.The method using a step homologous recombination, contaminates microorganism Treat on colour solid that the original regulation and control region of controlling gene replaces with resistant maker gene and has the artificial regulatory of particular expression intensity Element.

Described resistant maker gene be ampicillin resistance gene, card receive mycin resistant gene, chloramphenicol resistance gene, One or more in tetracycline resistance gene, apramycin resistance gene.

Described being replaced with in the original regulation and control region treating controlling gene on microbial chromosomal has particular expression intensity Artificial regulatory element, further comprising the steps of:

The method using two step homologous recombination, replaces with the original regulation and control region treating controlling gene on microbial chromosomal There is the artificial regulatory element of particular expression intensity.The method first passing through PCR amplifies first paragraph DNA fragmentation, it include with One section of fragment containing 40-3000 base of controlling gene original regulation and control region upstream sequence homology is treated on microbial chromosomal (as left homology arm), resistant maker gene, levan sucrose transferase gene treat that controlling gene rises on microbial chromosomal One section of the beginning codon downstream sequence homology fragment (as right homology arm) containing 40-3000 base.Carry out first step homology Restructuring, replaces with resistant maker gene by the original regulation and control region treating controlling gene on microbial chromosomal and levan sucrose turns Move enzyme gene.Amplifying second segment DNA fragmentation by the method for PCR, it includes treating that controlling gene is former on microbial chromosomal One section of the regulation and control region upstream sequence homology that begins containing the fragment (as left homology arm) of 40-3000 base, one have specific Treat controlling gene start codon downstream sequence homology on the artificial regulatory element of expression intensity and microbial chromosomal one section Fragment (as right homology arm) containing 40-3000 base.Carry out second step homologous recombination, by resistant maker gene and levan Sucrose transferase gene replaces with the artificial regulatory element with particular expression intensity.

Described resistant maker gene be ampicillin resistance gene, card receive mycin resistant gene, chloramphenicol resistance gene, One or more in tetracycline resistance gene, apramycin resistance gene.

Described microorganism is colon bacillus (Escherichia coli).

1-deoxidation-xylulose 5-phosphate synzyme that controlling gene is colon bacillus is treated on described microbial chromosomal Gene (dxs), 1-deoxidation-xylulose 5-phosphate reduction isomerase gene (dxr), 4-cytidine diphosphate (CDP) 2-C-methyl D erythrose Alcohol synthase gene (ispD), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol kinase gene (ispE), (E)-4-hydroxyl-3- Methyl-2-butene base-pyrophosphate synthetase gene (ispG), (E)-4-hydroxy-3-methyl-crotyl-pyrophosphoric acid reductase Gene (ispH), isovaleryl pyrophosphoric acid isomerase gene (idi), method Buddhist nun's diphosphate synthase gene (ispA)；Pantoea agglomerans Yak base yak base diphosphonic acid (GGPP) synthase gene (crtE) of (Pantoea agglomerans), beta-carotene Cyclase gene (crtX), lycopene beta cyclase gene (crtY), phytoene desaturase gene (crtI), eight Hydrogen lycopene synthase gene (crtB).

Accompanying drawing explanation

Fig. 1 is the schematic diagram that colon bacillus promoter library 1 (P-Lib1) builds.

Fig. 2 is that the enzyme of the beta galactosidase of 40 recons in colon bacillus promoter library 1 (P-Lib1) is lived. Shown enzyme work is and colon bacillus ATCC 8739 relative value that beta galactosidase enzyme is lived after IPTG induces.

Fig. 3 is the schematic diagram that colon bacillus promoter library 2 (P-Lib2) builds.

Fig. 4 is the enzyme of the beta galactosidase of 157 recons in colon bacillus promoter library 2 (P-Lib2) Live.Shown enzyme work is and colon bacillus ATCC 8739 relative value that beta galactosidase enzyme is lived after IPTG induces.

Fig. 5 is the schematic diagram that library, colon bacillus messenger RNA stable region 1 (M-Lib1) builds.

Fig. 6 is the beta galactose glycosides of 175 recons in library, colon bacillus messenger RNA stable region 1 (M-Lib1) The enzyme of enzyme is lived.Shown enzyme is lived and colon bacillus ATCC 8739 beta galactosidase enzyme after IPTG induces is lived Relative value.

Fig. 7 is the schematic diagram that colon bacillus promoter upstream library 1 (U-Lib1) builds.

Fig. 8 is the beta galactosidase of 100 recons in colon bacillus promoter upstream library 1 (U-Lib1) Enzyme live.Shown enzyme work is and colon bacillus ATCC 8739 phase that beta galactosidase enzyme is lived after IPTG induces To value.

Fig. 9 is the schematic diagram that colon bacillus ribosome binding site library 1 (R-Lib1) builds.

Figure 10 is the beta galactose of 134 recons in colon bacillus ribosome binding site library 1 (R-Lib1) The enzyme of glycosides enzyme is lived.Shown enzyme work is to live with colon bacillus ATCC 8739 beta galactosidase enzyme after IPTG induces Relative value.

Figure 11 is 7 recons in library, messenger RNA stable region 1 (M-Lib1) and colon bacillus ATCC 8739 After IPTG induces, the enzyme of the beta galactosidase under different condition of culture is lived.Shown enzyme work is and colon bacillus ATCC 8739 relative value that beta galactosidase enzyme is lived after IPTG induces.

Figure 12 is to use artificial regulatory element and a step homologous recombination method to the gene table on colon bacillus chromosome Reach the schematic diagram carrying out regulating and controlling.

Figure 13 is the schematic diagram of pTrc99A-M plasmid construction.

Figure 14 is the schematic diagram of pACYC184-M plasmid construction.

Figure 15 is the schematic diagram of pTrc99A-M-crt plasmid construction.

Figure 16 is the schematic diagram of pACYC184-M-crt plasmid construction.

Figure 17 is for using artificial regulatory element M1-12, M1-64, M1-30, M1-46, M1-37, M1-93 to E The dxs of bacterium MG1655, after the expression of dxr, ispD, ispE, ispG, ispH, idi, ispA gene regulates and controls, beta-carotene The change of yield.Shown beta-carotene yield is and colon bacillus MG1655 beta-carotene relative value of outcome.

Figure 18 is to use artificial regulatory element and two step homologous recombination methods to the gene table on colon bacillus chromosome Reach the schematic diagram carrying out regulating and controlling.A is first step homologous recombination, and B is second step homologous recombination.

Figure 19 is the schematic diagram of pXZ001, pXZ002, pXZ003-crt plasmid construction.

Figure 20 is to use artificial regulatory element M1-64, M1-46, M1-37, M1-93 crt to colon bacillus QL002 After gene expression regulates and controls, the change of beta-carotene yield.Beta-carotene yield is the relative value with QL002.

Figure 21 is to use artificial regulatory element library to enter the dxs gene expression of colon bacillus crt-M1-93-FRT The schematic diagram of row regulation and control.

Figure 22 is to use artificial regulatory element library to enter the dxs gene expression of colon bacillus crt-M1-93-FRT After row regulation and control, the change of the beta-carotene yield of 17 recons of random choose.Beta-carotene yield is and crt-M1- The relative value of 93-FRT.

Detailed description of the invention

Experimental technique used in following embodiment if no special instructions, is conventional method.

Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.

Embodiment 1, the structure of colon bacillus promoter library 1 (P-Lib1)

The strategy that colon bacillus promoter library 1 (P-Lib1) builds is by large intestine by Red homologous recombination technique (public can obtain Escherichia ATCC 8739 from Tianjin Institute of Industrial Biotechnology, recorded colon bacillus ATCC The non-patent literature of 8739 is Zhang, X., K.T.Shanmugam, L.O.Ingram.2010.Fermentation of glycerol tosuccinate by metabolically engineered strains of Escherichia Coli.Appl Environ Microbiol, 76:2397-2401) the opening of beta galactosidase (lacZ) gene on chromosome Mover replaces with and manually starts sublibrary 1 (P-Lib1) (Fig. 1), then the enzyme of beta galactosidase is alive determines each by measuring The intensity of promoter.

PL promoter sequence based on phageλ (Love et al., 1996, Gene, 176:49-53) devises startup Sublibrary 1 (P-Lib1), sequence is sequence 1 in sequence table.It is characterized by: be 17 between promoter-35 and-10 nucleus Randomized bases；-35 15, upstream, district bases are identical with PL promoter sequence with 6 ,-10 downstream, district base.

The DNA fragmentation II for homologous recombination is obtained by two-step PCR amplification.With pKD4 plasmid, (public can be from Tianjin Industrial biotechnology institute obtains, and the non-patent literature recording pKD4 plasmid is Datsenko, K.A., and B.L.Wanner.2000.One-step inactivation of chromosomal genes in Escherichia Coli K-12 using PCR products.Proc Natl Acad Sci USA, 97:6640-6645.) DNA be mould Plate, uses primer lacI-FRT and PL1-FRT to amplify DNA fragmentation I.Primer sequence is:

LacI-FRT:GCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTG AATGTGTAGGCTG GAGCTGCTTC,

PL1-FRT:TCCTGCTGATGTGCTCAGTATC (N 17) TGTCAACACCGCCAGAGATAACATATGAATATC CTC。

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer10ul, dNTP (10mM each DNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ Ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of changes Property 10 seconds, 59 DEG C anneal 10 seconds, 72 DEG C extend 1 minute 30 seconds (30 circulations)；72 DEG C extend 5 minutes (1 circulation).

Then with DNA fragmentation I as template, primer lacI-FRT and lacZ-R is used to amplify DNA fragmentation II.Primer sequence For:

LacZ-R:ACGACGGCCAGTGAATCCGTAATCATGGTCATAGCTGTTTCCTGTGTGA AGGTCAGTGCGTC CTGCTGATGTGCT。

DNA fragmentation II includes 50 bases (up50) of lacI upstream region of gene, FRT-Km-FRT fragment, P-Lib1, PL Messenger RNA stable region (message-RNA stabilizing, m-L), the ribosome binding site (RBS) of lacZ gene, lacZ 32 bases after gene start codon (lacZ ') (Fig. 1).

