CN103667163A

CN103667163A - Recombinant microorganism for producing isobutanol and method thereof

Info

Publication number: CN103667163A
Application number: CN201210322624.6A
Authority: CN
Inventors: 张学礼; 石爱琴; 朱欣娜; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2012-09-04
Filing date: 2012-09-04
Publication date: 2014-03-26
Anticipated expiration: 2032-09-04
Also published as: CN103667163B

Abstract

The invention provides recombinant microorganism for producing isobutanol and an application thereof in production of isobutanol, wherein pyridine nucleotide transhydrogenase and nicotinamide adenine dinucleotide (NAD) kinase in the recombinant escherichia coli are activated at the same time.

Description

Produce recombinant microorganism and the method for isopropylcarbinol

Technical field

The present invention relates to produce the recombinant microorganism of isopropylcarbinol, specifically recombination bacillus coli, and the methods and applications that use described recombination bacillus coli production isopropylcarbinol.

Background technology

The transport fuel in the whole world is mainly gasoline and the diesel oil refining from oil at present.Yet oil is a kind of non-renewable resource, existing Global Oil deposit is estimated to maintain 30 to 50 years again.Along with the minimizing gradually of Global Oil deposit, oil price rapidly increased in recent years, directly caused global energy nervous.In addition, a large amount of uses of oil have caused a large amount of discharges of greenhouse gases, make global warming, cause very serious ecocrisis.

Biomass are a kind of reproducible clean resources.By bio-manufacturing method, biomass can be converted into the reproducible replacement energy (Werpy et al., 2004; Perlack et al., 2005).In recent decades, the research and development of bioenergy mainly concentrate on ethanol, butanols, biogas, hydrogen, biofuel (Ingram et al., 1999; Lee et al., 2008; Vasudevan and Briggs, 2008) etc.Wherein, ethanol is considered to the most possible renewable energy source that replaces gasoline transport fuel at present.Brazil just greatly develops alcohol biological manufacturing technology from last century the seventies, and due to its domestic abundant sugarcane yield, its domestic automobile transport fuel take ethanol as main (Macedo et al., 2008) at present.

Isopropylcarbinol is compared with ethanol, is more suitable for the substitute as gasoline, and reason is: energy density is close to gasoline; Steam forces down, and easily mixes with gasoline; Compare with ethanol, can mix with gasoline high density, and not need special adaptive device; Can use that existing petroleum pipe line transports etc. (Connor and Liao, 2009).In addition, isopropylcarbinol also has a lot of purposes in Chemical market, mainly for the production of double solventss such as lubricating oil additive, topcoating, tackiness agents, the while can also be for the production of phthalic ester plasticizer (Connor and Liao, 2009) at present.The annual market requirement of isopropylcarbinol has 500,000 tons of left and right at present.

Some natural microbial can be produced isopropylcarbinol, but its output very low (Chen et al., 2011).Dupont company has carried out the research (PCT/US2006/041602) that builds recombination bacillus coli production isopropylcarbinol the earliest.Subsequently, the James of Univ California-Los Angeles USA Liao seminar and U.S. Gevo company have also carried out relevant research (Atsumi et al.2008; Atsumi et al., 2009; Baez et al., 2011; PCT/US2008/053514; PCT/US2008/082159).By introduce keto acid decarboxylase and the alcoholdehydrogenase of external source in intestinal bacteria, the intermediate 2-ketone group isovaleric acid of amino acid metabolism can be converted into isopropylcarbinol (Fig. 1).Liao seminar produces isopropylcarbinol by the keto acid decarboxylase gene (KivD) of mistake expression Lactococcus lactis (Lactococcus lactis) and the alcohol dehydrogenase gene (adh) of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) in intestinal bacteria; Cross the acetolactate synthase gene (alsS) of expression genus bacillus (Bacillus subtilis), the Acetohydroxy acid isomeroreductase gene (ilvC) of intestinal bacteria self and dihydroxy-acid dehydratase gene (ilvD) can improve the output of isopropylcarbinol; Knock out the output that alcohol dehydrogenase gene (adhE), lactate dehydrogenase gene (ldhA), fumaric reductase gene (frd), transcriptional regulator (fnr), phosphate acetyltransferase gene (pta) and pyruvate formate-lyase gene (pflB) can further improve isopropylcarbinol.The final recombination bacillus coli building is used rich medium in 24 hours, can produce the isopropylcarbinol (Smithet al., 2011) of 7.7g/L.Current, this area also needs to produce with high yield the recombinant microorganism of isopropylcarbinol.

Summary of the invention

The inventor finds to strengthen pyridine nucleotide transhydrogenase and the NAD kinases in intestinal bacteria simultaneously, can improve output and transformation efficiency that intestinal bacteria produce isopropylcarbinol.

In one aspect, the invention provides a kind of recombination bacillus coli for the production of isopropylcarbinol, it comprises 2-keto acid decarboxylase, alcoholdehydrogenase, acetolactate synthestase, Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase, it is characterized in that in described intestinal bacteria, the activity of pyridine nucleotide transhydrogenase and Nicotinamide Adenine Dinucleotide Kinase is enhanced simultaneously, and the activity that optionally, is selected from 1,2,3,4 or 5 kind of enzyme in described 2-keto acid decarboxylase, alcoholdehydrogenase, acetolactate synthestase, Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase is enhanced.

Do not wish to be subject to any theory constraint, NADPH (NADPH) is the crucial cofactor in isopropylcarbinol route of synthesis, and the source of NADPH has three kinds: phosphopentose pathway, tricarboxylic acid cycle and pyridine nucleotide transhydrogenase.Under aerobic condition, the NADPH of the needed 35-45% of intestinal bacteria biosynthesizing derives from phosphopentose pathway, the NADPH of 20-25% derives from the isocitric enzyme that participates in tricarboxylic acid cycle (TCA circulation), the NADPH of other 35%-45% derives from pyridine nucleotide transhydrogenase (Sauer et al., 2004).Phosphopentose pathway and tricarboxylic acid cycle under anaerobic normally do not have activated (Bastian et al., 2011), and therefore the pyridine nucleotide transhydrogenase that only has of NADPH can be provided.The reducing power type major part that under anaerobic condition, cell produces is NADH.For High-efficient Production isopropylcarbinol, must solve the problem of cofactor imbalance (cofactor imbalance).Pyridine nucleotide transhydrogenase has two types: a kind of is embrane-associated protein PntAB, and it can be reduced to NADPH by NADP+ in proton is proceeded to the process in born of the same parents, also NADH is oxidized to NAD+ simultaneously; Another kind is soluble proteins UdhA, and its function is mainly that too much NADPH is converted into NADH.For pyridine nucleotide transhydrogenase can be worked constantly, NAD+ need to be converted into NADP+ again.NAD kinases is the enzyme in the interior unique production NADP storehouse of cell, and (Shi et al., 2009 play an important role in the reducing power balance in maintaining born of the same parents; Kawai et al., 2001).

In this article, the activity of enzyme " enhancing " refers in the born of the same parents that improve in microorganism by one or more enzyme of corresponding DNA encoding active, enhanced activity can realize by any appropriate method known in the art, for example cross expression, include but not limited to improve described gene or allelic copy number, modify the nucleotide sequence that guidance or controlling gene are expressed, use strong promoter or use coding to there is gene or the allelotrope of the corresponding enzyme of high reactivity, and optionally combine these measures.By enhancement measures, the activity of respective egg white matter or concentration generally improve at least 10%, 20,30% compared with beginning microorganism level, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400% or 500%, or until 1000%, 2000%, 3000%, 4000%, 10000% or 20000%.

Cross to express and typically refer to intracellular concentration or active the increasing of comparing Yeast Nucleic Acid, protein (polypeptide) or enzyme with initial strain (parental strain) or wild type strain (if it is initial strain).Initial strain (parental strain) refers to it was caused expressing the bacterial strain of processing.

Copy number can increase by the plasmid copying in the kytoplasm of microorganism.Up to now, prior art has been described a large amount of plasmids for different microorganisms, and described plasmid can be used for setting the increasing amount of the hope of gene copy number.Be suitable for the plasmid of Escherichia at for example Molecular Biology, in Labfax (Ed.:T.A.Brown, Bios Scientific, Oxford, UK, 1991), describe.Copy number also can increase by extra one or more copy of required gene being integrated in the karyomit(e) of microorganism.

Genetic expression can be further by being used strong promoter to increase, and described promotor is connected with the gene function being expressed.Preferably use the promotor stronger than natural promoter, described natural promoter is the promotor being present in wild-type or parental strain.Up to now, this area has many available methods.The known promotor that is suitable for Escherichia for a long time.It comprises the P of traditional promotor lac promotor, trp promotor, hybrid promotor tac and trc, phageλ _land P _rpromotor.Also a plurality of promotors can be placed on hope gene upstream or be connected with the gene function being expressed, with this, realize and express increasing.

Cross and express also and can realize by the expression that increases expression or the reduction of activator albumen or close repressor albumen.

Mentioned expression measure excessively can be combined in a suitable manner mutually.Therefore, can for example be used in combination suitable promotor and increase copy number.About the manipulation of DNA, the conversion of the digestion of DNA and connection, transformant and the guidance of selection are found in the handbook " Molecular Cloning:A Laboratory Manual " that known Sambrook etc. writes, Second Edition (Cold Spring Harbor Laboratory Press, 1989).Express or cross the degree of expressing and can pass through measurement from the amount of the mRNA of gene transcription, by determining the amount of polypeptide and determining by definite enzymic activity.

In one embodiment, encode in the recombination bacillus coli of the present invention gene of described 2-keto acid decarboxylase and acetolactate synthestase is external source for described recombination bacillus coli.Described external source 2-keto acid decarboxylase gene and acetolactate synthase gene can be the corresponding gene from any microorganism such as galactococcus, genus bacillus etc.In one embodiment, described 2-keto acid decarboxylase is selected from Lactococcus lactis 2-keto acid decarboxylase, Salmonella typhimurium 2-keto acid decarboxylase and acetobutyric acid clostridium 2-keto acid decarboxylase, preferably Lactococcus lactis 2-keto acid decarboxylase.In one embodiment, described acetolactate synthestase is selected from subtilis acetolactate synthestase, Klebsiella pneumonia acetolactate synthestase and Lactococcus lactis acetolactate synthestase, preferably subtilis acetolactate synthestase.In further embodiment, described in recombination bacillus coli of the present invention, the activity of 2-keto acid decarboxylase and acetolactate synthestase one or both of is enhanced.

In one embodiment, in recombination bacillus coli of the present invention, can there is external source alcoholdehydrogenase encoding gene, for example the alcoholdehydrogenase encoding gene of Lactococcus lactis (for example adhA).

Described external source 2-keto acid decarboxylase gene, alcohol dehydrogenase gene and/or acetolactate synthase gene can any suitable method known in the art be for example present in described intestinal bacteria with plasmid form or the form that is integrated in genome.In one embodiment, described exogenous origin gene integrator enters in the genome of described recombination bacillus coli.In an example, described external source 2-keto acid decarboxylase gene (for example kivD) is integrated into the pyruvate formate-lyase encoding gene pflB site of described escherichia coli chromosome.In an example, described external source alcohol dehydrogenase gene is integrated into the fumaric reductase encoding gene frd site of described escherichia coli chromosome.In an example, described external source acetolactate synthase gene (for example alsS) is integrated into propionate kinase encoding gene tdcD site and the lactic dehydrogenase enzyme coding gene ldhA site of described escherichia coli chromosome.

" integration " of the present invention can realize by any method known in the art.For example, in one embodiment, enzyme coding gene is passed through to homologous recombination method (Court et al., 2002; Thomason et al., 2003) be integrated in colibacillary genome.In one embodiment, described in, be integrated into enzyme coding gene in genome and be placed in suitable promotor for example under the control of above-mentioned strong promoter.

In further embodiment, described foreign gene can be placed under suitable promotor control, for example any promotor being applicable at expression in escherichia coli.In one embodiment, described promotor is the promotor with sequence shown in SEQ ID NO:1,2,3,4,5 or 75.For example, described 2-keto acid decarboxylase encoding gene is placed under the promotor control shown in SEQID NO:1, alcoholdehydrogenase encoding gene is placed under the promotor control shown in SEQ ID NO:75 and/or by acetolactate synthestase encoding gene and is placed under the promotor control shown in SEQ ID NO:1 or 5.

In one embodiment, in recombination bacillus coli of the present invention, the activity of Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase is also enhanced.

In one embodiment, the increased activity of enzyme of the present invention is expressed enzyme coding gene realization by mistake.In one embodiment, described cross to express can be by increasing gene copy number, using the realizations such as strong promoter, for example, the coding gene sequence of described enzyme be placed under the control of strong promoter and/or increase one or more copy of described enzyme coding gene.In further embodiment, one or more copy and the optional promotor nucleotide sequence existing of described enzyme coding gene are integrated in the genome of described recombination bacillus coli, or the plasmid that comprises described enzyme coding gene is imported in described recombination bacillus coli.

In one embodiment, strong promoter of the present invention is selected from the promotor of SEQ ID NO:1-5 shown in arbitrary.For example, for example,, in recombination bacillus coli of the present invention: (a) Acetohydroxy acid isomeroreductase gene (ilvC) encoding sequence is placed under the control of promotor shown in SEQ ID NO:3; And/or (b) dihydroxy-acid dehydratase gene (for example ilvD) encoding sequence is placed under the control of promotor shown in SEQ ID NO:1; And/or (c) pyridine nucleotide transhydrogenase gene (for example pntAB) encoding sequence is placed under the control of promotor shown in SEQ ID NO:1,3,4 or 5; And/or (d) Nicotinamide Adenine Dinucleotide Kinase gene (for example yfjB) encoding sequence is placed under the control of promotor shown in SEQ ID NO:2,3 or 4.In one embodiment, described pyridine nucleotide transhydrogenase of the present invention is PntAB albumen.

In one embodiment, the invention provides a kind of recombination bacillus coli, it comprises:

(a) Acetohydroxy acid isomeroreductase of increased activity (for example its encoding gene is as ilvC);

(b) dihydroxyacid dehydratase of increased activity (for example its encoding gene is as ilvD);

(c) for example, from the 2-keto acid decarboxylase (its encoding gene is as kivD) of Lactococcus lactis;

(d) for example, from subtilis acetolactate synthestase (its encoding gene is as alsS); And the pyridine nucleotide transhydrogenase encoding gene pntAB gene of described recombination bacillus coli is placed under the promotor control shown in SEQ ID NO:5 and Nicotinamide Adenine Dinucleotide Kinase encoding gene yfjB is placed under the promotor control shown in SEQ ID NO:4.

In the embodiment of, the activity that is selected from one or more following endogenous enzyme in recombination bacillus coli of the present invention is lowered, for example, by inactivation: serum lactic dehydrogenase, pyruvate formate-lyase, fumaric reductase, phosphate acetyltransferase, E.C. 2.7.2.1, ethanol dehydrogenase, propionate kinase, formic acid acetyltransferase and methylglyoxal synthase.

In further embodiment; one or more (for example whole) of gene of endogenous serum lactic dehydrogenase (for example ldhA), pyruvate formate-lyase (for example pflB), fumaric reductase (for example frd), phosphate acetyltransferase (for example pta), E.C. 2.7.2.1 (for example ackA), ethanol dehydrogenase (for example adhE), propionate kinase (for example tdcD), formic acid acetyltransferase (for example tdcE) and/or methylglyoxal synthase (for example mgsA) of encoding in recombination bacillus coli of the present invention are weakened, for example, be knocked.

(a) colibacillary Acetohydroxy acid isomeroreductase encoding gene ilvC, it is integrated into described recombination bacillus coli chromosomal methylglyoxal synthase encoding gene mgsA site and is placed under the control of the promotor shown in SEQ ID NO:3;

(b) colibacillary dihydroxyacid dehydratase encoding gene ilvD, it is integrated into described recombination bacillus coli chromosomal pyruvate formate-lyase encoding gene pflB site and is placed under the control of the promotor shown in SEQ ID NO:1;

(c) the 2-keto acid decarboxylase encoding gene kivD of Lactococcus lactis, it is integrated into described recombination bacillus coli chromosomal pyruvate formate-lyase encoding gene pflB site and is placed under the promotor control shown in SEQ ID NO:1;

(d) the alcoholdehydrogenase encoding gene adhA of Lactococcus lactis, it is integrated into described recombination bacillus coli chromosomal fumaric reductase encoding gene frd site and is placed under the promotor control shown in SEQ ID NO:75;

(e) the acetolactate synthestase encoding gene alsS of subtilis, it is incorporated into respectively described recombination bacillus coli chromosomal propionate kinase encoding gene tdcD site and lactic dehydrogenase enzyme coding gene ldhA site (the acetolactate synthestase encoding gene alsS of a copy is integrated into tdcD site, and the acetolactate synthestase encoding gene alsS of a copy is integrated into ldhA site) simultaneously and is placed in respectively under the promotor control shown in SEQ ID NO:1 and 5;

And the original promotor of the pyridine nucleotide transhydrogenase encoding gene pntAB gene of described recombination bacillus coli is replaced by the promotor shown in SEQ ID NO:1,3,4 or 5; And the original promotor of Nicotinamide Adenine Dinucleotide Kinase encoding gene yfjB gene is replaced by the promotor shown in SEQ ID NO:2,3 or 4; And

The methylglyoxal synthase encoding gene mgsA of described recombination bacillus coli, pyruvate formate-lyase encoding gene pflB, fumaric reductase encoding gene frd, propionate kinase encoding gene tdcD, formate acetyltransferase encoding gene tdcE, lactic dehydrogenase enzyme coding gene ldhA, phosphate acetyltransferase encoding gene pta, E.C. 2.7.2.1 encoding gene ackA and alcohol dehydrogenase enzyme coding gene adhE are knocked.