By Red homologous recombination technique by the beta galactosidase on colon bacillus ATCC 8739 chromosome (lacZ) promoter of gene replaces with P-Lib1.Wherein, (50, upstream base, relative to rising for the upstream region of lacI gene The region of-the 50-0 of beginning codon) in homologous recombination, it is used as left homology arm；The ribosome binding site of lacZ gene and part LacZ gene (RBS::lacZ ', relative to the region of-18-+32 of start codon) in homologous recombination, it is used as right homology arm (Fig. 1).First by pKD46 plasmid, (public can obtain from Tianjin Institute of Industrial Biotechnology, recorded the non-of pKD46 plasmid Patent documentation is Datsenko, K.A., and B.L.Wanner.2000.One-step inactivation of chromosomal genes inEscherichia coli K-12 using PCR products.Proc Natl Acad Sci USA, 97:6640-6645) converted to colon bacillus ATCC 8739 by calcium chloride transformation.Then by DNA sheet Section II electricity goes to colon bacillus ATCC 8739 with pKD46.Electricity turns condition: first prepare with pKD46 plasmid The Electroporation-competent cells of colon bacillus ATCC 8739；50ul competent cell is placed on ice, adds 200ng DNA fragmentation II, places 2 minutes on ice, is transferred to the Bio-Rad electric shock cup of 0.2cm.(Bio-Rad is public to use MicroPulser Department) electroporation apparatus, shock parameters is voltage 2.5kv.Rapidly by 1ml LB media transfer to electric shock cup after electric shock, blow and beat 5 It is transferred to after secondary in test tube, 200 turns, hatches 2 hours for 37 DEG C.Take 200ul bacterium solution be coated in respectively the LB containing 5 kanamycin put down On plate, 39 DEG C of incubated overnight, remove pKD46 plasmid.1000ul bacterium solution has obtained altogether 250 clones, and recombination efficiency is 1250 Recon/ug DNA.

Randomly select 40 recombinant bacterial strains (P1-1 to P1-40), cultivated 4 hours in LB culture medium, carry out β-gala The enzyme activity determination of glycosidase.It addition, add (0.1mM) respectively and without IPTG, LB culture medium is cultivated E Bacterium ATCC 8739, the enzyme measuring beta galactosidase is lived.The single bacterium specifically comprised the following steps that on (1) picking flat board of enzyme activity determination Fall incubated overnight, is seeded in the test tube containing 3ml LB culture medium in the ratio of 1/100, cultivates about 4h for 37 DEG C, 220 turns, OD600 is about about 2.0, and control strain colon bacillus ATCC 8739 adds IPTG (eventually when cultivating to OD600 about 0.3 Concentration is 0.1mM).(2) taking the bacterium solution of 1ml, 12000rpm is centrifuged 1min, with the resuspended thalline of the Z-buffer of 1ml, is carried out After, 12000rpm is centrifuged one minute, abandons supernatant.And thalline is resuspended in Z-buffer.(3) spectrophotometer is used, Under the light absorption value of 420nm, adjust the OD420 to 1.0 of thalline.(4) take the bacterium solution that 1ml OD420 is 1.0, add 2 chloroforms and 1 Drip SDS (0.1%), vibrate 10 seconds in vortex oscillator.(5) take cell bacterium solution 100ul after above-mentioned crushing, add 900ul Z-buffer, be placed in the water-bath of 28 DEG C preheat 2min, comparison is set simultaneously.(6) above-mentioned system will add 200ul's ONPG (O-nitrophenyl-beta-D-galactopyranoside), mixing is placed in water-bath, starts timing, until anti- Answer the yellow that in system, appearance can detect, add 500ul sodium carbonate (1M) and terminate reaction and stop timing.(7) will reaction System removal water-bath, after every individual system adds the pure water of 1.3ml, centrifugal by thalline removing, o-in mensuration system at 420nm The light absorption value of nitrophenol.(8) enzyme design conditions alive: as light absorption value OD420=1, be equivalent to contain in every milliliter of bacterium solution 5x10⁸Individual cell；10⁹Individual cell contains the albumen of 150ug；At 420nm, the suction that 1nmol/ml o-nitrophenol has Light value is 0.0045.Enzyme computing formula: OD420X3ml/ (0.0045X75ugX0.001XT) alive, T is the response time.

When inducing without IPTG, the beta galactosidase enzyme of colon bacillus ATCC 8739 is lived as 0.02U/mg albumen. Colon bacillus ATCC 8739 beta galactosidase enzyme after induction is lived as 1.9U/mg albumen.In P-Lib1 library with It is the 0.05-0.7 after colon bacillus ATCC 8739 is induced that the beta galactosidase enzyme of 40 recombinant bacterial strains that machine is selected is lived Again (Fig. 2).

Embodiment 2, the structure of colon bacillus promoter library 2 (P-Lib2)

In order to improve the efficiency of homologous recombination, expand the storage capacity of promoter library, construct the startup of colon bacillus Sublibrary 2 (P-Lib2).When building P-Lib2, the length of left homology arm is extended to 500 base (lacI by 50 bases 500 bases of upstream, relative to the region of-500-0 of lacI start codon) (Fig. 3).

The sequence of P-Lib2 is sequence 2 in sequence table.It is characterized in that: promoter-35 core space and 15 of-35 upstreams, district Base is identical with P-Lib1；-10 core space sequences change into TATAAT；Between promoter-35 and-10 core space be 14 random Base and TGR.-10 core space downstream sequences change into 6 randomized bases.

The DNA fragmentation IV (Fig. 3) for homologous recombination is obtained by two-step PCR amplification.First, with the weight in P-Lib1 The genomic DNA of group bacterial strain P1-1 is template, uses primer lacI-up500 and pL-down-35 to amplify DNA fragmentation III.Draw Thing sequence is:

LacI-up500:CGGGCGACGTTTGCCGCTTCTGAAAACC,

PL-down-35:TGTCAACACCGCCAGAGA.

Then, with DNA fragmentation III as template, use primer lacI-up500 and lacZ-PL-R2 to amplify DNA fragmentation IV.Primer sequence is:

LacZ-pL-R2:AATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCA CAATT (N6) ATTATAYCA(N14)TGTCAACACCGCCAGAGA。

DNA fragmentation IV include 500 bases (up500) of lacI upstream region of gene, FRT-Km-FRT fragment, P-Lib2, 12 bases after the messenger RNA stable region (mRS) of lacZ gene, ribosome binding site (RBS) and start codon (lacZ ') (Fig. 3).

By Red homologous recombination technique by the beta galactosidase on colon bacillus ATCC 8739 chromosome (lacZ) promoter of gene replaces with P-Lib2.Wherein, the upstream region of lacI gene (500, upstream base, relative to The region of-the 500-0 of lacI start codon) in homologous recombination, it is used as left homology arm；The messenger RNA of lacZ gene is stable District, ribosome binding site and part lacZ gene (mRS::RBS::lacZ ', relative to the district of-38-+12 of start codon Territory) in homologous recombination, it is used as right homology arm (Fig. 3).First pKD46 plasmid is converted to large intestine angstrom by calcium chloride transformation Uncommon Salmonella ATCC 8739.Then DNA fragmentation IV electricity is gone to colon bacillus ATCC 8739 with pKD46.Electricity turns bar Part is: first prepare the Electroporation-competent cells of colon bacillus ATCC 8739 with pKD46 plasmid；50ul is felt It is placed on ice by state cell, adds 50ngDNA fragment IV, place 2 minutes on ice, be transferred to the Bio-Rad electric shock cup of 0.2cm. Using MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.Rapidly 1mlLB is trained after electric shock Support in group-transfer extremely electric shock cup, be transferred in test tube after blowing and beating 5 times, 200 turns, hatch 2 hours for 37 DEG C.Take 100ul bacterium solution respectively It is coated on the LB flat board containing 10 kanamycin, 39 DEG C of incubated overnight, removes pKD46 plasmid.1000ul bacterium solution obtains altogether 2500 clones, recombination efficiency is 12500 recons/ug DNA.

Randomly select 157 recombinant bacterial strains (P2-1 to P2-157), cultivated 4 hours in LB culture medium, carry out β-half The enzyme activity determination of lactoside enzyme.It addition, measure colon bacillus ATCC 8739 beta galactosidase enzyme after IPTG induces Live.In P-Lib2 library, the beta galactosidase enzyme of 157 recombinant bacterial strains of random choose is lived and is evenly distributed, for E 0.2-3.3 times (Fig. 4) after bacterium ATCC 8739 induction.Wherein, the activity of 64% recombinant bacterial strain is higher than colon bacillus Activity after ATCC 8739 induction.

The promoter region of recombinant bacterial strain P2-53, P2-49, P2-33, P2-39, P2-30, P2-15 is checked order, surveys Sequence primer is lacI-up500 and lacZ-373.Primer sequence is:

LacZ-373:AGTAACAACTCGTCGGATTCT.

The beta galactosidase enzyme of recombinant bacterial strain P2-53, P2-49, P2-33, P2-39, P2-30, P2-15 is lived and is respectively greatly After intestinal Escherichia ATCC 8739 induction 0.4,0.5,2.0,2.0,2.1,3.3 times.The artificial regulatory of recombinant bacterial strain P2-53 Element sequences is sequence 3 in sequence table；The artificial regulatory element sequences of recombinant bacterial strain P2-49 is sequence 4 in sequence table；Recombinant bacterium The artificial regulatory element sequences of strain P2-33 is sequence 5 in sequence table；The artificial regulatory element sequences of recombinant bacterial strain P2-39 is sequence Sequence 6 in list；The artificial regulatory element sequences of recombinant bacterial strain P2-20 is sequence 7 in sequence table；The people of recombinant bacterial strain P2-15 Work controlling element sequence is sequence 8 in sequence table.

Embodiment 3, the structure in library, colon bacillus messenger RNA stable region 1 (M-Lib1)

In order to improve the stability of messenger RNA after genetic transcription, construct between promoter and ribosome binding site Library, messenger RNA stable region (M-Lib1).

The sequence of M-Lib1 is sequence 9 in sequence table, it is characterized in that: the highest the opening of intensity in promoter sequence and P-Lib2 Mover P2-15 sequence is the same；The sequence of messenger RNA stable region is 18 randomized bases and PmeI restriction enzyme site sequence.