In yet another aspect, the invention provides the application of recombination bacillus coli of the present invention in producing isopropylcarbinol.

In yet another aspect, the invention provides the method for using recombination bacillus coli of the present invention to produce isopropylcarbinol, described method comprises: fermentation culture recombination bacillus coli of the present invention, separation is also gathered in the crops isopropylcarbinol.

The condition that recombination bacillus coli produces isopropylcarbinol is any cultivation intestinal bacteria well known by persons skilled in the art and produces the required fermentation condition of isopropylcarbinol.Fermentation of the present invention can be anaerobically fermenting or aerobic fermentation.

Described fermentation can for example be carried out under aerobic conditions in air.In order to keep these conditions, oxygen or containing oxygen gas mixture for example air can be filled with culture.

Described fermentation can for example be carried out under anaerobic or micro-oxygen condition in anaerobism, for example, by passing into nitrogen or other suitable gas carries out.In one embodiment, anaerobic of the present invention or micro-aerobe fermentation are used anaerobism bottle to carry out.

In one embodiment, the air air flow of described aerobic fermentation is 0.1-3.0L/minL, for example 0.1L/minL, 0.2L/minL, 0.3L/minL, 0.4L/minL, 0.5L/minL, 0.6L/minL, 0.7L/minL, 0.8L/minL, 0.9L/minL, 1.0L/minL, 1.5L/minL, 2.0L/minL, 2.5L/minL or 3.0L/minL.

Described colibacillary leavening temperature can be any suitable temp known in the art.In one embodiment, described colibacillary fermentation is at 25 ℃-39 ℃, for example, carry out at 25 ℃, 30 ℃, 37 ℃ or 39 ℃.

In order to regulate the pH value of substratum or culture, can add in a suitable manner basic cpd as NaOH, KOH, ammonia or ammoniacal liquor, or acidic cpd is as phosphoric acid or sulfuric acid.In one embodiment, for the pH value of described colibacillary fermentation system, be 6.0-8.0, for example 6.0,6.5,7.0,7.5 or 8.0.

In one embodiment, described colibacillary fermentation time is 24 hours-144 hours, for example 24 hours, 48 hours, 72 hours, 96 hours, 120 hours or 144 hours.

Recombination bacillus coli of the present invention can also carry out Fermentive production of isobutanol with simple minimal medium, thereby reduces production costs and downstream separation extraction cost.In one embodiment, for colibacillary substratum of the present invention, can be any applicable substratum known in the art.In one embodiment, described substratum is the substratum being grouped into by water-soluble following one-tenth: glucose, KH ₂pO ₄, K ₂hPO ₄, (NH ₄) ₂hPO ₄, MgSO ₄7H ₂o and CaCl ₂2H ₂o; FeCl ₃6H ₂o, CoCl ₂6H ₂o, CuCl ₂2H ₂o, ZnCl ₂, Na ₂moO ₄2H ₂o and MnCl ₂4H ₂o.

In one embodiment, the content of described medium component is:

Glucose is 50g/L-150g/L, for example 50g/L, 100g/L or 150g/L;

KH ₂pO ₄for 0.5g/L-5g/L, for example 0.5g/L, 1g/L or 5g/L;

K ₂hPO ₄for 0.5g/L-10g/L, for example 0.5g/L, 1g/L, 5g/L or 10g/L;

(NH ₄) ₂hPO ₄for 1g/L-10g/L, for example 1g/L, 3g/L or 10g/L;

MgSO ₄7H ₂o is 0.1g/L-5g/L, for example 0.1g/L, 1g/L or 5g/L;

CaCl ₂2H ₂o is 0.1g/L-5g/L, for example 0.1g/L, 1g/L or 5g/L;

FeCl ₃6H ₂o is 0.2 μ g/L-5 μ g/L, for example 0.2 μ g/L, 1.5 μ g/L or 5 μ g/L;

CoCl ₂6H ₂o is 0.05 μ g/L-5 μ g/L, for example 0.05 μ g/L, 0.1 μ g/L or 5 μ g/L;

CuCl ₂2H ₂o is 0.05 μ g/L-5 μ g/L, for example 0.05 μ g/L, 0.1 μ g/L or 5 μ g/L;

ZnCl ₂be 0.05 μ g/L-5 μ g/L, for example 0.05 μ g/L, 0.1 μ g/L or 5 μ g/L;

Na ₂moO ₄2H ₂o is 0.05 μ g/L-5 μ g/L, for example 0.05 μ g/L, 0.1 μ g/L or 5 μ g/L; With

MnCl ₂4H ₂o is 0.05 μ g/L-5 μ g/L, for example 0.05 μ g/L, 0.2 μ g/L or 5 μ g/L.

In one embodiment, first the fermentation of recombination bacillus coli of the present invention can cultivate in seed culture medium, then seed stoste is inoculated in fermention medium.The one-tenth of described seed culture medium is grouped into can be identical with fermention medium.In one embodiment, the volume percent of the inoculum size of described seed stoste inoculation fermentation substratum is 0.01%-10%, for example 0.01%, 0.3% or 10%.

The isopropylcarbinol of recombination bacillus coli fermentative production of the present invention can carry out separation and purifying by any method known in the art.For example, referring to (Atsumi et al., 2008; Inokuma et al., 2010; Baez et al., 2011).

In yet another aspect, the invention provides a kind of method for the preparation of producing the recombination bacillus coli of isopropylcarbinol, comprise that (a) imports the nucleotide sequence of coding 2-keto acid decarboxylase and acetolactate synthestase in the intestinal bacteria that comprise alcoholdehydrogenase, Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase, and (b) strengthen the activity of pyridine nucleotide transhydrogenase PntAB and Nicotinamide Adenine Dinucleotide Kinase in these intestinal bacteria simultaneously.

In one embodiment, the original promotor of the original promotor of pyridine nucleotide transhydrogenase PntAB encoding gene of the present invention and/or Nicotinamide Adenine Dinucleotide Kinase encoding gene (for example yfjB) is replaced by the promotor shown in SEQ ID NO:1,2,3,4 or 5.In one embodiment, the original promotor of described pyridine nucleotide transhydrogenase PntAB encoding gene is replaced by the promotor shown in SEQ ID NO:1,3,4 or 5.In one embodiment, the original promotor of Nicotinamide Adenine Dinucleotide Kinase encoding gene of the present invention is replaced by the promotor shown in SEQ IDNO:2,3 or 4.Described replacement can be undertaken by homologous recombination.

In one embodiment, described 2-keto acid decarboxylase is selected from Lactococcus lactis 2-keto acid decarboxylase, Salmonella typhimurium 2-keto acid decarboxylase and acetobutyric acid clostridium 2-keto acid decarboxylase, preferably Lactococcus lactis 2-keto acid decarboxylase.

In one embodiment, described acetolactate synthestase is selected from subtilis acetolactate synthestase, Klebsiella pneumonia acetolactate synthestase and Lactococcus lactis acetolactate synthestase, preferably subtilis acetolactate synthestase.

In one embodiment, described method comprises the activity that strengthens Acetohydroxy acid isomeroreductase and/or dihydroxyacid dehydratase.In one embodiment, the increased activity of described enzyme is expressed enzyme coding gene realization by mistake.

In one embodiment, the gene coded sequence of described enzyme is placed under the control of strong promoter and/or increase described enzyme coding gene one or more copy to carry out expression.In one embodiment, one or more copy of described enzyme coding gene and the optional promotor nucleotide sequence existing are integrated in the genome of described recombination bacillus coli, or the plasmid that comprises described enzyme coding gene is imported in described recombination bacillus coli.

In one embodiment, described strong promoter is selected from the promotor of SEQ ID NO:1-5 shown in arbitrary.

In one embodiment, the invention provides a kind of method for the preparation of producing the recombination bacillus coli of isopropylcarbinol, comprise: (a) nucleotide sequence of the Lactococcus lactis 2-keto acid decarboxylase of encoding (for example kivD gene coded sequence) and subtilis acetolactate synthestase (for example alsS gene coded sequence) is imported and comprises alcoholdehydrogenase, in the intestinal bacteria of Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase, (b) nucleotide sequence of the coding intestinal bacteria Acetohydroxy acid isomeroreductase of additional copy (for example ilvC gene coded sequence) and dihydroxyacid dehydratase (for example ilvD gene coded sequence) is imported in these intestinal bacteria, (c) promotor of pyridine nucleotide transhydrogenase encoding gene pntAB in these intestinal bacteria and Nicotinamide Adenine Dinucleotide Kinase encoding gene is replaced into respectively to the promotor shown in SEQ ID NO:5 and 4.In one embodiment, described method comprise by encoding exogenous alcoholdehydrogenase for example the gene order of Lactococcus lactis alcoholdehydrogenase (for example adhA) import in above-mentioned intestinal bacteria.

In one embodiment, described method comprises the activity that is selected from one or more following endogenous enzyme described in reduction, for example inactivation in intestinal bacteria: (i) serum lactic dehydrogenase; (ii) pyruvate formate-lyase; (iii) fumaric reductase; (iv) phosphate acetyltransferase; (v) E.C. 2.7.2.1; (vi) ethanol dehydrogenase; (vii) propionate kinase; (viii) formate acetyltransferase; (ix) methylglyoxal synthase.

In one embodiment, described method comprises and knocks out the encoding gene that is selected from one or more following endogenous enzyme in described intestinal bacteria: (i) serum lactic dehydrogenase (for example ldhA); (ii) pyruvate formate-lyase (for example pflB); (iii) fumaric reductase (for example frd); (iv) phosphate acetyltransferase (for example pta); (v) E.C. 2.7.2.1 (for example ackA); (vi) ethanol dehydrogenase (for example adhE); (vii) propionate kinase (for example tdcD); (viii) formate acetyltransferase (for example tdcE); (ix) methylglyoxal synthase (for example mgsA).

In one embodiment, the invention provides a kind of method for the preparation of producing the recombination bacillus coli of isopropylcarbinol, comprising: (a) colibacillary Acetohydroxy acid isomeroreductase encoding gene ilvC be incorporated into described recombination bacillus coli chromosomal methylglyoxal synthase encoding gene mgsA site and be placed under the control of the promotor shown in SEQ ID NO:3; (b) colibacillary dihydroxyacid dehydratase encoding gene ilvD be incorporated into described recombination bacillus coli chromosomal pyruvate formate-lyase encoding gene pflB site and be placed under the control of the promotor shown in SEQ ID NO:1; (c) the 2-keto acid decarboxylase encoding gene kivD of Lactococcus lactis be incorporated into described recombination bacillus coli chromosomal pyruvate formate-lyase encoding gene pflB site and be placed under the promotor control shown in SEQ IDNO:1; (d) the alcoholdehydrogenase encoding gene adhA of Lactococcus lactis be incorporated into described recombination bacillus coli chromosomal fumaric reductase encoding gene frd site and be placed under the promotor control shown in SEQ ID NO:75; (e) (the acetolactate synthestase encoding gene alsS of a copy is integrated into tdcD site the acetolactate synthestase encoding gene alsS of subtilis to be incorporated into respectively to described recombination bacillus coli chromosomal propionate kinase encoding gene tdcD site and lactic dehydrogenase enzyme coding gene ldhA site, the acetolactate synthestase encoding gene alsS of a copy is integrated into ldhA site simultaneously), and be placed in respectively under the promotor control shown in SEQ ID NO:1 and 5; And the original promotor of the pyridine nucleotide transhydrogenase encoding gene pntAB gene of described recombination bacillus coli is replaced with to the promotor shown in SEQID NO:1,3,4 or 5 and the original promotor of Nicotinamide Adenine Dinucleotide Kinase encoding gene yfjB is replaced with to the promotor shown in SEQ ID NO:2,3 or 4; And methylglyoxal synthase encoding gene mgsA, the pyruvate formate-lyase encoding gene pflB, fumaric reductase encoding gene frd, propionate kinase encoding gene tdcD, formate acetyltransferase encoding gene tdcE, lactic dehydrogenase enzyme coding gene ldhA, phosphate acetyltransferase encoding gene pta, E.C. 2.7.2.1 encoding gene ackA and the alcohol dehydrogenase enzyme coding gene adhE that knock out recombination bacillus coli.

The keto acid decarboxylase of 2-described in the present invention refers to that catalysis alpha-ketoisocaproic acid changes isobutyric aldehyde and CO into ₂enzyme.The EC numbering of preferred 2-keto acid decarboxylase is 4.1.1.72 (Enzyme Nomenclature 1992, Academic Press, San Diego), can derive from many sources, include but not limited to Lactococcus lactis (GenBank No:AAS49166, AY548760), Salmonella typhimurium (GenBank No:NP_461346) and acetobutyric acid clostridium (GenBank No:NP_149189, NCJD01988).

Alcoholdehydrogenase described in the present invention refers to that catalysis aldehyde changes the enzyme of alcohol into.In one embodiment of the invention, described alcoholdehydrogenase refers to that catalyzing iso-butane aldehyde changes the enzyme of isopropylcarbinol into.The EC numbering of the preferred alcoholdehydrogenase of the present invention is 1.1.1.265 (Enzyme Nomenclature 1992, Academic Press, San Diego), can be still also the alcoholdehydrogenase (especially as EC 1.1.1.1 or 1.1.1.2) that is categorized as other.

Acetolactate synthestase described in the present invention refers to and can change acetylactis and CO into by catalysis pyruvic acid ₂enzyme.The EC of preferred acetolactate synthestase is numbered 2.2.1.69 (Enzyme Nomenclature 1992, Academic Press, San Diego).These enzymes can derive from multiple source, include but not limited to subtilis (GenBank No:CAB15618, Z99122), Klebsiella pneumonia (GenBank No:AAA25079, M73842) and Lactococcus lactis (GenBankNo:AAA25161, L16975).

Acetohydroxy acid isomeroreductase described in the present invention refers to can be by using NADPH to change the enzyme of 2,3-dihydroxyl isovaleric acid into as electron donor catalysis acetylactis.The EC numbering of preferred Acetohydroxy acid isomeroreductase is 1.1.1.86 (Enzyme Nomenclature 1992, Academic Press, San Diego), it can derive from a large amount of microorganisms, include but not limited to intestinal bacteria (GenBank No:NP_418222, NC_000913), yeast saccharomyces cerevisiae (GenBank No:NP_013459, NC_001144), Methanococcus maripaludis (GenBank No:CAF30210, BX957220) and subtilis (GenBank No:CAB 14789, Z99118).

Dihydroxyacid dehydratase described in the present invention refers to catalysis 2, and 3-dihydroxyl isovaleric acid changes the enzyme of alpha-ketoisocaproic acid into.The EC of preferred dihydroxyacid dehydratase is numbered 4.2.1.9 (Enzyme Nomenclature 1992, Academic Press, San Diego).This kind of enzyme can derive from a large amount of microorganisms, include but not limited to intestinal bacteria (GenBank No:YP_026248, NC_000913), yeast saccharomyces cerevisiae (GenBank No:NP_012550, NC_001142), M.maripaludis (GenBank No:CAF29874, BX957219) and subtilis (GenBank No:CAB14105, Z99115).

Pyridine nucleotide transhydrogenase described in the present invention refers to conversion mutually between catalyzing N ADH and NAD+, realizes the enzyme of mutually changing between NADP+ and NADPH simultaneously, in the time of reaction, proton is pumped in born of the same parents from born of the same parents.The EC of preferred pyridine nucleotide transhydrogenase is numbered 1.6.1.2 (Enzyme Nomenclature 1992, Academic Press, San Diego).This kind of enzyme can derive from large number of biological, includes but not limited to intestinal bacteria (GenBank No:NC_000913.2), Rhodospirillum rubrum (GenBank No:NC_017584.1), Entamoeba histolytica (GenBank No:NW_001914887.1) and Caenorhabditis elegans (GenBank No:Chromosome:X; NC_003284.8).