The DNA fragmentation VI (Fig. 5) for homologous recombination is obtained by two-step PCR amplification.First, with recombinant bacterial strain P2- The genomic DNA of 15 is template, uses primer lacI-up500 and pL-down-3 to amplify DNA fragmentation V.Primer sequence is:

PL-down-3:GGCTCAATTATATCAACG.

Then, with DNA fragmentation V as template, use primer lacI-up500 and lacZ-pL-R3C to amplify DNA fragmentation VI. Primer sequence is:

LacZ-pL-R3C:TGTAAAACGACGGCCAGTGAATCCGTAATCATGGTCATAGCTGT TTCCTGGTTTAAA C(N18)GGCTCAATTATATCAACG。

DNA fragmentation VI includes 500 bases (up500), FRT-Km-FRT fragment, P2-15, M-of lacI upstream region of gene 38 bases after Lib1, the ribosome binding site (RBS) of lacZ gene and start codon (lacZ ') (Fig. 5).

By Red homologous recombination technique by the beta galactosidase on colon bacillus ATCC 8739 chromosome (lacZ) promoter and the messenger RNA stable region of gene replaces with P2-15 and M-Lib1.Wherein, the upstream region of lacI gene (500, upstream base, relative to the region of-500-0 of start codon) is used as left homology arm in homologous recombination；LacZ base The ribosome binding site of cause and part lacZ gene (RBS::lacZ ', relative to the region of-12-+38 of start codon) Right homology arm (Fig. 5) it is used as in homologous recombination.First pKD46 plasmid is converted to E by calcium chloride transformation Bacterium ATCC 8739.Then DNA fragmentation VI electricity is gone to colon bacillus ATCC 8739 with pKD46.Electricity turns condition: First the Electroporation-competent cells of colon bacillus ATCC 8739 with pKD46 plasmid is prepared；By thin for 50ul competence Born of the same parents are placed on ice, add 50ngDNA fragment VI, place 2 minutes on ice, are transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.Rapidly by 1mlLB culture medium after electric shock It is transferred to shock by electricity in cup, is transferred in test tube after blowing and beating 5 times, 200 turns, hatches 2 hours for 37 DEG C.Take 100ul bacterium solution to be coated in respectively On LB flat board containing 10 kanamycin, 39 DEG C of incubated overnight, remove pKD46 plasmid.1000ul bacterium solution obtains altogether 4000 clones, recombination efficiency is 20000 recons/ug DNA.

Randomly select 175 recombinant bacterial strains (M1-1 to M1-175), cultivated 4 hours in LB culture medium, carry out β-half The enzyme activity determination of lactoside enzyme.It addition, measure colon bacillus ATCC 8739 beta galactosidase enzyme after IPTG induces Live.In M-Lib1 library, the beta galactosidase enzyme of 175 recombinant bacterial strains of random choose is lived and is evenly distributed, for E 0.03-7 times (Fig. 6) after bacterium ATCC 8739 induction.

The artificial regulatory element of recombinant bacterial strain M1-12, M1-64, M1-30, M1-46, M1-37, M1-162, M1-93 is entered Row order-checking, sequencing primer is lacI-up500 and lacZ-373.

The beta galactosidase enzyme of recombinant bacterial strain M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, M1-162 is lived It is respectively 0.1,0.4,0.8,1.7,2.5,5,4.9 times after colon bacillus ATCC 8739 induction.Recombinant bacterial strain M1-12 Artificial regulatory element sequences be sequence 10 in sequence table；The artificial regulatory element sequences of recombinant bacterial strain M1-64 is in sequence table Sequence 11；The artificial regulatory element sequences of recombinant bacterial strain M1-30 is sequence 12 in sequence table；The artificial tune of recombinant bacterial strain M1-46 Control element sequences is sequence 13 in sequence table；The artificial regulatory element sequences of recombinant bacterial strain M1-37 is sequence 14 in sequence table；Weight The artificial regulatory element sequences of group bacterial strain M1-93 is sequence 15 in sequence table；The artificial regulatory element sequence of recombinant bacterial strain M1-162 It is classified as sequence 16 in sequence table.

Embodiment 4, the structure of colon bacillus promoter upstream library 1 (U-Lib1)

In order to improve Gene expression intensities further, construct promoter upstream library (U-in the upstream of promoter Lib1).The sequence of U-Lib1 is sequence 17 in sequence table, it is characterized by: U-Lib1 is positioned at promoter-35 core space upstream, altogether 24 bases, wherein 9 randomized bases, remaining is the sequence rich in AT.

The DNA fragmentation VIII (Fig. 7) for homologous recombination is obtained by two-step PCR amplification.With the restructuring in M-Lib1 The genomic DNA of bacterial strain M1-93 is template, uses primer lacI-up500 and pL-down-5 to amplify DNA fragmentation VII.Primer Sequence is:

PL-down5:CATATGAATATCCTCCTTAG

Then, with DNA fragmentation VII as template, use primer lacI-up500 and pL-UP-1 to amplify DNA fragmentation VIII. Primer sequence is:

PL-UP-1:CATGCTAACAATACGGGCTCAATTATATCAACGTTGTTATCTCTTGTC AANNNNTTTTNN AAAAWAWWTT TNNNCATATG AATATCCTC。

DNA fragmentation VIII include 500 bases (up500) of lacI upstream region of gene, FRT-Km-FRT fragment, U-Lib1, 38 bases after P2-15, M-93, the ribosome binding site (RBS) of lacZ gene and start codon (lacZ ') (Fig. 7).

FRT-Km-FRT fragment on colon bacillus M1-93 chromosome is removed, obtains colon bacillus M1- 93-FRT.Specifically comprise the following steps that (public can obtain from Tianjin Institute of Industrial Biotechnology, recorded pFT-by plasmid pFT-A The non-patent literature of A plasmid is Datsenko, K.A., and B.L.Wanner.2000.One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.Proc Natl Acad Sci USA, 97:6640-6645.) convert in M1-93 competent cell, 30 DEG C of incubated overnight on LB Amp100 flat board； In 250ml triangular flask, monoclonal is inoculated in 10ml LB Amp50 fluid medium, 150rpm, cultivates extremely for 30 DEG C OD0.1；Add duomycin (chlorotetracyclin, 5mg/ml) the final concentration 0.025mg/ml of 50ul, continued growth 6h；In the flat lining out of LB, 39 DEG C of cultivations；The Strain Designation that resistance disappears is: M1-93-FRT.

By Red homologous recombination technique beta galactosidase on colon bacillus M1-93-FRT chromosome (lacZ) U-Lib1 is added before promoter P2-15 of gene.Wherein, upstream region (500, upstream base, the phase of lacI gene The region of-500-0 for start codon) in homologous recombination, it is used as left homology arm；Promoter and messenger RNA stable region (P2-15::M1-93, relative to the region of-35-+15 of transcriptional start site) is used as right homology arm (figure in homologous recombination 7).First pKD46 plasmid is converted to colon bacillus M1-93-FRT by calcium chloride transformation.Then by DNA fragmentation VIII electricity goes to colon bacillus M1-93-FRT with pKD46.Electricity turns condition: first prepare with pKD46 plasmid The Electroporation-competent cells of colon bacillus M1-93-FRT；50ul competent cell is placed on ice, adds 50ngDNA Fragment VIII, places 2 minutes on ice, is transferred to the Bio-Rad electric shock cup of 0.2cm.(Bio-Rad is public to use MicroPulser Department) electroporation apparatus, shock parameters is voltage 2.5kv.Rapidly by 1ml LB media transfer to electric shock cup after electric shock, blow and beat 5 It is transferred to after secondary in test tube, 200 turns, hatches 2 hours for 37 DEG C.Take 100ul bacterium solution and be coated in the LB containing 10 kanamycin respectively On flat board, 39 DEG C of incubated overnight, remove pKD46 plasmid.1000ul bacterium solution has obtained altogether 20000 clones, and recombination efficiency is 100000 recons/ug DNA.

Having randomly selected 100 recombinant bacterial strains, cultivated 4 hours in LB culture medium, the enzyme carrying out beta galactosidase is lived Measure.Live it addition, measure colon bacillus ATCC 8739 beta galactosidase enzyme after IPTG induces.U-Lib1 library The beta galactosidase enzyme of 100 recombinant bacterial strains of middle random choose is lived and is evenly distributed, and lures for colon bacillus ATCC 8739 1.0-5.0 times (Fig. 8) after leading.

Embodiment 5, the structure in colon bacillus ribosome binding site library 1 (R-Lib1)

The sequence of ribosome binding site library R-Lib1 is sequence 18 in sequence table.It is characterized by: ribosome binding site The core space sequence of point is AGGAGR, and the upstream and downstream at it has 1 and 6 randomized bases respectively.

The DNA fragmentation X (Fig. 9) for homologous recombination is obtained by two-step PCR amplification.First, with recombinant bacterial strain P2-15 Genomic DNA be template, use primer lacI-up500 and pL-down4 amplify DNA fragmentation IX.Primer sequence is:

PL-down4:TGTGAAATTGTTATCCGC.

Then, with DNA fragmentation IX as template, use primer lacI-up500 and lacZ-PL-R4 to amplify DNA fragmentation X. Primer sequence is:

LacZ-PL-R4:CAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTAATCATG GTCAT (N6) CTCCTNTGTGAAATTGTTATCCGC。

DNA fragmentation X includes 500 bases (up500), FRT-Km-FRT fragment, P2-15, lacZ of lacI upstream region of gene 50 bases after the mRS of gene, R-Lib1, lacZ gene start codon (lacZ ') (Fig. 9).