Nicotinamide Adenine Dinucleotide Kinase described in the present invention refers to and NAD+ phosphoric acid can be turned to the enzyme of NADP+.The EC of preferred Nicotinamide Adenine Dinucleotide Kinase is numbered 2.7.1.23 (Enzyme Nomenclature 1992, Academic Press, San Diego).This kind of enzyme can derive from a large amount of microorganisms, includes but not limited to intestinal bacteria (GenBank No:NC_000913.2), yeast saccharomyces cerevisiae (GenBank No:Chromosome:V; NC_001137.3), Methanocaldococcus jannaschii (GenBank No:NC_000909.1) and subtilis (GenBank No:NC_004350.2).

The nucleotide sequence of enzyme coding of the present invention " gene " can derive from various public publications, patent application, patent, reference, database, for example 2-keto acid decarboxylase encoding gene kivD (GenBank No:AAS49166, AY548760), alcoholdehydrogenase encoding gene adhA (GenBank No:NP_267964.1, NC_002662.1), acetolactate synthestase encoding gene alsS (GenBank No:CAB15618, Z99122), Acetohydroxy acid isomeroreductase encoding gene ilvC (GenBank No:NP_418222, NC_000913), dihydroxyacid dehydratase encoding gene ilvD (GenBank No:YP_026248, NC_000913), pyridine nucleotide transhydrogenase encoding gene pntAB (GenBank No:NC_000913.2), Nicotinamide Adenine Dinucleotide Kinase encoding gene yfjB (GenBank No:ACA76736.1), lactic dehydrogenase enzyme coding gene ldhA (GenBank No.:YP_001725238.1, NC_010468.1), pyruvate formate-lyase encoding gene pflB (GenBank No.:ACA78322.1), fumaric reductase encoding gene frd (frdA GenBank No:ACA79460.1, frdB GenBank No:ACA79461.1, frdC GenBank No:ACA79462.1, frdD GenBank No:ACA79463.1), phosphate acetyltransferase encoding gene pta (GenBank No:ACA77021.1), E.C. 2.7.2.1 encoding gene ackA (GenBank No:ACA77022.1), alcohol dehydrogenase enzyme coding gene adhE (GenBank No:ACA78022.1), propionate kinase encoding gene tdcD (GenBank No:ACA76259.1), formic acid acetyltransferase encoding gene tdcE (GenBank No:ACA76260.1), and methylglyoxal synthase encoding gene mgsA (GenBank No:ACA78263.1).

" optionally " of the present invention or " optional existence " refers to and can exist or not exist.For example, described " optionally, be selected from described 2-keto acid decarboxylase, alcoholdehydrogenase, acetolactate synthestase, in Acetohydroxy acid isomeroreductase and

dihydroxyacid dehydratase

1, 2, 3, 4 or the activity of 5 kind of enzyme be enhanced " refer to that intestinal bacteria of the present invention have pyridine nucleotide transhydrogenase and the Nicotinamide Adenine Dinucleotide Kinase of increased activity, and 2-keto acid decarboxylase in this recombination bacillus coli, alcoholdehydrogenase, acetolactate synthestase, in Acetohydroxy acid isomeroreductase and

dihydroxyacid dehydratase

1, 2, 3, 4 or the activity of 5 kind of enzyme also can be enhanced, or can not be enhanced yet.

The gene of " external source " described herein refers in intestinal bacteria it is not the gene existing with native state, and it is introduced in described intestinal bacteria by gene transfer technique.

Term in literary composition " reduction " refers to and reduces or eliminate in microorganism in the born of the same parents by one or more enzyme (protein) of corresponding DNA encoding active, for example use weak promoter, or use coding to there is SA gene or allelotrope, or inactivation corresponding gene or enzyme (protein), and optionally combine these measures.By reduction measure, the activity of respective egg white matter or concentration are generally reduced to the 0-50% of wild-type protein activity or concentration, 0-25%, 0-10% or 0-5%.

The inactivation of described enzyme can be realized by any appropriate method known in the art, such as knocking out encoding gene, transgenation, use inhibitor such as siRNA etc.In one embodiment, the inactivation of described enzyme has knocked out encoding gene by homologous recombination and has realized.

Described recombinant microorganism of the present invention can cultured continuously, described at WO 05/021772; Or discontinuous (batch culture) or fed batch cultivation or the repeated fed-batch culture of in batches cultivating, with the organic compound that produces hope isopropylcarbinol for example.About the description for colibacillary substratum, can see described in the Manual of Methods for General Bacteriology (Washington D.C., USA, 1981) of American Society for Bacteriology.Term " substratum ", " fermention medium " or " seed culture medium " are used interchangeably.

Of the present inventionly strengthen pyridine nucleotide transhydrogenase and the kinase whose recombination bacillus coli isopropylcarbinol of NAD aerobic and output and transformation efficiency anaerobically fermenting all improve simultaneously.In addition, the present invention can be incorporated into the key gene in isopropylcarbinol pathways metabolism in genome of E.coli, and uses composing type controlling element to regulate and control the expression of these genes, thereby can obtain the recombination bacillus coli of inheritance stability.

Accompanying drawing explanation:

Fig. 1: isopropylcarbinol route of synthesis

Fig. 2: the biochemical reaction schematic diagram of pyridine nucleotide transhydrogenase and Nicotinamide Adenine Dinucleotide Kinase catalysis

Fig. 3: the structure schematic diagram of intestinal bacteria ATCC 8739 to recombination bacillus coli AS108

Fig. 4: the structure schematic diagram that knocks out the required plasmid of lactate dehydrogenase gene (ldhA)

Fig. 5: the kinase whose sudden change promotor of the phosphoenolpyruvic acid carboxylation pck of intestinal bacteria XZ-T110 ^*(SEQ IDNO:75), the 2-keto acid decarboxylase gene of Lactococcus lactis and the colibacillary dihydroxy-acid dehydratase gene integration schematic diagram in strain X Z-T010

Fig. 6: the 2-keto acid decarboxylase gene of Lactococcus lactis and the colibacillary dihydroxy-acid dehydratase gene expression regulation schematic diagram in strains A S18

Fig. 7: the schematic diagram of plasmid pXZ112 and pXZ116;

Fig. 8: intestinal bacteria ATCC 8739 and the output and the transformation efficiency that have activated the engineering bacteria production isopropylcarbinol of PntAB and YfjB.

Embodiment

The present invention further illustrates by following embodiment, but any embodiment or its combination not should be understood to the restriction to scope of the present invention or embodiment.Scope of the present invention is limited by appended claims, and in conjunction with the general general knowledge of this specification sheets and this area, those of ordinary skills can clearly understand claims limited range.Under prerequisite without departing from the spirit and scope of the present invention, those skilled in the art can carry out any modification or change to technical scheme of the present invention, and this modification and change are also contained in scope of the present invention.

The experimental technique using in following embodiment if no special instructions, is ordinary method.In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.

The structure of embodiment 1, recombination bacillus coli AS18

The structure of recombination bacillus coli AS18, is divided into following six steps (Fig. 3):

(1) lactate dehydrogenase gene ldhA's knocks out

The method that knocks out employing two step homologous recombination of lactate dehydrogenase gene ldhA (GenBank No:YP_001725238.1, NC_010468.1), altogether following six steps (Fig. 4):

The first step, intestinal bacteria ATCC 8739 (from the ATCC) genomic dna of take is template, use primer XZ-ldhA-up/XZ-ldhA-down, the lactic dehydrogenase enzyme coding gene ldhA of amplification intestinal bacteria ATCC8739 and each 400 left and right bases of upstream and downstream thereof.Primer sequence is:

XZ-ldhA-up：GATAACGGAGATCGGGAATG(SEQ ID NO：7)，

XZ-ldhA-down：CTTTGGCTGTCAGTTCACCA(SEQ ID NO：8)。

Amplification system is: NewEngland Biolabs Phusion 5X damping fluid 10 μ l, dNTP (every kind of each 10mM of dNTP) 1 μ l, DNA profiling 20ng, each 2 μ l of primer (10 μ M), Phusion High-Fidelity archaeal dna polymerase (2.5U/ μ l) 0.5 μ l, distilled water 33.5 μ l, cumulative volume is 50 μ l.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

Amplified production comprises lactate dehydrogenase gene ldhA and each 400 left and right bases of upstream and downstream thereof, and is cloned on pEASY-Blunt cloning vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd).Clone body is: 1 μ l pcr amplification product, 1 μ l pEASY-Blunt cloning vector, mixing, room temperature reaction add after 5 minutes in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) gently, ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted lactate dehydrogenase gene and each 400 left and right bases of upstream and downstream thereof on carrier pEASY-Blunt, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ001 (Fig. 4) obtaining.

Second step, take pXZ001 plasmid DNA as template, uses primer XZ-ldhA-1/XZ-ldhA-2 to amplify section of DNA fragment, and primer sequence is:

XZ-ldhA-1：TCTGGAAAAAGGCGAAACCT(SEQ ID NO：9)，

XZ-ldhA-2：TTTGTGCTATAAACGGCGAGT(SEQ ID NO：10)。

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 60 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 2 minutes (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

Pcr amplification product comprises pEASY-Blunt carrier and each 400 left and right bases of lactic dehydrogenase enzyme coding gene upstream and downstream.

The 3rd step, is connected to the DNA fragmentation that contains chloromycetin gene (cat) and Polylevulosan sucrose transferase gene (sacB) pcr amplification product of second step.The pBM002 plasmid (deriving from Hefei Bai Mai Bioisystech Co., Ltd) of take is template, uses primer cat-sacB-up/down pcr amplification cat-sacB fragment.Primer sequence is:

cat-sacB-up：GGAGAAAATACCGCATCAGG(SEQ ID NO：11)

cat-sacB-down：GCGTTGGCCGATTCATTA(SEQ ID NO：12)。

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Agarose gel electrophoresis reclaims, and obtains the DNA fragmentation (3030bp) that contains chloromycetin gene (cat) and Polylevulosan sucrose transferase gene (sacB).

Linked system is: the second step pcr amplification product of 10ng, and the cat-sacB DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (cat-sacB DNA fragmentation is cloned into the plasmid in pXZ001) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proof plasmid construction is correct, by the recombinant plasmid called after pXZ002 (Fig. 4) obtaining.

The 4th step, take pXZ002 plasmid DNA as template, uses primer XZ-ldhA-up/XZ-ldhA-down to amplify DNA fragmentation I.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 40 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

DNA fragmentation I comprises 400 of lactic dehydrogenase enzyme coding gene ldhA upstreams left and right base, cat-sacB DNA fragmentation, 400, lactic dehydrogenase enzyme coding gene ldhA downstream left and right base.

DNA fragmentation I is used for to homologous recombination for the first time.First pKD46 plasmid (Datsenko and Wanner, 2000) is converted into intestinal bacteria ATCC8739 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation I electricity is gone to the intestinal bacteria ATCC8739 with pKD46.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the intestinal bacteria ATCC8739 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-ldhA-up/XZ-ldhA-down to verify, the fragment that correct bacterium colony amplified production is 3859bp).Select a correct single bacterium colony, by its called after XZ-T001.

The 5th step, the DNA cloning fragment of the pXZ001 plasmid that second step is obtained is carried out phosphatizing treatment, certainly the plasmid of getting continuously for homologous recombination for the second time.

Concrete steps are as follows: first the pcr amplification product of second step is cleaned to (Gel/PCR Extration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, the pcr amplification product of the above-mentioned second step of sequencing result has carried out certainly connecting, and proves that plasmid construction is correct, obtains plasmid pXZ003 (Fig. 4).

The 6th step, take pXZ003 plasmid DNA as template, with primer XZ-ldhA-up/XZ-ldhA-down, amplifies DNA fragmentation II.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 15 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

DNA fragmentation II is used for homologous recombination for the second time.First pKD46 plasmid is converted into XZ-T001 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation II electricity is gone to the XZ-T001 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower etal., 1988) with the XZ-T001 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer XZ-ldhA-up/XZ-ldhA-down to verify, the fragment that correct bacterium colony amplified production is 763bp), select a correct single bacterium colony, by its called after XZ-T002, obtain strain X Z-T002 (table 1).

(2) pyruvate formate-lyase encoding gene pflB's knocks out

In strain X Z-T002, knock out pyruvate formate-lyase encoding gene pflB (GenBank No:ACA78322.1), operation steps is following six steps altogether:

The first step, intestinal bacteria ATCC 8739 genomic dnas of take are template, use primer XZ-pflB-up/XZ-pflB-down (SEQ ID NO:15/SEQ ID NO:16), the pyruvate formate-lyase encoding gene pflB of amplification intestinal bacteria ATCC8739 and each 400 left and right bases of upstream and downstream thereof.

By extension amplification outcome to pEASY-Blunt cloning vector.Clone body is: 1 μ l pcr amplification product, 1 μ lpEASY-Blunt cloning vector, mixing, room temperature reaction add after 5 minutes in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) gently, ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted pyruvate formate-lyase encoding gene and each 400 left and right bases of upstream and downstream thereof on carrier pEASY-Blunt, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ015 obtaining.

Second step, take pXZ015 plasmid DNA as template, use primer XZ-pflB-1/XZ-pflB-2 (SEQ ID NO:17/SEQ ID NO:18) to carry out pcr amplification, amplified production comprises pEASY-Blunt carrier and each 400 left and right bases of pyruvate formate-lyase encoding gene upstream and downstream.

The 3rd step, will contain the pcr amplification product that chloromycetin gene (cat) and Polylevulosan sucrose transferase gene (sacB) DNA fragmentation are connected to second step.The pBM002 plasmid (deriving from Hefei Bai Mai Bioisystech Co., Ltd) of take is template, uses primer cat-sacB-up/down pcr amplification cat-sacB fragment.Primer sequence is:

cat-sacB-up：GGAGAAAATACCGCATCAGG(SEQ ID NO：11)

cat-sacB-down：GCGTTGGCCGATTCATTA(SEQ ID NO：12)。

Linked system is: the second step pcr amplification product of 10ng, and the cat-sacB DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (cat-sacB DNA fragmentation is cloned into the plasmid in pXZ015) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ016 obtaining.

The 4th step, take pXZ016 plasmid DNA as template, uses primer XZ-pflB-up/XZ-pflB-down to amplify DNA fragmentation I.

DNA fragmentation I comprises 400 of pyruvate formate-lyase encoding gene pflB upstreams left and right base, cat-sacBDNA fragment, 400, pyruvate formate-lyase encoding gene pflB downstream left and right base.

DNA fragmentation I is used for to homologous recombination for the first time.First pKD46 plasmid is converted into strain X Z-T002 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation I electricity is gone to the strain X Z-T002 with pKD46.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the intestinal bacteria XZ-T002 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-pflB-up/XZ-pflB-down to verify, the fragment that correct bacterium colony amplified production is 3909bp).Select a correct single bacterium colony, by its called after XZ-T003.

The 5th step, the DNA cloning fragment of the pXZ015 plasmid that second step is obtained is carried out phosphatizing treatment, carry out from connecting, certainly the plasmid of getting continuously for homologous recombination for the second time.

Concrete steps are as follows: first the product of the pcr amplification of second step is cleaned to (Gel/PCRExtration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, the pcr amplification product of the above-mentioned second step of sequencing result has carried out certainly connecting, and obtains plasmid pXZ017.

The 6th step, take pXZ017 plasmid DNA as template, with primer XZ-pflB-up/XZ-pflB-down, amplifies DNA fragmentation II, and DNA fragmentation II is used for homologous recombination for the second time.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower etal., 1988) with the XZ-T003 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer XZ-pflB-up/XZ-pflB-down to verify, the fragment that correct bacterium colony amplified production is 879bp), select a correct single bacterium colony, by its called after XZ-T004, obtain strain X Z-T004 (table 1).

Knock out the constructed plasmid of pflB gene in Table 3, the primer sequence of use is in Table 2.

(3) fumaric reductase encoding gene frd's knocks out

In strain X Z-T004, knock out fumaric reductase encoding gene frdABCD (frdA GenBank No:ACA79460.1, frdB GenBank No:ACA79461.1, frdC GenBank No:ACA79462.1, frdD GenBankNo:ACA79463.1), operation steps following six steps altogether:

The first step, intestinal bacteria ATCC 8739 genomic dnas of take are template, use primer XZ-frdB-up/XZ-frdC-down (SEQ ID NO:27/SEQ ID NO:28), the fumaric reductase encoding gene frdABCD of amplification intestinal bacteria ATCC8739 and each 400 left and right bases of upstream and downstream thereof.

By extension amplification outcome to pEASY-Blunt cloning vector.Clone body is: 1 μ l pcr amplification product, 1 μ lpEASY-Blunt cloning vector, mixing, room temperature reaction add after 5 minutes in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) gently, ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted fumaric reductase encoding gene frdABCD and each 400 left and right bases of upstream and downstream thereof on carrier pEASY-Blunt, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ005 obtaining.

Second step, take pXZ005 plasmid DNA as template, use primer XZ-frdC-1/XZ-frdB-2 (SEQ ID NO:29/SEQ ID NO:30) to carry out pcr amplification, amplified production comprises pEASY-Blunt carrier and each 400 left and right bases of fumaric reductase encoding gene upstream and downstream.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 57 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 40 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

The 3rd step, will contain the pcr amplification product that chloromycetin gene (cat) and Polylevulosan sucrose transferase gene (sacB) DNA fragmentation are connected to second step.

The pBM002 plasmid (deriving from Hefei Bai Mai Bioisystech Co., Ltd) of take is template, uses primer cat-sacB-up/down pcr amplification cat-sacB fragment.Primer sequence is:

cat-sacB-up：GGAGAAAATACCGCATCAGG(SEQ ID NO：11)

cat-sacB-down：GCGTTGGCCGATTCATTA(SEQ ID NO：12)。

Linked system is: the second step pcr amplification product of 10ng, and the cat-sacB DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (cat-sacB DNA fragmentation is cloned into the plasmid in pXZ005) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ006 obtaining.

The 4th step, take pXZ006 plasmid DNA as template, uses primer XZ-frdB-up/XZ-frdC-down to amplify DNA fragmentation I.

DNA fragmentation I comprises 400 of fumaric reductase encoding gene frdABCD upstreams left and right base, cat-sacBDNA fragment, 400, fumaric reductase encoding gene frdABCD downstream left and right base.

DNA fragmentation I is used for to homologous recombination for the first time.First pKD46 plasmid is converted into strain X Z-T004 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation I electricity is gone to the strain X Z-T004 with pKD46.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the intestinal bacteria XZ-T004 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-frdB-up/XZ-frdC-down to verify, the fragment that correct bacterium colony amplified production is 3901bp).Select a correct single bacterium colony, by its called after XZ-T005.

The 5th step, the DNA cloning fragment of the pXZ005 plasmid that second step is obtained is carried out phosphatizing treatment, and carries out from connecting.

Concrete steps are as follows: first the product of the pcr amplification of second step is cleaned to (Gel/PCRExtration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, immediately as for 2 minutes on ice.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, the pcr amplification product of the above-mentioned second step of sequencing result has carried out certainly connecting, and proves that plasmid construction is correct, obtains plasmid pXZ007.

The 6th step, take pXZ007 plasmid DNA as template, with primer XZ-frdB-up/XZ-frdC-down, amplifies DNA fragmentation II.

Amplification system is: NewEngland Biolabs Phusion 5X damping fluid 10 μ l, dNTP (every kind of each 10mM of dNTP) 1 μ l, DNA profiling 20ng, each 2 μ l of primer (10 μ M), Phusion High-Fidelity archaeal dna polymerase (2.5 U/ μ l) 0.5 μ l, distilled water 33.5 μ l, cumulative volume is 50 μ l.

DNA fragmentation II is used for homologous recombination for the second time.First pKD46 plasmid is converted into XZ-T005 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation II electricity is gone to the XZ-T005 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the XZ-T005 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer XZ-frdB-up/XZ-frdC-down to verify, the fragment that correct bacterium colony amplified production is 821bp), select a correct single bacterium colony, by its called after XZ-T006, obtain strain X Z-T006 (table 1).

Knock out the constructed plasmid of frd gene in Table 3, the primer sequence of use is in Table 2.

(4) phosphate acetyltransferase encoding gene pta and E.C. 2.7.2.1 encoding gene ackA's knocks out

In strain X Z-T006, knock out phosphate acetyltransferase encoding gene pta (GenBank No:ACA77021.1) and E.C. 2.7.2.1 encoding gene ackA (GenBank No:ACA77022.1), operation steps is following six steps altogether:

The first step, intestinal bacteria ATCC 8739 genomic dnas of take are template, use primer XZ-ackA-up/XZ-pta-down (SEQ ID NO:35/SEQ ID NO:36), phosphate acetyltransferase encoding gene pta and 400, downstream left and right base and E.C. 2.7.2.1 encoding gene ackA and 400 of the upstreams left and right base thereof of amplification intestinal bacteria ATCC8739.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 56 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

By extension amplification outcome to pEASY-Blunt cloning vector.Clone body is: 1 μ l pcr amplification product, 1 μ lpEASY-Blunt cloning vector, mixing, room temperature reaction add after 5 minutes in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) gently, ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted phosphate acetyltransferase encoding gene pta and 400, downstream left and right base and E.C. 2.7.2.1 encoding gene ackA and 400 of upstreams left and right base thereof on carrier pEASY-Blunt, proof plasmid construction is correct, by the recombinant plasmid called after pXZ023 obtaining.

Second step, take pXZ023 plasmid DNA as template, use primer XZ-ackA-2/XZ-pta-2 (SEQ ID NO:37/SEQ ID NO:38) to carry out pcr amplification, amplified production comprises pEASY-Blunt carrier and 400, phosphate acetyltransferase encoding gene pta downstream left and right base and 400 of E.C. 2.7.2.1 encoding gene ackA upstreams left and right base.

cat-sacB-up：GGAGAAAATACCGCATCAGG(SEQ ID NO：11)

cat-sacB-down：GCGTTGGCCGATTCATTA(SEQ ID NO：12)。

Linked system is: the second step pcr amplification product of 10ng, and the cat-sacB DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (cat-sacB DNA fragmentation is cloned into the plasmid in pXZ023) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ024 obtaining.

The 4th step, take pXZ024 plasmid DNA as template, uses primer XZ-ackA-up/XZ-pta-down to amplify DNA fragmentation I.

DNA fragmentation I comprises 400, phosphate acetyltransferase encoding gene pta downstream left and right base, cat-sacB DNA fragmentation, 400 of E.C. 2.7.2.1 encoding gene ackA upstreams left and right base.

DNA fragmentation I is used for to homologous recombination for the first time.First pKD46 plasmid is converted into strain X Z-T006 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation I electricity is gone to the strain X Z-T006 with pKD46.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strain X Z-T006 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-ackA-up/XZ-pta-down to verify, the fragment that correct bacterium colony amplified production is 3011bp).Select a correct single bacterium colony, by its called after XZ-T009.

The 5th step, the DNA cloning fragment of the pXZ023 plasmid that second step is obtained is carried out phosphatizing treatment, carries out from connecting.

Concrete steps are as follows: first the product of the pcr amplification of second step is cleaned to (Gel/PCRExtration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, immediately as for 2 minutes on ice.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, the pcr amplification product of the above-mentioned second step of sequencing result has carried out certainly connecting, and proves that plasmid construction is correct, obtains plasmid pXZ025.

The 6th step, take pXZ025 plasmid DNA as template, with primer XZ-ackA-up/XZ-pta-down, amplifies DNA fragmentation II, and DNA fragmentation II is used for homologous recombination for the second time.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 56 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 15 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

First pKD46 plasmid is converted into XZ-T009 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation II electricity is gone to the XZ-T009 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower etal., 1988) with the XZ-T009 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer XZ-ackA-up/XZ-pta-down to verify, the fragment that correct bacterium colony amplified production is 731bp), select a correct single bacterium colony, by its called after XZ-T010, obtain strain X Z-T010 (table 1).

Knock out the constructed plasmid of ackA-pta gene in Table 3, the primer sequence of use is in Table 2.

(5) integrate 2-keto acid decarboxylase gene and the colibacillary dihydroxy-acid dehydratase gene (Fig. 5) of Lactococcus lactis

Integrate 2-keto acid decarboxylase gene (the GenBank No:AAS49166 of Lactococcus lactis, AY548760) and colibacillary dihydroxy-acid dehydratase gene (GenBank No:YP_026248, NC_000913) and improve its expression intensity, total following seven steps.The primer is in Table 2.

The first step, the kinase whose promotor pck of phosphoenolpyruvic acid carboxylation of clone intestinal bacteria MG1655 is to carrier pTrc99A.

With intestinal bacteria MG1655 (from ATCC, numbering 700926) genome, be template, use primer P-pck ^*-up-SpeI/P-pck ^*the kinase whose promotor pck of phosphoenolpyruvic acid carboxylation of-down-KpnI (SEQ ID NO:19/SEQ ID NO:20) amplification intestinal bacteria MG1655, primer sequence is in Table 2.

Amplified production is the kinase whose promotor pck of phosphoenolpyruvic acid carboxylation, and PCR product carries out SpeI (purchased from NEB company) and KpnI (purchased from NEB company) enzyme is cut.Be cloned on pTrc99A (the deriving from Hefei Bai Mai Bioisystech Co., Ltd) expression vector of cutting through same enzyme enzyme.

Linked system is: the pTrc99A enzyme of 10ng is cut product, the pck endonuclease bamhi of 30ng, and 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ lLB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows on carrier pTrc99A, to have inserted the kinase whose promotor pck of phosphoenolpyruvic acid carboxylation, proves that plasmid construction is correct, by the expression plasmid called after pXZ602 obtaining.

Second step, the kinase whose sudden change promotor of clone's phosphoenolpyruvic acid carboxylation pck ^*to pTrc99A.

Take plasmid pXZ602 as template, design primer pck ^*-F/pck ^*-R (SEQ ID NO:21/SEQ ID NO:22), primer sequence is in Table 2.

98 ℃ of denaturations of amplification condition 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 7 minutes (1 circulation).

Amplified production phosphorates through T4 polynucleotide kinase (purchased from NEB company), certainly gets positive plasmid continuously.

Concrete steps are as follows: first the product of pcr amplification is cleaned to (Gel/PCR Extration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ lLB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck on carrier pTrc99A ^*(SEQ ID NO:75), proves that plasmid construction is correct, by the expression plasmid called after pXZ603 obtaining.

The 3rd step, carries out Lactococcus lactis 2-keto acid decarboxylase gene, intestinal bacteria dihydroxy-acid dehydratase gene, and pck ^*the ligation of promotor.

With Lactococcus lactis (Lactococus lactis IL1403, from ATCC, numbering 7962) genomic dna is template, with primer kivD-F-KpnI/kivD-R-XbaI (SEQ ID NO:23/SEQ ID NO:24), the 2-keto acid decarboxylase encoding gene kivD of amplification Lactococcus lactis.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is 2-keto acid decarboxylase encoding gene kivD, and PCR product carries out KpnI (purchased from NEB company) and XbaI (purchased from NEB company) enzyme is cut.

With intestinal bacteria MG1655 (from ATCC, numbering 700926) genomic dna is template, use primer ilvD-F-Xbal/ilvD-R-SalI (SEQ ID NO:25/SEQ ID NO:26), the dihydroxy-acid dehydratase gene ilvD of amplification intestinal bacteria MG1655.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 58 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is dihydroxy-acid dehydratase gene ilvD, and PCR product carries out XbaI (purchased from NEB company) enzyme and cuts.

Take plasmid pXZ603 as template, use primer P-pck ^*-up-SpeI and P-pck ^*the kinase whose sudden change promotor of-down-KpnI amplification phosphoenolpyruvic acid carboxylation pck ^*.Amplification system is: NewEngland Biolabs Phusion 5X damping fluid 10 μ l, dNTP (every kind of each 10mM of dNTP) 1 μ l, DNA profiling 20ng, each 2 μ l of primer (10 μ M), Phusion High-Fidelity archaeal dna polymerase (2.5U/ μ l) 0.5 μ l, distilled water 33.5 μ l, cumulative volume is 50 μ l.Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 15 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck ^*, PCR product carries out KpnI enzyme and cuts.

Above-mentioned three fragments are carried out ligation.Linked system is: pck ^*enzyme is cut PCR fragment 10ng, kivD enzyme is cut PCR fragment 20ng, and ilvD enzyme is cut PCR fragment 15ng, 5 μ l 2Xquick ligase damping fluids (purchased from NEB company), 0.5 μ lQuick T4DNA ligase enzyme (purchased from NEB company), supplements distilled water to 10 μ l.25 ℃, 5 minutes.

The connection product of take is template, uses primer P-pck ^*-up-SpeI carries out pcr amplification to improve the concentration that is connected product with ilvD-R-SalI.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 58 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is pck ^*, the junction fragment of kivD and ilvD.

The 4th step, take pXZ015 plasmid DNA as template, with primer XZ-pflB-1/XZ-pflB-2, carries out pcr amplification, obtains the DNA cloning fragment of pXZ015 plasmid.

The 5th step, will contain the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck ^*, 2-keto acid decarboxylase and dihydroxyacid dehydratase DNA fragmentation be connected to the 4th step pcr amplification product.

Linked system is: the 4th step pcr amplification product of 10ng, and the 3rd step pcr amplified dna fragment of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, and get 5 μ l and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes, 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck on carrier pXZ015 ^*, 2-keto acid decarboxylase encoding gene kivD and dihydroxyacid dehydratase ilvD, prove that plasmid construction is correct, by the plasmid called after pXZ618 obtaining, (building process is shown in Fig. 5 a).

The 6th step, take pXZ016 plasmid DNA as template, with primer XZ-pflB-up/XZ-pflB-down, carries out pcr amplification, obtains the DNA cloning fragment I of pXZ016 plasmid.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

DNA fragmentation I comprises 400 of pyruvate formate-lyase encoding gene pflB upstreams left and right base, cat-sacB DNA fragmentation, 400, pyruvate formate-lyase encoding gene pflB downstream left and right base.

The DNA cloning fragment of pXZ016 plasmid is used for to homologous recombination for the first time.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the intestinal bacteria XZ-T010 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA amplified fragments I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-pflB-up/XZ-pflB-down to verify, the fragment that correct bacterium colony amplified production is 3909bp).Select a correct single bacterium colony, obtain strains A S5 (building process is shown in Fig. 5 b).

The 7th step, take pXZ618 plasmid DNA as template, with primer XZ-pflB-up/XZ-pflB-down, carries out pcr amplification, obtains the DNA cloning fragment II of pXZ618 plasmid.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 15 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

The DNA cloning fragment of pXZ618 plasmid is used for to homologous recombination for the second time.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S5 of pKD46; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking, (use primer XZ-pflB-up/XZ-pflB-down to verify, correct bacterium colony amplified production is the fragment of 4871bp left and right.Select a correct single bacterium colony, by its called after strains A S6 (table 1) (building process is shown in Fig. 5 c).

(6) integrate the alcohol dehydrogenase gene of Lactococcus lactis

By the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck ^*be incorporated into the frd site of AS6 with the alcohol dehydrogenase gene adhA (GenBank No:NP_267964.1, NC_002662.1) of Lactococcus lactis, and improve its expression intensity, total following five steps:

The first step, carries out the alcohol dehydrogenase gene adhA of Lactococcus lactis and pck ^*the ligation of promotor.

With Lactococcus lactis (Lactococus lactis IL1403, from ATCC, numbering 7962) genomic dna is template, with primer adhA-F-XbaI/adhA-R-SalI (SEQ ID NO:33/SEQ ID NO:34), and the alcohol dehydrogenase gene adhA of amplification Lactococcus lactis.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

Amplified production is alcohol dehydrogenase gene adhA, and PCR product carries out XbaI (purchased from NEB company) enzyme and cuts.

Take plasmid pXZ603 as template, use primer P-pck ^*-up-SpeI and P-pck ^*the kinase whose sudden change promotor of-down-XbaI (SEQ ID NO:31/SEQ ID NO:32) amplification phosphoenolpyruvic acid carboxylation pck ^*.Amplification system is: NewEngland Biolabs Phusion 5X damping fluid 10 μ l, dNTP (every kind of each 10mM of dNTP) 1 μ l, DNA profiling 20ng, each 2 μ l of primer (10 μ M), Phusion High-Fidelity archaeal dna polymerase (2.5U/ μ l) 0.5 μ l, distilled water 33.5 μ l, cumulative volume is 50 μ l.Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 15 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck ^*, PCR product carries out XbaI enzyme cutting.

Two fragments are carried out ligation.Linked system is: pck ^*enzyme is cut PCR fragment 10ng, and adhA enzyme is cut PCR fragment 20ng, 5 μ l 2Xquick ligase damping fluids (purchased from NEB company), and 0.5 μ l Quick T4DNA ligase enzyme (purchased from NEB company), supplements distilled water to 10 μ l.25 ℃, 5 minutes.

The connection product of take is template, uses primer P-pck ^*-up-SpeI carries out pcr amplification to improve the concentration that is connected product with adhA-R-SalI (SEQ ID NO:31/SEQ IDNO:34).

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is pck ^*junction fragment with adhA.