By Red homologous recombination technique by the beta galactosidase on colon bacillus ATCC 8739 chromosome (lacZ) ribosome binding site of gene replaces with R-Lib1.Wherein, the upstream region of lacI gene (500, upstream base, Region relative to the-500-0 of start codon) in homologous recombination, it is used as left homology arm；Part lacZ gene (lacZ ', phase The region of+1-+50 for start codon) in homologous recombination, it is used as right homology arm (Fig. 9).First pKD46 plasmid is led to Superchlorination calcium conversion method converts to colon bacillus ATCC 8739.Then DNA fragmentation X electricity is gone to the large intestine with pKD46 Escherichia ATCC 8739.Electricity turns condition: first prepare the electricity of colon bacillus ATCC 8739 with pKD46 plasmid Transformed competence colibacillus cell；50ul competent cell is placed on ice, adds 50ngDNA fragment X, place 2 minutes on ice, be transferred to The Bio-Rad electric shock cup of 0.2cm.Using MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.Rapidly by 1ml LB media transfer to electric shock cup after electric shock, it is transferred in test tube after blowing and beating 5 times, 200 turns, 37 DEG C Hatch 2 hours.Take 100ul bacterium solution to be coated in respectively on the LB flat board containing 10 kanamycin, 39 DEG C of incubated overnight, remove PKD46 plasmid.1000ul bacterium solution has obtained altogether 4000 clones, and recombination efficiency is 20000 recons/ug DNA.

Having randomly selected 134 recombinant bacterial strains, cultivated 4 hours in LB culture medium, the enzyme carrying out beta galactosidase is lived Measure.Live it addition, measure colon bacillus ATCC 8739 beta galactosidase enzyme after IPTG induces.R-Lib1 library The beta galactosidase enzyme of 134 recombinant bacterial strains of middle random choose is lived and is evenly distributed, and lures for colon bacillus ATCC 8739 0.005-5.3 times (Figure 10) after leading.

Checking order the ribosome binding site district of recombinant bacterial strain R1-9, sequencing primer is lacI-up500 and lacZ- 373.The beta galactosidase enzyme of recombinant bacterial strain R1-9 lives 3.5 times after being respectively colon bacillus ATCC 8739 induction.Weight The artificial regulatory element sequences of group bacterial strain R1-9 is sequence 19 in sequence table.

Case study on implementation 6, the artificial regulatory element strength detection under different condition of culture

Choose recombinant bacterial strain M1-12, M1-64, M1-30, M1-46, the M1-in library, messenger RNA stable region 1 (M-Lib1) 37, M1-93, M1-162 (beta galactosidase enzyme live be respectively colon bacillus ATCC 8739 induction after 0.1,0.4, 0.8,1.7,2.5,5.0,4.9 times) cultivate 4 hours in LB culture medium, LB+5% glucose and AM1+5% glucose respectively, Carry out the enzyme activity determination of beta galactosidase.It addition, measure colon bacillus ATCC 8739 β-gala after IPTG induces Glycosidase enzyme is lived.

Under LB+5% glucose condition of culture, intensity and the LB condition of culture of the artificial controlling element of major part are suitable (80%-108%).The only intensity of two controlling elements has substantially reduction: M1-46 is the 53% of LB condition of culture, and M1-12 is The 60% of LB condition of culture.Under AM1+5% glucose condition of culture, intensity and the LB of the artificial controlling element of major part cultivate bar Part is quite (76%-112%).The intensity of this controlling element of only M1-162 has substantially reduction, is LB condition of culture 69% (Figure 11).These results indicate that the strength ratio that the artificial regulatory element of our structure is under different condition of culture is more consistent, Belong to constitutive expression.

Case study on implementation 7, use artificial regulatory element and a step homologous recombination method are to the base on colon bacillus chromosome Because expressing

By a pair general primer, use the step homologous recombination method can be by gene on colon bacillus chromosome Original regulation and control region replaces with the artificial regulatory element (Figure 12) with various intensity.The implementation case is by colon bacillus terpene 1-deoxidation in vinyl compound route of synthesis-xylulose 5-phosphate synthase gene (dxs), 1-deoxidation-xylulose 5-phosphate Reduction isomerase gene (dxr), 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol synthase gene (ispD), 4-diphosphonic acid born of the same parents Glycosides 2-C-methyl D erythritol kinase gene (ispE), (E)-4-hydroxy-3-methyl-crotyl-pyrophosphate synthetase base Because of (ispG), (E)-4-hydroxy-3-methyl-crotyl-pyrophosphoric acid reductase gene (ispH), isovaleryl pyrophosphoric acid isomerase Gene (idi), the original regulation and control region of method Buddhist nun's diphosphate synthase gene (ispA) replaces with M1-12, M1-64, M1-30, M1- 46, these six kinds of artificial regulatory elements of M1-37, M1-93, study its impact on beta-carotene synthesis.

Forward primer is gene-up-FRT, including treat overseas 50 bases in the original control region of controlling gene and with FRT sequence 20 bases of row homology.Downstream primer is gene-RBS-down, ties including the ribosome with colon bacillus lacZ gene Close 15 bases of site homology and 50 bases after controlling gene start codon.

For dxs gene, use dxs-up-FRT and dxs-RBS-down primer, with library 1, messenger RNA stable region (M- Lib1) the recombinant bacterial strain M1-93 in is template, amplifies DNA fragmentation dxs-M1-93, for homologous recombination (Figure 12).Primer sequence It is classified as:

Dxs-up-FRT:ACTACATCATCCAGCGTAATAAATAAACAATAAGT

ATTAATAGGCCCCTGGTGTAGGCTGGAGCTGCTTC

Dxs-RBS-down:GTGGAGTCGA CCAGTGCCAG GGTCGGGTAT TTGGCAATATCAAAACTCATAGCTGTTTCC TGGTT

By Red homologous recombination technique, by colon bacillus MG1655, (public can study from Tianjin industrial biotechnology Being obtained, the non-patent literature recording colon bacillus K-12MG1655 is Blattner et al., 1997, The Complete Genome Sequence of Escherichia coli K-12Science, 277:1453-1462.) dyeing The original regulation and control region of the dxs gene on body replaces with M1-93.First by pKD46 plasmid by calcium chloride transformation convert to Colon bacillus MG1655.Then DNA fragmentation dxs-M1-93 electricity is gone to colon bacillus MG1655 with pKD46. Electricity turns condition: first prepare the Electroporation-competent cells of colon bacillus MG1655 with pKD46 plasmid；By 50ul Competent cell is placed on ice, adds 50ngDNA fragment, places 2 minutes on ice, is transferred to the Bio-Rad electric shock cup of 0.2cm. Using MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.Rapidly 1ml LB is trained after electric shock Support in group-transfer extremely electric shock cup, be transferred in test tube after blowing and beating 5 times, 200 turns, hatch 2 hours for 37 DEG C.Take 100ul bacterium solution respectively It is coated on the LB flat board containing kanamycin, 39 DEG C of incubated overnight, removes pKD46 plasmid.Obtain recombinant bacterial strain dxs-M1-93- FKF。

Use same method, use dxs-up-FRT and dxs-RBS-down primer, with library, messenger RNA stable region 1 (M-Lib1) recombinant bacterial strain M1-12, M1-64, M1-30, M1-46, M1-37 in are template, amplify DNA fragmentation dxs-M1- 12, obtain after dxs-M1-64, dxs-M1-30, dxs-M1-46, dxs-M1-37, and colon bacillus MG1655 homologous recombination Recombinant bacterial strain dxs-M1-12-FKF, dxs-M1-64-FKF, dxs-M1-30-FKF, dxs-M1-46-FKF, dxs-M1-37- FKF。

Use same method, use dxr-up-FRT and dxr-RBS-down primer, by the original control region of dxr gene Territory replaces with these six kinds of artificial regulatory elements of M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, obtains recombinant bacterial strain dxr-M1-64-FKF、dxr-M1-12-FKF、dxr-M1-30-FKF、dxr-M1-46-FKF、dxr-M1-37-FKF、dxr-M1- 93-FKF.Primer sequence is:

Dxr-up-FRT:ATCGGCTGGCGGCGTTTTGCTTTTTATTCTGTCTCAACTCTGGAT GTTTCGTGTAGGC TGGAGCTGCTTC

Dxr-RBS-down:GTGCTGCAAC CAATCGAGCC GGTCGAGCCC AGAATGGTGAGTTGCTTCATAGCTGTTTCCTGGTT

Use same method, use ispD-up-FRT and ispD-RBS-down primer, by the original tune of ispD gene Control region replaces with these six kinds of artificial regulatory elements of M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, obtains recombinant bacterium Strain ispD-M1-12-FKF, ispD-M1-64-FKF, ispD-M1-30-FKF, ispD-M1-46-FKF, ispD-M1-37-FKF, ispD-M1-93-FKF.Primer sequence is:

IspD-up-FRT:TGCCTGACGCGTCGAAGCGCGCACAGTCTGCGGGGC

AAAACAATCGATAAGTGTAGGCTGGAGCTGCTTC

IspD-RBS-down:AATCCGGCCG CCGGAACCAC GGCGCAAACA TCCAAATGAGTGGTTGCCATAGCTGTTTCC TGGTT

Use same method, use ispE-up-FRT and ispE-RBS-down primer, by the original tune of ispE gene Control region replaces with these six kinds of artificial regulatory elements of M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, obtains recombinant bacterium Strain ispE-M1-12-FKF, ispE-M1-64-FKF, ispE-M1-30-FKF, ispE-M1-46-FKF, ispE-M1-37-FKF, ispE-M1-93-FKF.Primer sequence is:

IspE-up-FRT:ACGGTGGTCAACGCATCAAGTTAAAAATGGATAACT

GGATAGTGAAATAAGTGTAGGCTGGAGCTGCTTC

IspE-RBS-down:ATGTATAAAA ACAGATTAAG TTTTGCCGGA GAGGGCCACTGTGTCCGCATAGCTGTTTCC TGGTT

Use same method, use ispG-up-FRT and ispG-RBS-down primer, by the original tune of ispG gene Control region replaces with this six all artificial regulatory element of M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, is recombinated Bacterial strain ispG-M1-12-FKF, ispG-M1-64-FKF, ispG-M1-30-FKF, ispG-M1-46-FKF, ispG-M1-37- FKF、ispG-M1-93-FKF.Primer sequence is:

IspG-up-FRT:GCCGAACAATCACCGGCGCAGTAACAGACGGGTAACGCGGG AGATTTTTCGTGTAGGCTGGAGCTGCTTC

IspG-RBS-down:ACGTAAATAC GTGTTGATTT TCTACGTTGA ATTGGAGCCTGGTTATGCATAGCTGTTTCC TGGTT

Use same method, use ispH-up-FRT and ispH-RBS-down primer, by the original tune of ispH gene Control region replaces with these six kinds of artificial regulatory elements of M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, obtains recombinant bacterium Strain ispH-M1-12-FKF, ispH-M1-64-FKF, ispH-M1-30-FKF, ispH-M1-46-FKF, ispH-M1-37-FKF, ispH-M1-93-FKF.Primer sequence is:

IspH-up-FRT:TCATTTTGATATTGAAGTGCTGGAAATCGATCCGGC

ACTGGAGGCGTAACGTGTAGGCTGGAGCTGCTTC

IspH-RBS-down:CGGTCTACCC CGGCACAAAA ACCACGCGGG TTGGCCAACAGGATCTGCATAG CTGTTTCC TGGTT

Use same method, use idi-up-FRT and idi-RBS-down primer, by the original control region of idi gene Territory replaces with these six kinds of artificial regulatory elements of M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, obtains recombinant bacterial strain idi-M1-12-FKF、idi-M1-64-FKF、idi-M1-30-FKF、idi-M1-46-FKF、idi-M1-37-FKF、idi-M1- 93-FKF.Primer sequence is:

Idi-up-FRT:TCACTTGGTTAATCATTTCACTCTTCAATTATCT

ATAATGATGAGTGATCGTGTAGGCTGGAGCTGCTTC

Idi-RBS-down:CCCGTGGGAA CTCCCTGTGC ATTCAATAAA ATGACGTGTTCCGTTTGCATAGCTGTTTCC TGGTT

Use same method, use ispA-up-FRT and ispA-RBS-down primer, by the original tune of ispA gene Control region replaces with this six all artificial regulatory element of M1-12, M1-64, M1-30, M1-46, M1-37, M1-93, is recombinated Bacterial strain ispA-M1-64-FKF, ispA-M1-12-FKF, ispA-M1-30-FKF, ispA-M1-46-FKF, ispA-M1-37- FKF、ispA-M1-93-FKF.Primer sequence is:

IspA-up-FRT:CTGACAATGAAGACGCCTCTCTAACCCCTTTTACACCGGACAAT GAGT AAGTGTAGGCTGGAGCTGCTTC

IspA-RBS-down:GCCTGGTTGGCCTGCTTAACGCAGGCTTCGAGTTGCTGCGGA AAGTCCATAGCTG TTTCCTGGTT

In order to verify dxs, dxr, ispD, ispE, isp G, to β-Radix Dauci Sativae after ispH, idi, ispA gene expression regulation The impact of element synthesis, is incorporated into beta-carotene route of synthesis in the recombinant bacterial strain after MG1655 regulation and control, measures beta-carotene The change of synthesis capability.

First the gene of beta-carotene route of synthesis is cloned in pTrc99A-M and pACYC184-M plasmid. The structure of pTrc99A-M plasmid is as shown in figure 13: by PCR method, at pTrc99A plasmid, (public can be from Tianjin industrial bio skill Art institute obtains, and the non-patent literature recording pTrc99A plasmid is Amann E, Ochs B, Abel KJ.Tightly regulated tac promoter vectors useful for the expression of unfused and fused Proteins in Escherichia coli.Gene.1988,69 (2): 301-15.) the lacI gene in is previously incorporated PacI, SpeI and NdeI restriction enzyme site, rrnB T2 transcription terminator followed by PacI restriction enzyme site, concrete steps are such as Under:

With primer 99A-F1-PacI-SpeI-NdeI and 99A-R1-PacI as primer, pTrc99A is that template carries out PCR expansion Increasing, obtain fragment I, with 99A-F2/99A-R2 as primer, pTrc99A is that template carries out PCR amplification, obtains fragment II.Primer sequence It is classified as:

99A-F1-PacI-SpeI-NdeI:TTAATTAACTAGTCATATG GGCATGCATTTACGTTGACA

99A-R1-PacI:TTAATTAA AGAAACGCAAAAAGGCCATC

99A-F2:CATTCAAATATGTATCCGCTCA

99A-R2:CGCAGGAAAGAACATGTGAG

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each DNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ Ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is: 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of changes Property 10 seconds, 58 DEG C anneal 10 seconds, 72 DEG C extend 40sec (30 circulations)；72 DEG C extend 5 minutes (1 circulation).Amplified production sheet Section I comprises the fragment of the about 1900bp of lacI gene, lacIq fragment, multiple clone site and rrnB termination codon, amplification Product fragment II comprises the fragment of the about 1700bp of ampicillin resistance gene and pMB1 replication origin.PCR primer is used After PCR cleaning reagent box cleans (PCR cleaning reagent box is purchased from Biomiga company), process respectively with DpnI (purchased from NEB company) Fragment I and fragment II.Enzyme action system and condition be: 40ul PCR primer, 5ul 10 × buffer 4,1ulDpnI, 37 DEG C is hatched 1 hour, PCR cleaning reagent box cleaned fragment I and fragment II, phosphatizing treatment fragment I.Phosphorylation system is: 8ul is to be processed PCR fragment, in 70 DEG C of water bath processing 5min, adds 1ul T4DNA ligase buffer (purchased from NEB company), the many poly-nuclears of 0.5ul T4 Thuja acid kinases (purchased from NEB company), 37 DEG C, 60min, 60 DEG C of temperature bath 20min inactivate phosphorylase, and PCR cleaning reagent box cleans Phosphorylated fragment thereof.Connecting enzyme soon and connect two fragments, linked system is: 2.5ul fragment I, 2.5ul fragment II, 5ul 2 × connect soon Buffer, 0.5ul quick ligase (purchased from NEB company), was gently mixed, room temperature reaction adds 50ul Trans1-after 5 minutes (purchased from Beijing Quanshijin Biotechnology Co., Ltd) in 10 competent cells, ice bath 30 minutes.42 DEG C of heat shocks 30 seconds, put immediately In on ice 2 minutes.Add 500ul LB culture medium, 200rpm, hatch 1 hour for 37 DEG C.Take 200ul bacterium solution and be coated in containing ammonia benzyl blue or green On the LB flat board of mycin, after incubated overnight, select 5 positive single bacterium colonies, positive colony is carried out liquid culture, extracts positive gram Grand plasmid carries out digestion verification, it was demonstrated that be previously incorporated PacI, SpeI and NdeI restriction enzyme site at lacI gene, at rrnB T2 eventually Only son followed by upper PacI restriction enzyme site, named pTrc99A-M.

The structure of pACYC184-M plasmid is as shown in figure 14: by PCR method, at pACYC184 plasmid, (public can be from Tianjin Industrial biotechnology institute obtains, and the non-patent literature recording pACYC184-M plasmid is Rose, R.E.The Nucleotide sequence of pACYC184.Nucleic Acids Res.1988,16 (1), 355.) introduce in The lacI gene of pTrc99A plasmid, lacIq fragment, multiple clone site and rrnB termination codon, and draw before lacI gene Enter PacI, SpeI and NdeI restriction enzyme site, rrnB T2 terminator followed by PacI restriction enzyme site, specifically comprise the following steps that

With primer 99A-F1-PacI-SpeI-NdeI and 99A-R1-PacI as primer, pTrc99A is that template carries out PCR expansion Increasing, obtain fragment I, with 184-F2,184-R2 as primer, pACYC184 is that template carries out PCR amplification, obtains fragment II.Primer Sequence is:

184-F2:GGGAGAGCCTGAGCAAACT

184-R2:CGATGATAAGCTGTCAAACATGA

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each DNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ Ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is: 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of changes Property 10 seconds, 58 DEG C anneal 10 seconds, 72 DEG C extend 40sec (30 circulations)；72 DEG C extend 5 minutes (1 circulation).Amplified production sheet Section I comprises the fragment of the about 1900bp of lacI gene, lacIq, multiple clone site and rrnB termination codon, amplified production Fragment II comprises chloramphenicol resistance gene and the fragment of p15A replication origin about 2200bp.PCR primer PCR is cleaned examination After agent box cleans (PCR cleaning reagent box is purchased from Biomiga company), process fragment I and sheet respectively with DpnI (purchased from NEB company) Section II enzyme action system and condition be: 40ul PCR primer, 5ul10 × buffer 4,1ul DpnI, hatch 1 hour for 37 DEG C, PCR Cleaning reagent box cleans fragment I and fragment II.Phosphatizing treatment fragment I, phosphorylation system is: 8ul PCR fragment to be processed in 70 DEG C of water bath processing 5min, add 1ul T4DNA ligase buffer (purchased from NEB company), 0.5ul T4 polynueleotide kinase (purchased from NEB company), 37 DEG C, 60min, 60 DEG C of temperature bath 20min inactivate phosphorylase, and PCR cleaning reagent box cleans phosphorylation sheet Section.Connecting enzyme soon and connect two fragments, linked system is: 2.5ul fragment I, 2.5ul fragment II, 5ul 2 × connect buffer, 0.5ul soon Quick ligase (purchased from NEB company), was gently mixed, room temperature reaction adds 50ul Trans1-10 competent cell after 5 minutes In (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 DEG C of heat shocks 30 seconds, are immediately placed on 2 minutes on ice. Add 500ul LB culture medium, 200rpm, hatch 1 hour for 37 DEG C.Take 200ul bacterium solution to be coated on the LB flat board containing chloromycetin, After incubated overnight, select 5 positive single bacterium colonies, positive colony is carried out liquid culture, extracts positive colony plasmid and carry out enzyme action Checking, it was demonstrated that be previously incorporated PacI, SpeI and NdeI restriction enzyme site at lacI gene, after rrnB T2 transcription terminator Plus PacI restriction enzyme site, named pACYC184-M.