Second step, take pXZ005 plasmid DNA as template, with primer XZ-frdB-2/XZ-frdC-1, carries out pcr amplification, obtains the DNA cloning fragment of pXZ005 plasmid.

The 3rd step, will contain the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck ^*, alcohol dehydrogenase gene adhA DNA fragmentation be connected to second step pcr amplification product.

Linked system is: the second step pcr amplification product of 10ng, and the first step pcr amplified dna fragment of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, and get 5 μ l and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes, 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted the kinase whose sudden change promotor of phosphoenolpyruvic acid carboxylation pck on carrier pXZ005 ^*with alcohol dehydrogenase gene adhA, prove that plasmid construction is correct, by the plasmid called after pXZ619 obtaining.

The 4th step, take pXZ006 plasmid DNA as template, with primer XZ-frdB-up/XZ-frdC-down, carries out pcr amplification, obtains the DNA cloning fragment of pXZ006 plasmid, and the DNA cloning fragment of pXZ006 plasmid is used for to homologous recombination for the first time.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 57 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the intestinal bacteria AS6 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-frdB-up/XZ-frdC-down to verify, the fragment that correct bacterium colony amplified production is 3901bp).Select a correct single bacterium colony, by its called after AS17.

The 5th step, take pXZ619 plasmid DNA as template, with primer XZ-frdB-up/XZ-frdC-down, carries out pcr amplification, obtains the DNA cloning fragment of pXZ619 plasmid, and the DNA cloning fragment of pXZ619 plasmid is used for homologous recombination for the second time.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the intestinal bacteria AS17 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (use primer XZ-frdB-up/XZ-frdC-down to verify, correct bacterium colony amplified production is the fragment of 1844bp left and right), select a correct single bacterium colony, by its called after strains A S18 (table 1).

The primer is in Table 2, and the plasmid of structure is in Table 3.

The recombination bacillus coli of table 1, production isopropylcarbinol

Pck ^*represent intestinal bacteria pck promoter mutation body (becoming A locating G with respect to-64 of ATG section start) (Zhang et al., 2009a).M1-93 (SEQ ID NO:1), M1-37 (SEQ ID NO:2), M1-46 (SEQID NO:3), M1-30 (SEQ ID NO:4), M1-64 (SEQ ID NO:5) and M1-12 (SEQ ID NO:6) are the manual activation sub-element (CN201110155176.0 previously building; Lu et al., 2012), the intensity after the intestinal bacteria lacZ gene promoter of take induction is 1, the promotor intensity of these manual activation sub-elements is respectively its 5,2.5,1.7,0.8,0.4,0.1 times.

The primer using in table 2, the present invention

The plasmid building in table 3, the present invention

Embodiment 2: use recombination bacillus coli AS18 to produce isopropylcarbinol

Method I:AS18 aerobic fermentation is produced isopropylcarbinol

Seed culture medium and fermention medium consist of the following composition (solvent is water):

Macroelement: glucose 50g/L, KH ₂pO ₄3.5g/L, K ₂hPO ₄6.55g/L, (NH ₄) ₂hPO ₄3.5g/L, MgSO ₄7H ₂o 0.12g/L, Thiamine HCl 0.005g/L and Betaine-KCl 0.15g/L, MOPS 100mM;

Trace element: FeCl ₃6H ₂o 1.5 μ g/L, CoCl ₂6H ₂o 0.1 μ g/L, CuCl ₂2H ₂o 0.1 μ g/L, ZnCl ₂0.1 μ g/L, Na ₂moO ₄2H ₂o 0.1 μ g/L, MnCl ₂4H ₂o ₂0.2 μ g/L, H ₃bO ₃0.05 μ g/L.

AS18 aerobic fermentation, comprises the following steps:

(1) seed culture: in 250ml triangular flask, seed culture medium is 50ml, 115 ℃ of sterilizing 15min.After cooling, recombination bacillus coli AS18 being inoculated in to seed culture medium according to the inoculum size of 1% (V/V), is to cultivate and within 12 hours, obtain seed liquor under the condition of 7.0,37 ℃ and 100rpm in pH value, for fermention medium, inoculates.

(2) fermentation culture: in 250ml triangular flask, fermention medium is 50ml, by seed liquor according to final concentration OD ₅₅₀=0.1 inoculum size is inoculated in fermention medium, under the condition of 37 ℃ and 250rpm, cultivates 24 hours, obtains fermented liquid.Fermented liquid is all substances in fermentor tank.

Analytical procedure: use Agilent (Agilent-1200) high performance liquid chromatograph to measure the component in fermented liquid.Glucose in fermented liquid, isopropylcarbinol and organic acid concentration are measured the Aminex HPX-87H organic acid analysis column that adopts Bole (Biorad) company.Isopropylcarbinol standard substance are purchased from SIGMA company, and catalog number is 58448.

Result: aerobic fermentation 24 hours, AS18 has produced the isopropylcarbinol of 3.7mM, and sugar alcohol transformation efficiency is 0.04mol/mol (Fig. 3).

Method II:AS18 anaerobically fermenting is produced isopropylcarbinol

With AS18 anaerobically fermenting, comprise the following steps:

(2) fermentation culture: in 100ml anaerobism bottle, fermention medium volume is 50ml, by seed liquor according to final concentration OD ₅₅₀=0.1 inoculum size is inoculated in fermention medium, and 37 ℃ of standing cultivations 6 days, obtain fermented liquid.Fermented liquid is all substances in fermentor tank.The illogical any gas of culturing process.

Analytical procedure: use Agilent (Agilent-1200) high performance liquid chromatograph to measure the component in the 6th day fermented liquid.Glucose in fermented liquid, isopropylcarbinol and organic acid concentration are measured the Aminex HPX-87H organic acid analysis column that adopts Bole (Biorad) company.

Result: anaerobically fermenting 6 days, AS18 has produced the isopropylcarbinol of 2.5mM, and sugar alcohol transformation efficiency is 0.07mol/mol (Fig. 3).

Embodiment 3: the structure of recombination bacillus coli AS29

The structure of recombination bacillus coli AS29, has with next step

(1) improve the 2-keto acid decarboxylase gene of Lactococcus lactis and the expression intensity (seeing Fig. 6) of colibacillary dihydroxy-acid dehydratase gene

Improve the 2-keto acid decarboxylase gene of Lactococcus lactis and the expression intensity of colibacillary dihydroxy-acid dehydratase gene, altogether following two steps:

The first step, take pXZ016 as template, uses primer XZ-pflB-up/kivD-sacB-down (SEQ ID NO:15/SEQ ID NO:53) amplification of DNA fragments I, for homologous recombination for the first time.Primer sequence is in Table 2.

Gained DNA cloning fragment electricity is gone to the strains A S18 with pKD46 plasmid.Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the intestinal bacteria AS18 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-pflB-up/kivD-sacB-down to verify, the fragment that correct bacterium colony amplified production is 3480bp).Select a correct single bacterium colony, called after strains A S28 (is shown in Fig. 6 a).

Second step, M1-93DNA (CN201110155176.0 in the promotor M-Lib1 library that beta-galactosidase enzymes (lacZ) gene locus with this laboratory on intestinal bacteria ATCC8739 karyomit(e) builds; Lu et al., 2012) be template, use primer pflB-up-P/kivD-RBS-down (SEQ ID NO:54/SEQ ID NO:55) amplification for the promoter fragment of second step homologous recombination, primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 10 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the promoter fragment for second step homologous recombination.

Electricity turns condition: first prepare the AS28 Electroporation-competent cells (Dower et al., 1988) with pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng amplification gained promoter dna fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by lml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (use primer pflB-up-P/kivD-R-XbaI to verify, correct bacterium colony amplified production is the fragment of 1786bp left and right), select a correct single bacterium colony, by its called after strains A S29 (table 1, Fig. 6 b).

Embodiment 4, use recombination bacillus coli AS29 produce isopropylcarbinol

Method I:AS29 aerobic fermentation is produced isopropylcarbinol

The formula of seed culture medium and fermention medium is identical with embodiment 2.Aerobic fermentation method and analysing and detecting method are identical with embodiment 2.

Result: aerobic fermentation 24 hours, AS29 has produced the isopropylcarbinol of 3.0mM, and sugar alcohol transformation efficiency is 0.04mol/mol (Fig. 3).

Method II:AS29 anaerobically fermenting is produced isopropylcarbinol

The formula of seed culture medium and fermention medium is identical with embodiment 2.Anaerobic fermentation method and analysing and detecting method are identical with embodiment 2.

Result: anaerobically fermenting 6 days, AS29 has produced the isopropylcarbinol of 4.8mM, and sugar alcohol transformation efficiency is 0.13mol/mol (Fig. 3).

The structure of embodiment 5, recombination bacillus coli AS74

The structure of recombination bacillus coli AS74, is divided into following two steps:

(1) alcohol dehydrogenase enzyme coding gene adhE's knocks out

In strains A S29, knock out alcohol dehydrogenase enzyme coding gene adhE (GenBank No:ACA78022.1), operation steps is following six steps altogether:

The first step, intestinal bacteria ATCC 8739 genomic dnas of take are template, use primer XZ-adhE-up/XZ-adhE-down (SEQ ID NO:39/SEQ ID NO:40), the alcohol dehydrogenase enzyme coding gene adhE of amplification intestinal bacteria ATCC8739 and each 400 left and right bases of upstream and downstream thereof, by extension amplification outcome to pEASY-Blunt cloning vector.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 51 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

Amplified production comprises alcohol dehydrogenase enzyme coding gene adhE and each 400 left and right bases of upstream and downstream thereof, and is cloned on pEASY-Blunt cloning vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd).Clone body is: 1 μ lPCR amplified production, 1 μ l pEASY-Blunt cloning vector, and mixing, room temperature reaction add after 5 minutes in 50 μ lTrans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) gently, ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted alcohol dehydrogenase enzyme coding gene and each 400 left and right bases of upstream and downstream thereof on carrier pEASY-Blunt, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ020 obtaining.

Second step, take pXZ020 plasmid DNA as template, use primer XZ-adhE-1/XZ-adhE-2 (SEQ ID NO:41/SEQ ID NO:42) to carry out pcr amplification, amplified production comprises pEASY-Blunt carrier and each 400 left and right bases of alcohol dehydrogenase enzyme coding gene upstream and downstream.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 52 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 40 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

The 3rd step, will contain the pcr amplification product that chloromycetin gene (cat) and Polylevulosan sucrose transferase gene (sacB) DNA fragmentation are connected to second step.The pBM002 plasmid (deriving from Hefei Bai Mai Bioisystech Co., Ltd) of take is template, uses primer cat-sacB-up/down pcr amplification cat-sacB fragment.

Linked system is: the second step pcr amplification product of 10ng, and the cat-sacB DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (cat-sacB DNA fragmentation is cloned into the plasmid in pXZ020) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ021 obtaining.

The 4th step, take pXZ021 plasmid DNA as template, uses primer XZ-adhE-up/XZ-adhE-down to amplify DNA fragmentation I.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 51 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

DNA fragmentation I comprises 400 of alcohol dehydrogenase enzyme coding gene adhE upstreams left and right base, cat-sacB DNA fragmentation, 400, alcohol dehydrogenase enzyme coding gene adhE downstream left and right base.

DNA fragmentation I is used for to homologous recombination for the first time.First pKD46 plasmid is converted into strains A S29 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation I electricity is gone to the strains A S29 with pKD46.

Electricity turns condition: first prepare the Electroporation-competent cells (Doweret al., 1988) with the strains A S29 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-adhE-up/XZ-adhE-down to verify, the fragment that correct bacterium colony amplified production is 3912bp).Select a correct single bacterium colony, by its called after AS71.

The 5th step, the DNA cloning fragment of the pXZ020 plasmid that second step is obtained is carried out phosphatizing treatment, carries out from connecting.

Concrete steps are as follows: first the product of the pcr amplification of second step is cleaned to (Gel/PCRExtration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, immediately as for 2 minutes on ice.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, the pcr amplification product of the above-mentioned second step of sequencing result has carried out certainly connecting, and proves that plasmid construction is correct, obtains plasmid pXZ022.

The 6th step, take pXZ022 plasmid DNA as template, with primer XZ-adhE-up/XZ-adhE-down, amplifies DNA fragmentation II, and DNA fragmentation II is used for homologous recombination for the second time.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 51 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 15 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

First pKD46 plasmid is converted into AS71 (Morrison, 1977) by calcium chloride transformation, then DNA fragment II electricity is gone to the AS71 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the AS71 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer XZ-adhE-up/XZ-adhE-down to verify, the fragment that correct bacterium colony amplified production is 883bp), select a correct single bacterium colony, by its called after AS72, obtain strains A S72 (table 1).

Knock out the constructed plasmid of adhE gene in Table 3, the primer sequence of use is in Table 2.

(2) propionate kinase encoding gene tdcD and formate acetyltransferase encoding gene tdcE's knocks out

In strains A S72, knock out propionate kinase encoding gene tdcD (GenBank No:ACA76259.1) and formate acetyltransferase encoding gene tdcE (GenBankNo:ACA76260.1), operation steps is following six steps altogether:

The first step, intestinal bacteria ATCC 8739 genomic dnas of take are template, use primer XZ-tdcDE-up/XZ-tdcDE-down (SEQ ID NO:43/SEQ ID NO:44), E.C. 2.7.2.1 encoding gene tdcD and 800 of upstreams left and right base and formate acetyltransferase encoding gene tdcE and 1000, the downstream left and right base thereof of amplification intestinal bacteria ATCC8739, by extension amplification outcome to pEASY-Blunt cloning vector.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 53 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 2 minutes (30 circulations); 72 ℃ are extended 10 minutes (1 circulation).

Amplified production comprises E.C. 2.7.2.1 encoding gene tdcD and 800 of upstreams left and right base and formate acetyltransferase encoding gene tdcE and 1000, downstream left and right base thereof, and is cloned on pEASY-Blunt cloning vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd).Clone body is: 2 μ l pcr amplification products, 1 μ l pEASY-Blunt cloning vector, mixing, room temperature reaction add after 5 minutes in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) gently, ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted E.C. 2.7.2.1 encoding gene tdcD and 800 of upstreams left and right base and formate acetyltransferase encoding gene tdcE and 1000, downstream left and right base thereof on carrier pEASY-Blunt, proof plasmid construction is correct, by the recombinant plasmid called after pXZ641 obtaining.

Second step, take pXZ641 plasmid DNA as template, use primer XZ-tdcDE-1/XZ-tdcDE-2 (SEQ IDNO:45/SEQ ID NO:46) to carry out pcr amplification, amplified production comprises pEASY-Blunt carrier, 800 of E.C. 2.7.2.1 encoding gene tdcD upstreams left and right base and 1000, formate acetyltransferase encoding gene tdcE downstream left and right base.

cat-sacB-up：GGAGAAAATACCGCATCAGG(SEQ ID NO：11)

cat-sacB-down：GCGTTGGCCGATTCATTA(SEQ ID NO：12)。

Linked system is: the second step pcr amplification product of 10ng, and the cat-sacB DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (cat-sacB DNA fragmentation is cloned into the plasmid in pXZ641) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ642 obtaining.

The 4th step, take pXZ642 plasmid DNA as template, uses primer XZ-tdcDE-up/XZ-tdcDE-down to amplify DNA fragmentation I.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 53 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 40 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

DNA fragmentation I comprises 800 of propionate kinase encoding gene tdcD upstreams left and right base, cat-sacB DNA fragmentation, 1000, formate acetyltransferase encoding gene tdcE downstream left and right base.

DNA fragmentation I is used for to homologous recombination for the first time.First pKD46 plasmid is converted into strains A S72 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation I electricity is gone to the strains A S72 with pKD46.

Electricity turns condition: first prepare the Electroporation-competent cells (Doweret al., 1988) with the strains A S72 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-tdcDE-up/XZ-tdcDE-down to verify, the fragment that correct bacterium colony amplified production is 5007bp).Select a correct single bacterium colony, by its called after AS73.

The 5th step, the DNA cloning fragment of the pXZ641 plasmid that second step is obtained is carried out phosphatizing treatment, carries out knocking out plasmid pXZ643 from getting second step continuously.

Concrete steps are as follows: first the product of the pcr amplification of second step is cleaned to (Gel/PCRExtration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, the pcr amplification product of the above-mentioned second step of sequencing result has carried out certainly connecting, and proves that plasmid construction is correct, obtains plasmid pXZ643.

The 6th step, take pXZ643 plasmid DNA as template, with primer XZ-tdcDE-up/XZ-tdcDE-down, amplifies DNA fragmentation II.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 53 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 40 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

DNA fragmentation II is used for homologous recombination for the second time.First pKD46 plasmid is converted into AS73 (Morrison, 1977) by calcium chloride transformation, then DNA fragmentation II electricity is gone to the AS73 with pKD46 plasmid.

Electricity turns condition: first prepare the AS73 Electroporation-competent cells (Dower et al., 1988) with pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (XZ-tdcDE-up/XZ-tdcDE-down verifies, the fragment that correct bacterium colony amplified production is 1907bp), select a correct single bacterium colony, by its called after AS74, obtain strains A S74 (table 1).

Knock out the constructed plasmid of tdcDE gene in Table 3, the primer sequence of use is in Table 2.

Embodiment 6, use recombination bacillus coli AS74 produce isopropylcarbinol

Method I:AS74 aerobic fermentation is produced isopropylcarbinol

Result: aerobic fermentation 24 hours, AS74 has produced the isopropylcarbinol of 2.6mM, and sugar alcohol transformation efficiency is 0.04mol/mol (Fig. 3).

Method II:AS74 anaerobically fermenting is produced isopropylcarbinol

Result: anaerobically fermenting 6 days, AS74 has produced the isopropylcarbinol of 4.9mM, and sugar alcohol transformation efficiency is 0.18mol/mol (Fig. 3).

The structure of embodiment 7, recombination bacillus coli AS77-AS82

The structure of recombination bacillus coli AS77, has following three steps:

(1) clone of acetolactate synthase gene, expression and enzyme are lived and are analyzed

The clone of acetolactate synthase gene, expression and enzyme are lived and are analyzed, total following six steps:

The first step, the acetolactate synthase gene alsS (GenBank No:CAB15618, Z99122) of clone subtilis is to pTrc99A (deriving from Hefei Bai Mai Bioisystech Co., Ltd).

With subtilis 168 (from ATCC, numbering 23857) genomic dna is template, with primer alsS-F-SacI/alsS-R-BamHI (SEQ ID NO:13/SEQ ID NO:14), carry out pcr amplification, the acetolactate synthestase encoding gene alsS that amplified production is subtilis.Primer sequence is in Table 2.

Amplified production is acetolactate synthestase encoding gene alsS.PCR product carries out SacI (purchased from NEB company) and BamHI (purchased from NEB company) enzyme is cut, and is cloned on the pTrc99A expression vector of cutting through same enzyme enzyme.

Linked system is: the pTrc99A enzyme of 10ng is cut product, and the alsS enzyme of 30ng is cut DNA fragmentation, and 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 10 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows on carrier pTrc99A, to have inserted acetolactate synthase gene alsS, proves that plasmid construction is correct, by the expression plasmid called after pXZ627 obtaining.

Second step, the acetolactate synthase gene ilvBN-Ec in clone intestinal bacteria source is to pTrc99A.

The intestinal bacteria MG1655 genomic dna of take is template, with primer ilvBNEc-F-EcoRI/ilvBNEc-R-PstI (SEQ ID NO:67/SEQ ID NO:68), carry out pcr amplification, amplified production is colibacillary acetolactate synthase gene ilvBN-Ec.Primer sequence is in Table 2.

Amplified production is acetolactate synthase gene ilvBN-Ec, and PCR product carries out EcoRI (purchased from NEB company) and PstI (purchased from NEB company) enzyme is cut, and is cloned on the pTrc99A expression vector of cutting through same enzyme enzyme.

Linked system is: the pTrc99A enzyme of 10ng is cut product, and the ilvBN-Ec enzyme of 30ng is cut DNA fragmentation, and 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 10 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100ug/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows on carrier pTrc99A, to have inserted acetolactate synthase gene ilvBN-Ec, proves that plasmid construction is correct, by the expression plasmid called after pXZ628 obtaining.

The 3rd step, clone ilvBN-Ec mutant is to pTrc99A.

Take plasmid pXZ628 as template, design primer ilvBNEcM-F/ilvBNEcM-R (SEQ ID NO:71/SEQ IDNO:72), primer sequence is in Table 2.The DNA cloning fragment that pcr amplification obtains is carried out phosphatizing treatment, certainly the plasmid clone of getting continuously ilvBN-Ec mutant ilvBN-EcM gene.

98 ℃ of denaturations of amplification condition 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 30 seconds (30 circulations); 72 ℃ are extended 7 minutes (1 circulation).

Concrete steps are as follows: first the product of pcr amplification is cleaned to (Gel/PCR ExtrationKit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, immediately as for 2 minutes on ice.Add 250 μ lLB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100ug/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted acetolactate synthestase mutant ilvBN-EcM gene on carrier pTrc99A, proves that plasmid construction is correct, by the expression plasmid called after pXZ630 obtaining.

The 4th step, the acetolactate synthase gene ilvBN-Cg in clone Corynebacterium glutamicum ATCC13032 source is to pTrc99A.

The Corynebacterium glutamicum ATCC13032 genomic dna of take is template, with primer ilvBNCg-F-EcoRI/ilvBNCg-R-HindIII (SEQ ID NO:69/SEQ ID NO:70), the acetolactate synthestase ilvBN-Cg gene that amplified production is Corynebacterium glutamicum.Primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 52 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 40 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

Amplified production is the acetolactate synthase gene ilvBN-Cg in Corynebacterium glutamicum source, PCR product carries out EcoRI (purchased from NEB company) and HindIII (purchased from NEB company) enzyme is cut, and is cloned on the pTrc99A expression vector of cutting through same enzyme enzyme.

Linked system is: the pTrc99A enzyme of 10ng is cut product, and the ilvBN-Cg enzyme of 30ng is cut DNA fragmentation, and 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 10 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200ul bacterium liquid is coated on the LB flat board that contains penbritin, after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows on carrier pTrc99A, to have inserted acetolactate synthestase ilvBN-Cg gene, proves that plasmid construction is correct, by the expression plasmid called after pXZ629 obtaining.

The 5th step, clone ilvBN-Cg mutant is to pTrc99A.

Take plasmid pXZ629 as template, design primer ilvBNCgM-F/ilvBNCgM-R (SEQ ID NO:73/SEQID NO:74), primer sequence is in Table 2.The DNA cloning fragment that pcr amplification obtains is carried out phosphatizing treatment, certainly the plasmid clone of getting continuously ilvBN-Cg mutant ilvBN-CgM gene.

Concrete steps are as follows: first the product of pcr amplification is cleaned to (Gel/PCR Extration Kit, purchased from BioMIGA Bioisystech Co., Ltd) with PCR purification kit; Get the pcr amplification product after 30ng purifying, add 2 μ l 10XT4 to connect damping fluid (NEB company), 1 μ l T4 polynucleotide kinase (NEB company), supplement distilled water to 20 μ l, 37 ℃ are reacted 30 minutes; Add 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), room temperature reaction obtains connecting product for 2 hours; Get 5 μ l connection products and add in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, immediately as for 2 minutes on ice.Add 250 μ lLB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100ug/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted acetolactate synthestase mutant ilvBN-CgM gene on carrier pTrc99A, proves that plasmid construction is correct, by the expression plasmid called after pXZ631 obtaining.

The 6th step, expresses each acetolactate synthestase, measures enzyme and lives.

Zymoprotein sample preparation condition is: transform respectively pXZ627, pXZ628, pXZ629, pXZ630 and pXZ631 to Trans10 competent cell (purchased from Beijing Quanshijin Biotechnology Co., Ltd).

Concrete operations are: get 1 μ l plasmid and add 50 μ l Trans10 competent cells, ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100 μ g/ml), after incubated overnight, select 1 single bacterium colony of the positive, be inoculated into 3ml LB and add the penbritin that final concentration is 100 μ g/l, 37 ℃, 220rpm are cultivated 12h, take final concentration as OD550=0.1 is inoculated into 30ml LB, and adding final concentration is penbritin and the 0.1mMIPTG of 100 μ g/l, 37 ℃, 220rpm inducing culture 4h.The centrifugal 5min collecting cell of 8000rpm; 0.05M Tris-HCl washes 2 times, is heavily dissolved in 3ml Tris-HCl.Ultrasonication cell; 12000rpm, 4 ℃ of centrifugal cell precipitations that go.With Bio-Rad protein quantification test kit, carry out protein quantification.

AlsS enzymic activity detection reaction system is: reaction buffer 980 μ l (potassiumphosphate pH 7.0,100 μ M, Potassium pyruvate 20 μ M, MgCl ₂10 μ M, thiaminpyrophosphate (purchased from sigma company) 80 μ g/ml), add 20 μ l enzyme liquid.37 ℃, reaction 30min, adds 100 μ l 18M H ₂sO ₄termination reaction.Blank is that reaction buffer adds H ₂sO ₄after termination reaction, add zymoprotein liquid 20 μ l.12000rpm, 4 ℃ of centrifugal Deproteinization precipitations.

Other four kinds of acetolactate synthestase enzymic activity detection reaction systems are: reaction buffer 980 μ l (potassiumphosphate pH7.6,100mM, FAD (purchased from sigma company) 20 μ g/ml, DTT 0.5mM, EDTA 10mM, MgCl ₂10mM, thiaminpyrophosphate (purchased from sigma company) 30 μ g/ml, Potassium pyruvate 20 μ M), add 20 μ l enzyme liquid.37 ℃, reaction 30min, adds 100 μ l 18M H ₂sO ₄termination reaction.Blank is that reaction buffer adds H ₂sO ₄after termination reaction, add zymoprotein liquid 20 μ l.12000rpm, 4 ℃ of centrifugal Deproteinization precipitations.

Product acetylactis assay: get 200 μ l supernatants and sequentially add 800 μ l 0.45M NaOH, 1ml arginine and 1ml naphthyl alcohol, 37 ℃ of reaction 15min.Use ultraviolet spectrophotometer at 530nm place, to detect absorption peak; OD ₅₃₀=0.4 is equivalent to have in 3ml the acetylactis of 60nM to generate.Carry out α-amino-isovaleric acid and suppress to test while detecting, added the α-amino-isovaleric acid that final concentration is 10mM in enzymic activity detection reaction system, other conditions are all identical.

Enzyme activity unit is defined as: the acetylactis μ M number that the catalysis of the every mg albumen of per minute forms.

When there is no α-amino-isovaleric acid inhibitor, AlsS enzyme activity unit number is 0.98U/mg albumen, and while having α-amino-isovaleric acid inhibitor to exist, AlsS enzyme activity unit number is 0.54U/mg albumen.

When there is no α-amino-isovaleric acid inhibitor, IlvBN-Ec enzyme activity unit number is 0.097U/mg albumen, and IlvBN-EcM enzyme activity unit number is 0.004U/mg albumen; While having α-amino-isovaleric acid inhibitor to exist, IlvBN-Ec enzyme activity unit number is 0.001U/mg albumen, and IlvBN-EcM enzyme activity unit number is 0.002U/mg albumen.

When there is no α-amino-isovaleric acid inhibitor, IlvBN-Cg enzyme activity unit number is 0.009U/mg albumen, and IlvBN-CgM enzyme activity unit number is 0.008U/mg albumen; While having α-amino-isovaleric acid inhibitor to exist, IlvBN-Cg enzyme activity unit number is 0.002U/mg albumen, and IlvBN-CgM enzyme activity unit number is 0.003U/mg albumen

(2) integrate the acetolactate synthase gene of subtilis

The acetolactate synthestase encoding gene alsS of subtilis is incorporated into the propionate kinase encoding gene tdcD site of AS74, and improves its expression intensity, total following five steps:

The first step, carries out the acetolactate synthestase encoding gene alsS pcr amplification reaction of subtilis.

With subtilis (Bacillus subtilis 168, from ATCC, is numbered 23857) genomic dna, be template, use primer alsS-F-SacI/alsS-R-BamHI, the acetolactate synthestase encoding gene alsS of amplification subtilis.

Amplified production is acetolactate synthestase encoding gene alsS.

Second step, take pXZ641 plasmid DNA as template, with primer XZ-tdcDE-1/XZ-tdcDE-2, carries out pcr amplification, obtains the DNA cloning fragment of pXZ641 plasmid.

The 3rd step, is connected to second step pcr amplification product by the DNA fragmentation of the acetolactate synthestase encoding gene alsS of subtilis.

Linked system is: the second step pcr amplification product of 10ng, and the alsS DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (alsS DNA fragmentation is cloned into the plasmid in pXZ641) and carry out sequence verification, sequencing result shows to have inserted the acetolactate synthestase encoding gene alsS of subtilis on carrier pXZ641, proof plasmid construction is correct, by the plasmid called after pXZ649 obtaining.

The 4th step, take pXZ642 plasmid DNA as template, with primer XZ-tdcDE-up/XZ-tdcDE-down, carries out pcr amplification, obtains the DNA cloning fragment I of pXZ642 plasmid.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 53 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

The DNA cloning fragment I of pXZ642 plasmid is used for to homologous recombination for the first time.The DNA cloning fragment electricity of plasmid pXZ642 is gone to the strains A S74 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Doweret al., 1988) with the strains A S74 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-tdcDE-up/XZ-tdcDE-down to verify, the fragment that correct bacterium colony amplified production is 5007bp).Select a correct single bacterium colony, obtain strains A S74 (tdcDE::cat-sacB).

The 5th step, take pXZ649 plasmid DNA as template, with primer XZ-tdcDE-up/XZ-tdcDE-down, carries out pcr amplification, obtains the DNA cloning fragment II of pXZ649 plasmid.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 53 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

The DNA cloning fragment II of pXZ649 plasmid is used for to homologous recombination for the second time.

Electricity turns condition: first prepare AS74 (tdcDE::cat-sacB) Electroporation-competent cells (Dower et al., 1988) with pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (use primer XZ-tdcDE-up/XZ-tdcDE-down to verify, correct bacterium colony amplified production is the fragment of 3476bp left and right), select a correct single bacterium colony, by its called after strains A S75 (table 1).

The primer is in Table 2, and constructed plasmid is in Table 3.

(3) regulation and control of acetolactate synthestase encoding gene alsS

The alsS genetic expression intensity of strains A S75 is regulated to M1-93, M1-37, M1-46, M1-30, M1-64 and M1-12 artificial regulatory element (CN201110155176.0; Lu et al., 2012), the primer is in Table 2.

Improve the expression intensity of the acetolactate synthestase encoding gene alsS of subtilis, altogether following two steps:

The first step, take pXZ642 as template, uses primer XZ-tdcDE-up/alsS-sacB-down (SEQ ID NO:43/SEQ ID NO:56) amplification of DNA fragments I, for homologous recombination for the first time.Primer sequence is in Table 2.

Gained DNA cloning fragment I electricity is gone to the strains A S75 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Doweret al., 1988) with the strains A S75 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-tdcDE-up/alsS-sacB-down to verify, the fragment that correct bacterium colony amplified production is 3880bp).Select a correct single bacterium colony, by its called after AS76.

Second step, M1-93, M1-37, M1-46, M1-30, M1-64 and M1-12DNA (CN201110155176.0 in the promotor M-Lib1 library that beta-galactosidase enzymes (lacZ) gene locus on intestinal bacteria ATCC8739 karyomit(e) builds with this laboratory respectively; Lu et al., 2012) be template, use primer tdcDE-up-P/alsS-RBS-down (SEQ ID NO:57/SEQ ID NO:59) amplification for the promoter fragment of second step homologous recombination, primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 15 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the promoter fragment for second step homologous recombination.By the DNA fragmentation of amplification respectively electricity go to the strains A S76 with pKD46 plasmid.

Electricity turns condition: first prepare the AS76 Electroporation-competent cells (Dower et al., 1988) with pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng for the promoter dna fragment of second step homologous recombination, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking, (use primer tdcDE-up-P/alsS-R-BamHI to verify, correct bacterium colony amplified production is the fragment of 1916bp left and right), select a correct single bacterium colony, by its called after strains A S77,78,79,80,81 and 82 (table 1).

Embodiment 8, use recombination bacillus coli AS77-82 produce isopropylcarbinol

Method I:AS77-82 aerobic fermentation is produced isopropylcarbinol

Result: aerobic fermentation 24 hours, AS77 has produced the isopropylcarbinol of 47.97mM, and sugar alcohol transformation efficiency is 0.34mol/mol; AS78 has produced the isopropylcarbinol of 1.75mM, and sugar alcohol transformation efficiency is 0.045mol/mol; AS79 has produced the isopropylcarbinol of 43.41mM, and sugar alcohol transformation efficiency is 0.32mol/mol; AS80 has produced the isopropylcarbinol of 41.67mM, and sugar alcohol transformation efficiency is 0.33mol/mol; AS81 has produced the isopropylcarbinol of 38.32mM, and sugar alcohol transformation efficiency is 0.31mol/mol; AS82 has produced the isopropylcarbinol of 32.49mM, and sugar alcohol transformation efficiency is 0.30mol/mol.