Beta-carotene route of synthesis gene cluster in pantoea agglomerans (Pantoea agglomerans) exists same Under operon, this operon comprise yak base yak base diphosphonic acid (GGPP) synthase gene (crtE), beta-carotene Cyclase gene (crtX), lycopene beta cyclase gene (crtY), phytoene desaturase gene (crtI), eight Hydrogen lycopene synthase gene (crtB), beta-carotene hydroxylase gene (crtZ) gene, the burnt phosphorus in colon bacillus Acid system Buddhist nun's fat (FPP) can produce beta-carotene successively through the catalysis of crtE, crtB, crtI, crtY gene encoding enzyme.With Crt- Cluster-f, Crt-cluster-r are primer, with pantoea agglomerans (Pantoea agglomerans, CGMCC number: 1.2244.Buy from China General Microbiological DSMZ) genome DNA be template, expand crtEBIXY gene. Primer sequence is:

Crt-cluster-f:CTGTGAATTCAAGGAGATATACCATGATGACGGTCTGTGCAGAA

Crt-cluster-r:TTGCAGTCGACGCTGCGAGAACGTCA

Wherein underscore part is respectively EcoRI and SalI restriction enzyme site, and The Scarlet Letter part is artificial RBS.

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each DNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ Ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of changes Property 10 seconds, 58 DEG C anneal 10 seconds, 72 DEG C extend 2 minutes (30 circulations)；72 DEG C extend 5 minutes (1 circulation).Amplified production bag Containing crtE, crtX, crtY, crtI and crtB gene, about 5800bp base.

The crtEXYIB gene of beta-carotene route of synthesis is cloned in pTrc99A-M plasmid, process such as Figure 15 institute Show.By the PCR fragment of EcoRI and SalI enzyme action crtEBIXY gene amplification, simultaneously with EcoRI and SalI enzyme action pTrc99A-M Plasmid, connects two fragments.Linked system is: 1ul pTrc99A-M digestion products, the PCR primer after 4ul enzyme action, 5ul connects soon Buffer, 0.5ul quick ligase (purchased from NEB company), was gently mixed, room temperature reaction adds 50ulTrans1-T1 after 5 minutes (purchased from Beijing Quanshijin Biotechnology Co., Ltd) in competent cell, ice bath 30 minutes.42 DEG C of heat shocks 30 seconds, immediately as 2 minutes on ice.Add 500ul LB culture medium, 200rpm, hatch 1 hour for 37 DEG C.Take 200ul bacterium solution to be coated in containing ammonia benzyl penicillium sp On the LB flat board of element, after incubated overnight, select 5 positive single bacterium colonies, positive colony is carried out liquid culture, extracts positive colony Plasmid carries out sequence verification, sequencing result show crt serial genes be inserted into pTrc99A-M multiple clone site EcoRI and At SalI, named pTrc99A-M-crt.

The crtEXYIB gene of beta-carotene route of synthesis is cloned in pACYC184-M plasmid, process such as Figure 16 institute Show.With PacI enzyme action pACYC184-M.Simultaneously with PacI enzyme action pTrc99A-M-crt, cut glue and reclaim about 7.8kb fragment, with The fragment of PacI enzyme action pACYC184-M is connected, and converts Top 10 competent cell (limited purchased from Beijing full formula gold biotechnology Company), ice bath 30 minutes, 42 DEG C of heat shocks 30 seconds, immediately as on ice 2 minutes.Addition 500ul LB culture medium, 200rpm, 37 DEG C hatch 1 hour.Take 200ul bacterium solution to be coated on the LB flat board containing chloromycetin, after incubated overnight, select 5 positive single bacterium colonies, Positive colony carrying out liquid culture, extracts positive colony plasmid and carry out sequence verification, sequencing result shows that crt serial genes is inserted Enter at the PacI enzyme action of pACYC184-M, named pACYC184-M-crt.

Use electrotransformation pACYC184-M-crt is transformed into MG1655, dxs-M1-12-FKF, dxs-M1-64-FKF, dxs-M1-30-FKF、dxs-M1-46-FKF、dxs-M1-37-FKF、dxs-M1-93-FKF、dxr-M1-12-FKF、dxr-M1- 64-FKF、dxr-M1-30-FKF、dxr-M1-46-FKF、dxr-M1-37-FKF、dxr-M1-93-FKF、ispD-M1-12- FKF、ispD-M1-64-FKF、ispD-M1-30-FKF、ispD-M1-46-FKF、ispD-M1-37-FKF、ispD-M1-93- FKF、ispE-M1-12-FKF、ispE-M1-64-FKF、ispE-M1-30-FKF、ispE-M1-46-FKF、ispE-M1-37- FKF、ispE-M1-93-FKF、ispG-M1-12-FKF、ispG-M1-64-FKF、ispG-M1-30-FKF、ispG-M1-46- FKF、ispG-M1-37-FKF、ispG-M1-93-FKF、ispH-M1-12-FKF、ispH-M1-64-FKF、ispH-M1-30- FKF、ispH-M1-46-FKF、ispH-M1-37-FKF、ispH-M1-93-FKF、idi-M1-12-FKF、idi-M1-64-FKF、 idi-M1-30-FKF、idi-M1-46-FKF、idi-M1-37-FKF、idi-M1-93-FKF、ispA-M1-12-FKF、ispA- In M1-64-FKF, ispA-M1-30-FKF, ispA-M1-46-FKF, ispA-M1-37-FKF, ispA-M1-93-FKF.

Determine beta-carotene yield by the absorption at 450 nm of the beta-carotene of mensuration acetone extract, and calculate Its relative value to cell turbidity (OD600nm).The 5ml LB culture medium containing 34ug/ml chloromycetin is cultivated containing pACYC184- MG1655 and dxs of M-crt plasmid, the restructuring after dxr, ispD, ispE, ispG, ispH, idi, ispA gene expression regulation Bacterial strain.30 DEG C, 220rpm cultivate 24 hours.Take 2ml bacterium solution and be centrifuged 10min in 4000rpm, clean one time with aquesterilisa, add 1ml Under 55 DEG C of acetone, dark condition extract 15min, 14,000rpm are centrifuged 1min, under ultraviolet spectrophotometer 453nm measure β- Carotene carotene content, result is as shown in figure 17.

Content beta-carotene after dxs gene regulation is 1.3-3.5 times of wild mushroom, and effect most preferably M1-37 regulates and controls Element；Content beta-carotene after dxr gene regulation is 0.7-2.3 times of wild mushroom, and effect most preferably M1-30 regulates and controls unit Part；Content beta-carotene after ispD gene regulation is 0.3-1.4 times of wild mushroom, and effect most preferably M1-93 regulates and controls unit Part；Content beta-carotene after ispE gene regulation is 0.9-1.4 times of wild mushroom, and effect most preferably M1-30 regulates and controls unit Part；Content beta-carotene after ispG gene regulation is 0.9-1.2 times of wild mushroom, and effect most preferably M1-37 regulates and controls unit Part；Content beta-carotene after ispH gene regulation is 0.3-1.2 times of wild mushroom, and effect most preferably M1-64 regulates and controls unit Part；Content beta-carotene after idi gene regulation is 0.4-2.1 times of wild mushroom, effect most preferably M1-37 controlling element； Content beta-carotene after ispA gene regulation is 1.6-2.3 times of wild mushroom, effect most preferably M1-30 controlling element；

Case study on implementation 8, use artificial regulatory element and two step homologous recombination methods are to the base on colon bacillus chromosome Because expressing

One step homologous recombination method, after completing gene expression regulation, can leave FRT-Km-FRT sheet on cell chromosome Section, although Km resistance marker can be removed by the effect of FLP, but still can stay next FRT fragment.Use two steps same The original regulation and control region of gene on colon bacillus chromosome can be replaced with by source recombination method has the artificial of various intensity Controlling element (Figure 18), does not the most leave any DNA fragmentation after having operated.When first step homologous recombination, controlling gene will be treated Original regulation and control region replaces with cat-sacB fragment (Figure 18 A)；When second step homologous recombination, cat-sacB fragment is replaced with There is the artificial regulatory element (Figure 18 B) of various intensity.

The DNA fragmentation gene-cat-sacB for first round homologous recombination is amplified by the method for PCR.Forward primer For gene-up-Km, including treat overseas 50 bases in the original control region of controlling gene and with cat gene upstream sequence homology 20 bases.Downstream primer is gene-sacB-down, including with 20 bases of sacB downstream of gene sequence homology and wait to adjust 50 bases after control gene start codon.

Amplified for the second DNA fragmentation taking turns homologous recombination by the method for PCR.Forward primer is gene-up-P, bag Include 50 bases and 20 the base (transcription initiations in artificial regulatory element promoter district treating that the original control region of controlling gene is overseas -50 to-31 sites of point).Downstream primer is gene-RBS-down, including the ribosome with colon bacillus lacZ gene 15 bases of binding site homology and 50 bases after controlling gene start codon.

Use two step homologous recombination methods that the original regulation and control region of the dxs gene of colon bacillus MG1655 is replaced with people Work controlling element M1-93.First with pBM002 plasmid (derive from Hefei hundred and step Bioisystech Co., Ltd) as template, use Dxs-up-cat and dxs-sacB-down primer, amplifies the DNA fragmentation dxs-cat-sacB for first step homologous recombination. Primer sequence is:

Dxs-up-cat:ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAA

TAGGCCCCTGGGAGAAAATACCGCATCAGG

Dxs-sacB-down:GTGGAGTCGA CCAGTGCCAG GGTCGGGTAT TTGGCAATATCAAAACTCATGCGTTGGCCGATTCATTA。

With M1-93 as template, use dxs-up-P and dxs-RBS-down primer, amplify for second step homologous recombination DNA fragmentation dxs-M1-93.Primer sequence is:

Dxs-up-P:ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAA

TAGGCCCCTGTTATCTCTGGCGGTG TTGAC

Dxs-RBS-down:GTGGAGTCGA CCAGTGCCAG GGTCGGGTAT TTGGCAATATCAAAACTCATAGCTGTTTCC TGGTT

First pKD46 plasmid is converted to colon bacillus MG1655 by electrotransformation.Then by DNA fragmentation dxs- Cat-sacB electricity goes to colon bacillus MG1655 with pKD46.Electricity turns condition: first prepare with pKD46 plasmid The Electroporation-competent cells of colon bacillus MG1655；50ul competent cell is placed on ice, adds 50ngDNA sheet Section dxs-cat-sacB, places 2 minutes on ice, is transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio- Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.Rapidly 1ml LB media transfer is extremely shocked by electricity in cup after electric shock, It is transferred in test tube after blowing and beating 5 times, 200 turns, hatches 2 hours for 37 DEG C.Take 200ul bacterium solution and be coated in the LB flat board containing chloromycetin On, after incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer dxs-up/dxs-down to verify).Select One correct single bacterium colony, by its named dxs-cat-sacB.

PKD46 plasmid is converted to dxs-cat-sacB by electrotransformation, then DNA fragmentation dxs-M1-93 electricity is turned To the dxs-cat-sacB with pKD46 plasmid, electricity turns condition and is: first prepare the dxs-cat-sacB with pKD46 plasmid Electroporation-competent cells；50ul competent cell is placed on ice, adds 50ng DNA fragmentation dxs-M1-93, put on ice Put 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, electric shock Parameter is voltage 2.5kv.Rapidly by 1ml LB media transfer to electric shock cup after electric shock, it is transferred in test tube after blowing and beating 5 times, 200rpm, hatches 4 hours for 37 DEG C, removes pKD46 plasmid.Bacterium solution is transferred to the LB liquid not having sodium chloride containing 10% sucrose Body culture medium (fills 50ml culture medium) in 250ml flask, consolidate at the LB not having sodium chloride containing 6% sucrose after cultivating 24 hours In body culture medium streak culture.Through PCR checking (using primer dxs-up/dxs-down to verify), select one correctly Single bacterium colony, by its named dxs-M1-93.

Use electrotransformation that pACYC184-M-crt is transformed into dxs-M1-93, measure the synthesis capability of beta-carotene. Dxs-M1-93 (pACYC184-M-crt) the synthesis ability of beta-carotene and dxs-M1-93-FKF's (pACYC184-M-crt) Essentially the same.

Exogenous gene expression on colon bacillus chromosome is adjusted by case study on implementation 9, use artificial regulatory element Control

The crtEXYIB gene of pantoea agglomerans can be catalyzed conversion Buddhist nun's fat (FPP) and synthesize β-Hu Luo through series reaction Bu Su.First crtEXYIB gene is integrated into colon bacillus ATCC 8739 chromosome by the method for two step homologous recombination LdhA site.For two step homologous recombination plasmid construction process as shown in figure 19.

The first step, with colon bacillus ATCC 8739 genomic DNA as template, uses primer ldhA-up/ldhA- Down, the lactate dehydrogenase gene ldhA of amplification colon bacillus ATCC 8739.Primer sequence is:

LdhA-up:GATAACGGAGATCGGGAATG；

LdhA-down:CTTTGGCTGTCAGTTCACCA.

Amplification system: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each DNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ Ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is: 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of changes Property 10 seconds, 58 DEG C anneal 10 seconds, 72 DEG C extend 40sec (30 circulations)；72 DEG C extend 5 minutes (1 circulation).Amplified production is Lactate dehydrogenase gene ldhA, and be cloned on pEASY-Blunt cloning vehicle.Clone's system is: 1ul PCR expands product Thing, 1ul pEASY-Blunt cloning vehicle, be gently mixed, room temperature reaction adds 50ul Trans1-T1 competence after 5 minutes thin (purchased from Beijing Quanshijin Biotechnology Co., Ltd) in born of the same parents, ice bath 30 minutes.42 DEG C of heat shocks 30 seconds, are immediately placed on 2 points on ice Clock.Add 250ul LB culture medium, 200rpm, hatch 1 hour for 37 DEG C.Take 200ul bacterium solution be coated in the LB containing kanamycin put down On plate, after incubated overnight, select 5 positive single bacterium colonies, positive colony is carried out liquid culture, extracts positive colony plasmid and carry out Sequence verification, sequencing result shows to insert lactate dehydrogenase gene ldhA on carrier pEASY-Blunt, it was demonstrated that plasmid construction Correctly, the named pXZ001 of recombiant plasmid that will obtain.

Second step, with pXZ001 plasmid DNA as template, carries out PCR amplification with primer ldhA-1/ldhA-2, obtains The DNA cloning fragment of pXZ001 plasmid, primer sequence is as follows:

LdhA-1:TCTGGAAAAAGGCGAAACCT；

LdhA-2:TTTGTGCTATAAACGGCGAGT.

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each DNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ Ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of changes Property 10 seconds, 58 DEG C anneal 10 seconds, 72 DEG C extend 2 minutes (30 circulations)；72 DEG C extend 5 minutes (1 circulation).PCR expands product Thing comprises about 400 bases of pEASY-Blunt carrier and lactate dehydrogenase gene encoding gene upstream and downstream.

3rd step, as template, uses primer 4162-with pBM002 plasmid (derive from Hefei hundred and step Bioisystech Co., Ltd) F/4162-R carries out PCR amplification, obtains containing chloromycetin gene (Cam) and levan sucrose transferase gene (sacB) DNA sheet Section, is connected to the pcr amplification product of second step.Primer sequence is as follows:

4162-F:GGAGAAAATACCGCATCAGG

4162-R:GCGTTGGCCGATTCATTA

Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each DNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ Ul) 0.5ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 DEG C of denaturations 1 minute (1 circulation)；98 DEG C of changes Property 10 seconds, 60 DEG C anneal 10 seconds, 72 DEG C extend 2 minutes (30 circulations)；72 DEG C extend 5 minutes (1 circulation).PCR contains chlorine The base of about about the 3000bp of mould plain gene (Cam) and levan sucrose transferase gene (sacB) DNA fragmentation.

After second step is obtained the cleaning of pcr amplification product PCR cleaning reagent box, DpnI process；3rd step is obtained PCR After amplified production cleans with PCR cleaning reagent box, this fragment of phosphatizing treatment, two fragments are connected.Take bacterium solution 200ul after conversion Be coated in receive containing card mycin and chloromycetin LB flat board on, after incubated overnight, select 5 positive single bacterium colonies, positive colony entered Row liquid culture, extracts positive colony plasmid and carries out digestion verification, it was demonstrated that chloromycetin gene (Cam) and levan sucrose are shifted Enzyme gene (sacB) is inserted into pEASY-Blunt carrier and the 400bp homology arm of lactate dehydrogenase gene encoding gene upstream and downstream Centre, named pXZ002.

4th step, with pXZ002 plasmid DNA as template, carries out PCR amplification with primer ldhA-up/ldhA-down, obtains The DNA cloning fragment of pXZ002 plasmid.Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, DNTP (10mM each dNTP) 1ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNAPolymerase (2.5U/ul) 1ul, distilled water 33.5ul, cumulative volume is 50ul.Amplification condition is 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of degeneration are annealed 10 seconds, 72 DEG C and are extended 1 minute 40 seconds (30 circulations) for 10 seconds, 59 DEG C；72 DEG C extend 5 minutes (1 circulation).DNA fragmentation I comprises about 400, lactic dehydrogenase enzyme coding gene upstream base, Cat-sacB DNA fragmentation, breast About 400, dehydrogenase-encoding gene downstream base.DNA fragmentation I is used for homologous recombination for the first time.First by pKD46 matter Grain.Converted to colon bacillus ATCC 8739 by calcium chloride transformation, then DNA fragmentation I electricity is gone to pKD46 Colon bacillus ATCC 8739.Electricity turns condition: first prepare colon bacillus ATCC with pKD46 plasmid The Electroporation-competent cells of 8739；50ul competent cell is placed on ice, adds 50ngDNA fragment I, place 2 points on ice Clock, is transferred to the Bio-Rad electric shock cup of 0.2cm.Using MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is Voltage 2.5kv.Rapidly by 1ml LB media transfer to electric shock cup after electric shock, it is transferred in test tube after blowing and beating 5 times, 200 turns, Hatch 2 hours for 37 DEG C, remove pKD46 plasmid.Take 200ul bacterium solution to be coated on the LB flat board containing chloromycetin, after incubated overnight, choose (using primer ldhA-up/ldhA-down to verify, correct bacterium colony amplified production is to select 5 single bacterium colonies to carry out PCR checking The fragment of about 3700bp).Select a correct single bacterium colony, by its named QL001.

5th step, by pTrc99A-M-crt plasmid through PacI enzyme action, cuts glue and reclaims about 8kb fragment, Klenow filling-in end It is connected with the PCR fragment obtained in second step afterwards.After taking conversion, bacterium solution 200ul is coated with on the LB flat board containing kanamycin, overnight trains After Yanging, select 5 positive single bacterium colonies, positive colony is carried out liquid culture, extracts positive colony plasmid and carry out enzyme action and order-checking Checking, result shows that crtEXYIB gene is inserted into pEASY-Blunt carrier and lactate dehydrogenase gene encoding gene upstream and downstream 400bp homology arm in the middle of, named pXZ003-crt.

6th step, with pXZ003-crt plasmid DNA as template, uses primer ldhA-up/ldhA-down to amplify DNA sheet Section II, amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10ul, dNTP (10mM each dNTP) 1.5ul, DNA profiling 20ng, primer (10uM) 2ul, Phusion High-Fidelity DNA Polymerase (2.5U/ul) 1ul, distilled water 32.5ul, cumulative volume is 50ul.Amplification condition is: 98 DEG C of denaturations 2 minutes (1 circulation)；98 DEG C of degeneration 10 Second, 59 DEG C of anneal 10 seconds, 72 DEG C of extensions 7 minutes (30 circulations)；72 DEG C extend 10 minutes (1 circulation).The core of DNA fragmentation II Nucleotide sequence is as shown in sequence 3 in sequence table.DNA fragmentation II comprise about 400, lactic dehydrogenase enzyme coding gene upstream base, Trc promoter, crtEXYIB gene, rrnB T2 transcription terminator and about 400, lactic dehydrogenase enzyme coding gene downstream alkali Base.DNA fragmentation II is for second time homologous recombination.First pKD46 plasmid is converted to QL001 by calcium chloride transformation, so After DNA fragmentation II electricity is gone to the QL001 with pKD46 plasmid, electricity turns condition and is: first prepare with pKD46 plasmid The Electroporation-competent cells of QL001；50ul competent cell is placed on ice, adds 50ng DNA fragmentation II, place 2 on ice Minute, it is transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters For voltage 2.5kv.Rapidly by 1ml LB media transfer to electric shock cup after electric shock, it is transferred in test tube after blowing and beating 5 times, 200rpm, hatches 4 hours for 37 DEG C, removes pKD46 plasmid.Bacterium solution is transferred to the LB liquid not having sodium chloride containing 10% sucrose Body culture medium (fills 50ml culture medium) in 250ml flask, consolidate at the LB not having sodium chloride containing 6% sucrose after cultivating 24 hours In body culture medium streak culture.(primer ldhA-up/crtE-r is used to verify, correct bacterium colony amplification through PCR checking Product is the fragment of about 4500bp), select a correct single bacterium colony, by its named QL002.CrtE-r primer sequence is such as Under:

CrtE-r:TTAACTGACGGCAGCGAGTT

By a pair general primer, a step homologous recombination method is used to be started by the trc of exogenous gene crtEXYIB Son replaces with the artificial regulatory element with various intensity.