Method II:AS77-82 anaerobically fermenting is produced isopropylcarbinol

Result: anaerobically fermenting 6 days, AS77 has produced the isopropylcarbinol of 25mM, and sugar alcohol transformation efficiency is 0.52mol/mol; AS78 has produced the isopropylcarbinol of 5mM, and sugar alcohol transformation efficiency is 0.25mol/mol; AS79 has produced the isopropylcarbinol of 24mM, and sugar alcohol transformation efficiency is 0.5mol/mol; AS80 has produced the isopropylcarbinol of 22mM, and sugar alcohol transformation efficiency is 0.65mol/mol; AS81 has produced the isopropylcarbinol of 23mM, and sugar alcohol transformation efficiency is 0.54mol/mol; AS82 has produced the isopropylcarbinol of 17mM, and sugar alcohol transformation efficiency is 0.48mol/mol.

The structure of embodiment 9, recombination bacillus coli AS84-AS89

(1) subtilis alsS gene is in the integration in ldhA site.

LdhA site by the alsS gene integration of subtilis at AS74, obtains strains A S83 (table 1).The primer is in Table 2, and constructed plasmid is in Table 3.

The acetolactate synthestase encoding gene alsS of subtilis is incorporated into the lactic dehydrogenase enzyme coding gene ldhA site of AS74, and improves its expression intensity, total following five steps:

The first step, carries out the acetolactate synthestase encoding gene alsSPCR amplified reaction of subtilis.

With subtilis, (Bacillus subtilis 168, ATCC23857) genomic dna is template, uses primer alsS-F-SacI/alsS-R-BamHI, the acetolactate synthestase encoding gene alsS of amplification subtilis.

Amplification system is: NewEngland Biolabs Phusion 5X damping fluid 10 μ l, dNTP (every kind of each 10 mM of dNTP) 1 μ l, DNA profiling 20ng, each 2 μ l of primer (10 μ M), Phusion High-Fidelity archaeal dna polymerase (2.5U/ μ l) 0.5 μ l, distilled water 33.5 μ l, cumulative volume is 50 μ l.

Amplified production is acetolactate synthestase encoding gene alsS.

Second step, take pXZ001 plasmid DNA as template, with primer XZ-ldhA-1/XZ-ldhA-2, carries out pcr amplification, obtains the DNA cloning fragment of pXZ001 plasmid.

Linked system is: the second step pcr amplification product of 10ng, and the alsSDNA fragment of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (alsS DNA fragmentation is cloned into the plasmid in pXZ001) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proof plasmid construction is correct, by the recombinant plasmid called after pXZ664 (Fig. 4) obtaining.

The 4th step, take pXZ002 plasmid DNA as template, with primer XZ-ldhA-up/XZ-ldhA-down, carries out pcr amplification, obtains the DNA cloning fragment I of pXZ002 plasmid.

The DNA cloning fragment I of pXZ002 plasmid is used for to homologous recombination for the first time.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the AS74 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-ldhA-up/XZ-ldhA-down to verify, the fragment that correct bacterium colony amplified production is 3859bp).Select a correct single bacterium colony, obtain strains A S74 (ldhA::cat-sacB).

The 5th step, take pXZ664 plasmid DNA as template, with primer XZ-ldhA-up/XZ-ldhA-down, carries out pcr amplification, obtains the DNA cloning fragment II of pXZ664 plasmid.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 45 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

The DNA cloning fragment II of pXZ664 plasmid is used for to homologous recombination for the second time.The DNA cloning fragment electricity of plasmid pXZ664 is gone to the strains A S74 (ldhA::cat-sacB) that transforms pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S74 (ldhA::cat-sacB) of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (using primer XZ-ldhA-up/XZ-ldhA-down to verify, the fragment that correct bacterium colony amplified production is 2545bp), select a correct single bacterium colony, by its called after strains A S83 (table 1).

The primer is in Table 2, and constructed plasmid is in Table 3.

(2) regulation and control of acetolactate synthestase encoding gene alsS

The alsS genetic expression intensity of strains A S83 is regulated to M1-93, M1-37, M1-46, M1-30, M1-64 and M1-12, obtains strains A S84,85,86,87,88 and 89.The primer is in Table 2.

The first step, take pXZ002 as template, uses primer XZ-ldhA-up and alsS-sacB-down amplification of DNA fragments I, for homologous recombination for the first time.Primer sequence is in Table 2.

Gained DNA cloning fragment I electricity is gone to the strains A S83 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S83 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-ldhA-up/alsS-sacB-down to verify, the fragment that correct bacterium colony amplified production is 3500bp).Select a correct single bacterium colony, obtain strains A S83 (ldhA::cat-sacB-alsS).

Second step, M1-93, M1-37, M1-46, M1-30, M1-64 and M1-12DNA (CN201110155176.0 in the promotor M-Lib1 library that beta-galactosidase enzymes (lacZ) gene locus on intestinal bacteria ATCC8739 karyomit(e) builds with this laboratory respectively; Lu et al., 2012) be template, use primer ldhA-up-P/alsS-RBS-down (SEQ ID NO:58/SEQ ID NO:59) amplification for the promoter fragment of second step homologous recombination, primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 10 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the promoter fragment for second step homologous recombination.By the DNA fragmentation of amplification respectively electricity go to the strains A S83 (ldhA::cat-sacB-alsS) with pKD46 plasmid.

Electricity turns condition: first prepare Electroporation-competent cells (the Dower et al. with the AS83 (ldhA::cat-sacB-alsS) of pKD46 plasmid, 1988), 50 μ l competent cells are placed on ice, add 50ng for the promoter dna fragment of second step homologous recombination, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking, (use primer ldhA-up-P/alsS-R-BamHI to verify, correct bacterium colony amplified production is the fragment of 1916bp left and right), select a correct single bacterium colony, by its called after strains A S84,85,86,87,88 and 89 (table 1).

Embodiment 10, use recombination bacillus coli AS84-AS89 produce isopropylcarbinol

Method I:AS84-AS89 aerobic fermentation is produced isopropylcarbinol

Result: aerobic fermentation 24 hours, AS84 has produced the isopropylcarbinol of 30.8mM, and sugar alcohol transformation efficiency is 0.17mol/mol; AS85 has produced the isopropylcarbinol of 13.1mM, and sugar alcohol transformation efficiency is 0.18mol/mol; AS86 has produced the isopropylcarbinol of 38.2mM, and sugar alcohol transformation efficiency is 0.45mol/mol; AS87 has produced the isopropylcarbinol of 27.2mM, and sugar alcohol transformation efficiency is 0.15mol/mol; AS88 has produced the isopropylcarbinol of 47.7mM, and sugar alcohol transformation efficiency is 0.36mol/mol; AS89 has produced the isopropylcarbinol of 23.5mM, and sugar alcohol transformation efficiency is 0.27mol/mol.

Method II:AS84-AS89 anaerobically fermenting is produced isopropylcarbinol

Result: anaerobically fermenting 6 days, AS84 has produced the isopropylcarbinol of 27.7mM, and sugar alcohol transformation efficiency is 0.45mol/mol; AS85 has produced the isopropylcarbinol of 17.8mM, and sugar alcohol transformation efficiency is 0.42mol/mol; AS86 has produced the isopropylcarbinol of 28mM, and sugar alcohol transformation efficiency is 0.5mol/mol; AS87 has produced the isopropylcarbinol of 28.8mM, and sugar alcohol transformation efficiency is 0.51mol/mol; AS88 has produced the isopropylcarbinol of 32.9mM, and sugar alcohol transformation efficiency is 0.58mol/mol; AS89 has produced the isopropylcarbinol of 19.1mM, and sugar alcohol transformation efficiency is 0.38mol/mol.

The structure of embodiment 11, recombination bacillus coli AS105

LdhA site by the alsS gene integration of subtilis at AS77, and its expression intensity is regulated to M1-64, obtain strains A S105, altogether following two steps:

The first step, take pXZ002 plasmid DNA as template, with primer XZ-ldhA-up/XZ-ldhA-down, carries out pcr amplification, obtains the DNA cloning fragment I of pXZ002 plasmid.

The DNA cloning fragment I of pXZ002 plasmid is used for to homologous recombination for the first time, and electricity goes to the strains A S77 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S77 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-ldhA-up/XZ-ldhA-down to verify, the fragment that correct bacterium colony amplified production is 3859bp).Select a correct single bacterium colony, obtain strains A S90.

Second step, take AS88 genomic dna as template, with primer XZ-ldhA-up/XZ-ldhA-down, carries out pcr amplification, and the DNA cloning fragment II obtaining is for homologous recombination for the second time.

Gained fragment II electricity is gone to the strains A S90 that transforms pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Doweret al., 1988) with the strains A S90 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (use primer XZ-ldhA-up/XZ-ldhA-down to verify, correct bacterium colony amplified production is the fragment of 2545bp left and right), select a correct single bacterium colony, by its called after strains A S105 (table 1).

Embodiment 12, use recombination bacillus coli AS105 produce isopropylcarbinol

Method I:AS105 aerobic fermentation is produced isopropylcarbinol

Result: aerobic fermentation 24 hours, AS105 has produced the isopropylcarbinol of 65mM, and sugar alcohol transformation efficiency is 0.41mol/mol (Fig. 3).

Method II:AS105 anaerobically fermenting is produced isopropylcarbinol

Result: anaerobically fermenting 6 days, AS105 has produced the isopropylcarbinol of 26mM, and sugar alcohol transformation efficiency is 0.66mol/mol (Fig. 3).

The structure of embodiment 13, recombination bacillus coli AS108

(1) intestinal bacteria ilvC gene is in the integration in mgsA site.

Intestinal bacteria ilvC gene (GenBank No:NP_418222, NC_000913) is incorporated into mgsA (GenBank No:ACA78263.1) site of AS105.The primer is in Table 2, and constructed plasmid is in Table 3.

Colibacillary Acetohydroxy acid isomeroreductase encoding gene ilvC is incorporated into the methylglyoxal synthase encoding gene mgsA site of AS105, and improves its expression intensity, total following seven steps:

The first step, intestinal bacteria (the Escherichia coli ATCC8739) genomic dna of take is template, with primer XZ-mgsA-up/XZ-mgsA-down (SEQ ID NO:47/SEQ ID NO:48), carry out pcr amplification, obtain the DNA fragmentation of methylglyoxal synthase encoding gene mgsA and upstream and downstream 400bp thereof left and right, by extension amplification outcome to pEASY-Blunt cloning vector.

Clone body is: 1 μ l pcr amplification product, 1 μ l pEASY-Blunt cloning vector, mixing, room temperature reaction add after 5 minutes in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) gently, ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted methylglyoxal synthase encoding gene and each 400 left and right bases of upstream and downstream thereof on carrier pEASY-Blunt, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ071 obtaining.

Second step, take pXZ071 plasmid DNA as template, with primer XZ-mgsA-1/XZ-mgsA-2 (SEQ ID NO:49/SEQ ID NO:50), carries out pcr amplification, obtains the DNA cloning fragment of pXZ071 plasmid.

cat-sacB-up：GGAGAAAATACCGCATCAGG(SEQ ID NO：11)

cat-sacB-down：GCGTTGGCCGATTCATTA(SEQ ID NO：12)。

Linked system is: the second step pcr amplification product of 10ng, and the cat-sacB DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (cat-sacB DNA fragmentation is cloned into the plasmid in pXZ071) and carry out sequence verification, sequencing result has connected cat-sacB DNA fragmentation on the pcr amplification product of above-mentioned second step, proves that plasmid construction is correct, by the recombinant plasmid called after pXZ072 obtaining.

The 4th step, take pXZ072 plasmid DNA as template, with primer XZ-mgsA-up/XZ-mgsA-down, carries out pcr amplification, obtains the DNA cloning fragment I of pXZ072 plasmid.

The DNA cloning fragment I of pXZ072 plasmid is used for to homologous recombination for the first time.The DNA cloning fragment I electricity of plasmid pXZ072 is gone to the strains A S105 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S105 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ngDNA fragment I, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-mgsA-up/XZ-mgsA-down to verify, the fragment that correct bacterium colony amplified production is 3867bp).Select a correct single bacterium colony, obtain strains A S105 (mgsA::cat-sacB).

The 5th step, carries out colibacillary Acetohydroxy acid isomeroreductase encoding gene ilvCPCR amplified reaction.

Intestinal bacteria (the Escherichia coli ATCC8739) genomic dna of take is template, with primer ilvC-F-BamHI/ilvC-R-PstI (SEQ ID NO:51/SEQ ID NO:52), colibacillary Acetohydroxy acid isomeroreductase encoding gene ilvC increases.

Amplified production is Acetohydroxy acid isomeroreductase encoding gene ilvC.

The 6th step, is connected to second step pcr amplification product by the DNA fragmentation of Acetohydroxy acid isomeroreductase encoding gene ilvC.

Linked system is: the second step pcr amplification product of 10ng, and the ilvC DNA fragmentation of 30ng, 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains kantlex (final concentration is 15 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid (ilvC DNA fragmentation is cloned into the plasmid in pXZ071) and carry out sequence verification, sequencing result shows to have inserted colibacillary Acetohydroxy acid isomeroreductase encoding gene ilvC on carrier pXZ071, proof plasmid construction is correct, by the plasmid called after pXZ670 obtaining.

The 7th step, take pXZ670 plasmid DNA as template, with primer XZ-mgsA-up/XZ-mgsA-down, carries out pcr amplification, obtains the DNA cloning fragment II of pXZ670 plasmid.

The DNA cloning fragment II of pXZ670 plasmid is used for to homologous recombination for the second time, the DNA cloning fragment II electricity of plasmid pXZ670 is gone to the strains A S105 (mgsA::cat-sacB) that transforms pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S105 (mgsA::cat-sacB) of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA fragmentation II, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (use primer XZ-mgsA-up/XZ-mgsA-down to verify, correct bacterium colony amplified production is the fragment of 2452bp left and right), select a correct single bacterium colony, by its called after strains A S105 (mgsA::ilvC).

(2) regulation and control of acetyl hydroxyl reduction isomerase ilvC gene

IlvC gene (GenBank No:NP_418222, NC_000913) expression intensity is regulated to M1-93, M1-37, M1-46, M1-30, obtains strains A S106,107,108 and 109.The primer is in Table 2.

Operation is carried out in two steps:

The first step, take pXZ072 as template, uses primer XZ-mgsA-up/ilvC-sacB-down (SEQ ID NO:47/SEQ ID NO:60) amplification of DNA fragments, for homologous recombination for the first time.Primer sequence is in Table 2.

Gained DNA cloning fragment electricity is gone to the strains A S105 (mgsA::ilvC) with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the AS105 (mgsA::ilvC) of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng DNA cloning fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17 μ g/ml), after 37 ℃ of incubated overnight, select 5 single bacterium colonies and carry out PCR checking (using primer XZ-mgsA-up/ilvC-sacB-down to verify, the fragment that correct bacterium colony amplified production is 3506bp).Select a correct single bacterium colony, obtain strains A S105 (mgsA::cat-sacB-ilvC).

Second step, in the promotor M-Lib1 library that beta-galactosidase enzymes (lacZ) gene locus of this laboratory on intestinal bacteria ATCC8739 karyomit(e) of take respectively builds, M1-93, M1-37, M1-46 and M1-30DNA are template, use primer mgsA-up-P/ilvC-RBS-down (SEQ ID NO:61/SEQ ID NO:62) amplification for the promoter fragment of second step homologous recombination, primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute 10 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the promoter fragment for second step homologous recombination.By the DNA fragmentation of amplification respectively electricity go to the strains A S 105 (mgsA::cat-sacB-ilvC) with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S105 (mgsA::cat-sacB-ilvC) of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng amplification gained promoter dna fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 4 hours for 30 ℃.Bacterium liquid is transferred to the LB liquid nutrient medium that there is no sodium-chlor (filling 50ml substratum in 250ml flask) that contains 10% sucrose, cultivate after 24 hours contain on the LB solid medium that there is no sodium-chlor of 6% sucrose streak culture.Through PCR checking (use primer mgsA-up-P/ilvC-R-PstI to verify, correct bacterium colony amplified production is the fragment of 1676bp left and right), select a correct single bacterium colony, by its called after strains A S106-109 (table 1).

Embodiment 14, use recombination bacillus coli AS108 produce isopropylcarbinol

Method I:AS108 aerobic fermentation is produced isopropylcarbinol

Result: aerobic fermentation 24 hours, AS108 has produced the isopropylcarbinol of 114mM, and sugar alcohol transformation efficiency is 0.51mol/mol (Fig. 3).

Method II:AS108 anaerobically fermenting is produced isopropylcarbinol

Result: anaerobically fermenting 6 days, AS108 has produced the isopropylcarbinol of 35mM, and sugar alcohol transformation efficiency is 0.66mol/mol (Fig. 3).