Present case the trc promoter of exogenous gene crtEXYIB is replaced with M1-64, M1-46, M1-37, M1-93 this four Plant artificial regulatory element, study its impact on beta-carotene synthesis.

Forward primer is ldhA-up-FRT, including ldhA upstream region of gene 50 bases and with 20 of FRT sequence homology Base.Downstream primer is crt-RBS-down, including the ribosome binding site homology with lacZ gene 15 bases and 50 bases after crtE gene start codon.Primer sequence is:

LdhA-up-FRT:ATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGT GATTCAGTGTAGG CTGGAGCTGCTTC

CrtE-RBS-down:GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACC GTCATCATAGCTG TTTCCTGGTT

Use crt-up-FRT and crt-RBS-down primer, with recombinant bacterial strain M1-64, M1-46, M1-in M-Lib1 37, M1-93 is template, amplifies DNA fragmentation crt-M1-64, crt-M1-46, crt-M1-37, crt-M1-93, and QL002 is same Recombinant bacterial strain crt-M1-64-FKF, crt-M1-46-FKF, crt-M1-37-FKF, crt-M1-93-FKF is obtained after the restructuring of source.

Mensuration QL002, crt-M1-64-FKF, crt-M1-46-FKF, crt-M1-37-FKF, crt-M1-93-FKF β-recklessly Radix Raphani element, result is shown in Figure 20.The β of crt-M1-64-FKF, crt-M1-46-FKF, crt-M1-37-FKF, crt-M1-93-FKF- Carotenoid production is the 2.7 of QL002,1.7,3,3.3 times respectively.

It addition, pTrc99A-M-crt Plastid transformation to be entered colon bacillus ATCC 8739, measure beta-carotene and produce Amount, it is 2 times of QL002.As can be seen here, single copy crt gene integration engineering bacteria on chromosome produces beta-carotene The effect of energy force rate plasmid high expressed to be got well.

Gene expression on colon bacillus chromosome is adjusted by case study on implementation 10, use artificial regulatory element library Control

Set up artificial regulatory element library and the dxs gene on colon bacillus chromosome is carried out expression regulation, thus Improve the yield (Figure 21) of beta-carotene.

First eliminate the card in crt-M1-93-FKF and receive mycin resistant gene, by plasmid pFT-Amp by calcium method for transformation Convert crt-M1-93-FKF, conversional solution is applied on the LB flat board containing ampicillin, 30 DEG C of incubated overnight, chooses 3 bacterium colonies and connect Planting in 10ml contains the LB fluid medium of ampicillin, 30 DEG C, 220rmp cultivates to about OD600=0.1, adds chlorotetracyclin Element induction 6h, in the flat lining out of LB, 39 DEG C of incubated overnight.Choose single bacterium colony respectively at LB, the LB of band ampicillin, band Ka Na The flat lining out of LB of mycin, verifies whether that eliminating card receives mycin resistant gene and pFT-Amp plasmid.Only raw on LB flat board Long, the LB of band ampicillin, band card receive mycin LB flat board on the bacterium colony that can not grow be the correct card that eliminates and receive mycin The bacterial strain of resistant gene.The correct bacterial strain of picking, named crt-M1-93-FRT.

With dxs-up480F/dxs-RBSL-down as primer, carry out with the genomic DNA of dxs-M1-93-FRT for template PCR, obtains the DNA fragmentation dxs-R-Lib1 for homologous recombination, and this fragment includes dxs upstream region of gene 480bp homology arm, M1- 93 artificial regulatory elements and variable RBS district (Figure 21).Primer sequence is:

Dxs-up480F:AGTGGTATTGCCGGAATG

Dxs-RBSL-down:GTGGAGTCGACCAGTGCCAGGGTCGGGTATTTGGCAATATCA AAACTCATNNNNN NYCTCCTGGTTTAAACGTACATG

Dxs-R-Lib1 is inserted in before dxs gene by the method using a step homologous recombination, the expression of regulation and control dxs gene. The PCR amplification of dxs-R-Lib1 and a step methods of homologous recombination see case study on implementation 7, are converted extremely by dxs-R-Lib1 fragment electricity Crt-M1-93-FRT, 30 DEG C, 75rmp cultivate 2h, take 200ul and be applied to the LB plate containing kanamycin, 39 DEG C of incubated overnight because Dxs-M1-93-FRT contains crtEXYIB gene and M1-93 artificial regulatory element, can produce beta-carotene, so bacterium colony face Color is yellow.After inserting dxs-R-Lib1 before dxs gene, the artificial regulatory element that intensity is high will make dxs gene expression higher, Making bacterial strain produce beta-carotene more, bacterium colony is more yellow.From building the bacterial strain that dxs controlling element storehouse, picking 17 strain color is deeper, Cultivating in the LB fluid medium containing kanamycin, measure content beta-carotene, result is shown in Figure 22.dxs-8、dxs-15、 The content beta-carotene of dxs-16 these three recon is the highest, the 1.7 of respectively crt-M1-93-FRT, 1.7,1.8 times.

It addition, also the original regulation and control region of the dxs of crt-M1-93-FRT is replaced with M1-37, obtain bacterial strain dxs-M1- 37-FKF2, its content beta-carotene is 1.6 times of crt-M1-93-FRT.Therefore, dxs is regulated and controled by artificial element library The effect of the artificial regulatory element regulation and control dxs gene expression of gene expression ratio certain strength is more preferable.

Claims (4)

1. utilization has a method for Gene expression intensities on the artificial regulatory element regulating and controlling microbial chromosome of certain strength, Comprise the following steps:

The original regulation and control region treating controlling gene on microbial chromosomal is replaced with artificial regulatory element；

Treat on described microbial chromosomal that controlling gene is the endogenous gene on microbial chromosomal and is incorporated into microbial staining Exogenous gene on body；

Described artificial regulatory element is one section of DNA sequence containing particular bases, and it has specific expression intensity, including starting Sub-upstream, promoter, messenger RNA stable region and ribosome binding site；

The sequence of described artificial regulatory element is the sequence 15 in sequence table；

Described microorganism is colon bacillus.

Method the most according to claim 1, it is characterised in that:

Described being replaced with in the original regulation and control region treating controlling gene on microbial chromosomal has the artificial of particular expression intensity Controlling element, comprises the following steps:

Amplifying section of DNA fragment by the method for PCR, it includes waiting on microbial chromosomal as left homology arm One section of gene original regulation and control region upstream sequence homology containing the fragment of 40-3000 base, resistant maker gene, one have The artificial regulatory element of particular expression intensity, treat controlling gene start codon as right homology arm on microbial chromosomal One section of the downstream sequence homology fragment containing 40-3000 base；The method using a step homologous recombination, by microbial chromosomal On treat that the original regulation and control region of controlling gene replaces with resistant maker gene and have the artificial regulatory element of particular expression intensity；

Described resistant maker gene is that ampicillin resistance gene, card receive mycin resistant gene, chloramphenicol resistance gene, Fourth Ring One or more in element resistant gene, apramycin resistance gene.

Method the most according to claim 1, it is characterised in that:

Described being replaced with in the original regulation and control region treating controlling gene on microbial chromosomal has the artificial of particular expression intensity Controlling element, comprises the following steps:

The method using two step homologous recombination, replaces with the original regulation and control region treating controlling gene on microbial chromosomal and has The artificial regulatory element of particular expression intensity: the method first passing through PCR amplifies first paragraph DNA fragmentation, and it includes as a left side Homology arm treat one section of controlling gene original regulation and control region upstream sequence homology containing 40-3000 alkali on microbial chromosomal The fragment of base, resistant maker gene, levan sucrose transferase gene, wait to adjust on microbial chromosomal as right homology arm One section of fragment containing 40-3000 base of control gene start codon downstream sequence homology；Carry out first step homologous recombination, will Treat on microbial chromosomal that the original regulation and control region of controlling gene replaces with resistant maker gene and levan sucrose transferring enzyme base Cause；Amplifying second segment DNA fragmentation by the method for PCR, it includes waiting to adjust on microbial chromosomal as left homology arm One section of control gene original regulation and control region upstream sequence homology containing the fragment of 40-3000 base, one to have particular expression strong Degree artificial regulatory element, as right homology arm with microbial chromosomal on treat controlling gene start codon downstream sequence with One section of the source fragment containing 40-3000 base；Carry out second step homologous recombination, resistant maker gene and levan sucrose are turned Move enzyme gene and replace with the artificial regulatory element with particular expression intensity；

Described resistant maker gene is that ampicillin resistance gene, card receive mycin resistant gene, chloramphenicol resistance gene, Fourth Ring One or more in element resistant gene, apramycin resistance gene.

The most according to the method in any one of claims 1 to 3, it is characterised in that:

1-deoxidation-xylulose 5-phosphate synzyme base that controlling gene is colon bacillus is treated on described microbial chromosomal Cause, 1-deoxidation-xylulose 5-phosphate reduction isomerase gene, 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol synzyme base Cause, 4-cytidine diphosphate (CDP) 2-C-methyl D erythritol kinase gene, (E)-4-hydroxy-3-methyl-crotyl-pyrophosphoric acid close Become enzyme gene, (E)-4-hydroxy-3-methyl-crotyl-pyrophosphoric acid reductase gene, isovaleryl pyrophosphoric acid isomerase gene, Method Buddhist nun's diphosphate synthase gene；The yak base yak base diphosphate synthase gene of pantoea agglomerans, beta-carotene are cyclized Enzyme gene, lycopene beta cyclase gene, phytoene desaturase gene, phytoene synthase gene.