The structure of embodiment 15, recombination bacillus coli AS142-AS145

The expression intensity of the pyridine nucleotide transhydrogenase gene pntAB (GenBank No:NC_000913.2) of AS108 is regulated to M1-93, M1-37, M1-46 and M1-30, obtains strains A S142-AS145 (table 1).The primer sequence is in Table 2.Concrete steps are:

With M1-93, M1-37, M1-46 and M1-30 (CN201110155176.0 in the promotor M-Lib1 library that beta-galactosidase enzymes (lacZ) gene locus builds on intestinal bacteria ATCC8739 karyomit(e), this laboratory; Lu et al., 2012) four kinds of different promoter DNAs are template (sequence is as shown in SEQ ID NO:1-4), and pntAB-up-FRT/pntAB-RBS-down (SEQ ID NO:63/SEQ ID NO:64) primer amplification is for the promoter fragment of homologous recombination.The primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the promoter fragment for homologous recombination.The DNA fragmentation electricity of amplification is gone to the strains A S108 (Dower et al., 1988) with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Doweret al., 1988) with the strains A S108 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng amplification gained promoter dna fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.The bacterium colony that screening can be grown on kantlex plate (kantlex final concentration is 15 μ g/ml), obtains strains A S142,143,144 and 145 (table 1).

Embodiment 16, use recombination bacillus coli AS142-AS145 produce isopropylcarbinol

Method I:AS142-AS145 aerobic fermentation is produced isopropylcarbinol

Result is as shown in table 4.The effect of M1-46 regulation and control pntAB gene is best, and the output of isopropylcarbinol aerobic fermentation improves 21%, and transformation efficiency improves 14%.

Table 4: the expression intensity of regulation and control pyridine nucleotide transhydrogenase gene pntAB improves the ability of the aerobic production isopropylcarbinol of recombination bacillus coli.

^arepresent that the raising of output and productive rate is for AS108.

Method II:AS142-AS146 anaerobically fermenting is produced isopropylcarbinol

Result is as shown in table 5.The effect of M1-30 regulation and control pntAB gene is best, and the output of isopropylcarbinol anaerobically fermenting improves 20%, and transformation efficiency improves 8%.

Table 5: the expression intensity of regulation and control pyridine nucleotide transhydrogenase gene pntAB improves the ability that recombination bacillus coli anaerobism is produced isopropylcarbinol.

^arepresent that the raising of output and productive rate is for AS108.

The structure of embodiment 17, recombination bacillus coli AS147-AS150

The expression intensity of the Nicotinamide Adenine Dinucleotide Kinase gene yfjB (GenBank No:ACA76736.1) of AS108 is regulated to M1-37, M1-46 and M1-30, obtains strains A S147,148 and 149 (table 1).The primer sequence is in Table 2.Concrete steps are:

With M1-37, M1-46 and M1-30 (CN201110155176.0 in the promotor M-Lib1 library that beta-galactosidase enzymes (lacZ) gene locus builds on intestinal bacteria ATCC8739 karyomit(e), this laboratory; Lu et al., 2012) three kinds of different promoter DNAs are template, and yfjB-up-FRT/yfjB-RBS-down (SEQ ID NO:65/SEQ ID NO:66) primer amplification is for the promoter fragment of homologous recombination.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A S108 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng amplification gained promoter dna fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.The bacterium colony that screening can be grown on kantlex plate (kantlex final concentration is 15 μ g/ml), obtains strains A S147,148 and 149 (table 1).

Embodiment 18, use recombination bacillus coli AS147-AS149 produce isopropylcarbinol

Method I:AS147-AS149 aerobic fermentation is produced isopropylcarbinol

The formula of seed culture medium and fermention medium is identical with embodiment 2.Aerobic fermentation method and analysing and detecting method are identical with embodiment 2.Result is as shown in table 6.

Table 6: the expression intensity of regulation and control Nicotinamide Adenine Dinucleotide Kinase gene yfjB improves the ability of the aerobic production isopropylcarbinol of recombination bacillus coli.

^arepresent that the raising of output and productive rate is for AS108.

Method II:AS147-AS149 anaerobically fermenting is produced isopropylcarbinol

The formula of seed culture medium and fermention medium is identical with embodiment 2.Anaerobic fermentation method and analysing and detecting method are identical with embodiment 2.Result is as shown in table 7.

Table 7: the expression intensity of regulation and control Nicotinamide Adenine Dinucleotide Kinase gene yfjB improves the ability that recombination bacillus coli anaerobism is produced isopropylcarbinol.

^arepresent that the raising of output and productive rate is for AS108.

The structure of embodiment 19, recombination bacillus coli AS165-AS168 and AS172-AS175

Use and embodiment 15 and 17 identical methods, the pntAB genetic expression intensity of AS108 is regulated to M1-93, yfjB genetic expression intensity is regulated to M1-37, obtains strains A S165.

The pntAB genetic expression intensity of AS108 is regulated to M1-93, and yfjB genetic expression intensity is regulated to M1-46, obtains strains A S166.

The pntAB genetic expression intensity of AS108 is regulated to M1-93, and yfjB genetic expression intensity is regulated to M1-30, obtains strains A S167.

The pntAB genetic expression intensity of AS108 is regulated to M1-30, and yfjB genetic expression intensity is regulated to M1-37, obtains strains A S172.

The pntAB genetic expression intensity of AS108 is regulated to M1-30, and yfjB genetic expression intensity is regulated to M1-46, obtains strains A S173.

The pntAB genetic expression intensity of AS108 is regulated to M1-30, and yfjB genetic expression intensity is regulated to M1-30, obtains strains A S174.

Embodiment 20, use recombination bacillus coli AS165-AS167 and AS172-AS174 produce isopropylcarbinol

AS165-AS167 and AS172-AS174 anaerobically fermenting are produced isopropylcarbinol

The formula of seed culture medium and fermention medium is identical with embodiment 2.Anaerobic fermentation method and analysing and detecting method are identical with embodiment 2.Result is as shown in table 9.

Table 9: the expression intensity of regulation and control pyridine nucleotide transhydrogenase gene pntAB and Nicotinamide Adenine Dinucleotide Kinase gene yfjB improves the ability that recombination bacillus coli anaerobism is produced isopropylcarbinol.

^arepresent that the raising of output and productive rate is for AS108.

The structure of embodiment 21, recombination bacillus coli AS225-AS226

Use and embodiment 15 and 17 identical methods, the pntAB genetic expression intensity of AS108 is regulated to M1-46, yfjB genetic expression intensity is regulated to M1-37, obtains strains A S225.

The pntAB genetic expression intensity of AS108 is regulated to M1-46, and yfjB genetic expression intensity is regulated to M1-30, obtains strains A S226.

Embodiment 22, use recombination bacillus coli AS225-AS226 produce isopropylcarbinol

AS225-AS226 aerobic fermentation is produced isopropylcarbinol

The formula of seed culture medium and fermention medium is identical with embodiment 2.Aerobic fermentation method and analysing and detecting method are identical with embodiment 2.Result is as shown in table 8.

Table 8: the expression intensity of regulation and control pyridine nucleotide transhydrogenase gene pntAB and Nicotinamide Adenine Dinucleotide Kinase gene yfjB improves the ability of the aerobic production isopropylcarbinol of recombination bacillus coli.

^arepresent that the raising of output and productive rate is for AS108.

The structure of embodiment 23, recombination bacillus coli AS47

The expression intensity of the Nicotinamide Adenine Dinucleotide Kinase gene yfjB (GenBank No:ACA76736.1) of intestinal bacteria ATCC8739 is regulated to M1-30, obtains strains A S47 (table 1).The primer sequence is in Table 2.Concrete steps are:

With M1-30 (CN201110155176.0 in the promotor M-Lib1 library that beta-galactosidase enzymes (lacZ) gene locus builds on intestinal bacteria ATCC8739 karyomit(e), this laboratory; Lu et al., 2012) promoter DNA is template (sequence is as shown in SEQ ID NO:4), and yfjB-up-FRT/yfjB-RBS-down primer amplification is for the promoter fragment of homologous recombination.The primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the promoter fragment for homologous recombination.The DNA fragmentation electricity of amplification is gone to (Doweret al., 1988) in the intestinal bacteria ATCC8739 with pKD46 plasmid

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A TCC8739 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng amplification gained promoter dna fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.The bacterium colony that screening can be grown on kantlex plate (kantlex final concentration is 15 μ g/ml), obtains bacterial strain, obtains strains A S47 (table 1).

The structure of embodiment 24, recombination bacillus coli AS48

The expression intensity of the pyridine nucleotide transhydrogenase gene pntAB (GenBank No:NC_000913.2) of intestinal bacteria ATCC8739 is regulated to M1-64, obtains strains A S48 (table 1).The primer sequence is in Table 2.Concrete steps are:

With M1-64 (CN201110155176.0 in the promotor M-Libl library that beta-galactosidase enzymes (lacZ) gene locus builds on intestinal bacteria ATCC8739 karyomit(e), this laboratory; Lu et al., 2012) promoter DNA is template (sequence is as shown in SEQ ID NO:5), and pntAB-up-FRT/pntAB-RBS-down primer amplification is for the promoter fragment of homologous recombination.The primer sequence is in Table 2.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is the promoter fragment for homologous recombination.The DNA fragmentation electricity of amplification is gone to (Dower et al., 1988) in the intestinal bacteria ATCC8739 with pKD46 plasmid.

Electricity turns condition: first prepare the Electroporation-competent cells (Dower et al., 1988) with the strains A TCC8739 of pKD46 plasmid; 50 μ l competent cells are placed on ice, add 50ng amplification gained promoter dna fragment, place on ice 2 minutes, be transferred to the Bio-Rad electric shock cup of 0.2cm.Use MicroPulser (Bio-Rad company) electroporation apparatus, shock parameters is voltage 2.5kv.After electric shock rapidly by 1ml LB media transfer to electric shock cup, be transferred in test tube after blowing and beating 5 times, 75 turn, and hatch 2 hours for 30 ℃.The bacterium colony that screening can be grown on kantlex plate (kantlex final concentration is 15 μ g/ml), obtains bacterial strain, obtains strains A S48 (table 1).

The structure of embodiment 25, recombination bacillus coli AS50

Use and embodiment 23 and 24 identical methods, the pntAB genetic expression intensity of intestinal bacteria ATCC8739 is regulated to M1-64, yfjB genetic expression intensity is regulated to M1-30, obtains strains A S50.

Embodiment 26, use recombination bacillus coli AS47, AS48 and AS50 produce isopropylcarbinol

Use recombination bacillus coli AS47, AS48 and AS50 produce isopropylcarbinol and divide five steps to carry out:

The first step, plasmid pXZ112 builds.

Carry out the ligation of Lactococcus lactis 2-keto acid decarboxylase gene and intestinal bacteria dihydroxy-acid dehydratase gene.

With Lactococcus lactis (Lactococus lactis IL1403, from ATCC, numbers 7962) genomic dna, be template, use primer kivD-F-KpnI/kivD-R-XbaI, the 2-keto acid decarboxylase encoding gene kivD of amplification Lactococcus lactis.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is 2-keto acid decarboxylase encoding gene kivD, and PCR product carries out XbaI (purchased from NEB company) enzyme and cuts.

With intestinal bacteria MG1655 (from ATCC, numbering 700926) genomic dna, be template, use primer ilvD-F-Xbal/ilvD-R-SalI, the dihydroxy-acid dehydratase gene ilvD of amplification intestinal bacteria MG1655.

Two fragments are carried out ligation.Linked system is: kivD enzyme is cut PCR fragment 20ng, and ilvD enzyme is cut PCR fragment 15ng, 5 μ l 2Xquick ligase damping fluids, and 0.5 μ l Quick T4DNA ligase enzyme (purchased from NEB company), supplements distilled water to 10 μ l.25 ℃, 5 minutes.

The connection product of take is template, uses primer kivD-F-KpnI and ilvD-R-SalI to carry out pcr amplification, to improve the concentration that connects product.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 58 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 1 minute (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).

PCR product is carried out to KpnI (purchased from NEB company) and the reaction of SalI (purchased from NEB company) double digestion.Be cloned on the pTrc99A expression vector of cutting through same enzyme enzyme.

Linked system is: the pTrc99A enzyme of 10ng is cut product, and the pcr amplification enzyme of 30ng is cut product, and 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains penbritin (final concentration is 100 μ g/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows on carrier pTrc99A, to have inserted Lactococcus lactis 2-keto acid decarboxylase gene and intestinal bacteria dihydroxy-acid dehydratase gene, proves that plasmid construction is correct, by the expression plasmid called after pXZ112 (Fig. 7 A) obtaining.

Second step, plasmid pXZ116 builds.

Carry out the ligation of subtilis acetolactate synthase gene and intestinal bacteria Acetohydroxy acid isomeroreductase encoding gene.

With subtilis (Bacillus subtilis 168, from ATCC, numbers 23857) genomic dna, be template, use primer alsS-F-SacI/alsS-R-BamHI, amplification subtilis acetolactate synthase gene alsS.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 59 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is acetolactate synthase gene alsS, and PCR product carries out BamHI (purchased from NEB company) enzyme and cuts.

Intestinal bacteria (the Escherichia coli ATCC8739) genomic dna of take is template, uses primer ilvC-F-BamHI/ilvC-R-PstI, and colibacillary Acetohydroxy acid isomeroreductase encoding gene ilvC increases.

Amplification condition is 98 ℃ of denaturations 2 minutes (1 circulation); 98 ℃ of 10 seconds, 58 ℃ 10 seconds, 72 ℃ extensions of annealing of sex change 30 seconds (30 circulations); 72 ℃ are extended 5 minutes (1 circulation).Amplified production is Acetohydroxy acid isomeroreductase encoding gene ilvC, and PCR product carries out BamHI (purchased from NEB company) enzyme and cuts.

Two fragments are carried out ligation.Linked system is: alsS enzyme is cut PCR fragment 20ng, and ilvC enzyme is cut PCR fragment 15ng, 5 μ l 2Xquick ligase damping fluids, and 0.5 μ l Quick T4DNA ligase enzyme (purchased from NEB company), supplements distilled water to 10 μ l.25 ℃, 5 minutes.

The connection product of take is template, uses primer alsS-F-SacI and ilvC-R-PstI to carry out pcr amplification, to improve the concentration that connects product.

PCR product is carried out to SacI (purchased from NEB company) and the reaction of PstI (purchased from NEB company) double digestion.Be cloned on the pACYC184M expression vector (deriving from Hefei Bai Mai Bioisystech Co., Ltd) of cutting through same enzyme enzyme.

Linked system is: the pACYC184M enzyme of 10ng is cut product, and the pcr amplification enzyme of 30ng is cut product, and 2 μ l 10XT4 connect damping fluid (NEB company), 1 μ l T4 ligase enzyme (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l.Room temperature connects 2 hours, gets 5 μ l and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd), ice bath 30 minutes.42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Getting 200 μ l bacterium liquid is coated on the LB flat board that contains paraxin (final concentration is 17ug/ml), after incubated overnight, select 5 single bacterium colonies of the positive, positive colony is carried out to liquid culture, extract positive colony plasmid and carry out sequence verification, sequencing result shows to have inserted subtilis acetolactate synthase gene and intestinal bacteria Acetohydroxy acid isomeroreductase encoding gene on carrier pACYC184M, proof plasmid construction is correct, by the expression plasmid called after pXZ116 (Fig. 7 B) obtaining.

The 3rd step, transforms the two plasmids of pXZ112 and pXZ116 and divides and be clipped to strains A TCC8739, AS47, AS48 and AS50.

PXZ112 and the two plasmid electricity of pXZ116 are transformed to bacterial strain ATCC8739, AS47, AS48 and AS50.

Transformation system is: 1 μ l pXZ112 and 1ul pXZ116 plasmid mix, and adds in 50 μ l Trans1-T1 competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd) ice bath 30 minutes; 42 ℃ of heat shocks 30 seconds, are placed in 2 minutes on ice immediately.Add 250 μ l LB substratum, 200rpm, hatches 1 hour for 37 ℃.Get 200 μ l bacterium liquid and be coated on the dual anti-flat board of LB that contains penbritin (final concentration is 100 μ g/ml) and paraxin (final concentration is 17 μ g/ml), after incubated overnight, select 1 single bacterium colony of the positive, positive colony is carried out to liquid culture.

The 4th step, is used the intestinal bacteria ATCC8739 that has transformed plasmid, AS47, the aerobic production isopropylcarbinol of AS48 and AS50.

Glucose 20g/L, yeast extract 5g/l, peptone 10g/l, sodium-chlor 10g/l.

Aerobic fermentation, comprises the following steps:

(1) seed culture: in 250ml triangular flask, seed culture medium is 50ml, 115 ℃ of sterilizing 15min.After cooling, according to the inoculum size of 1% (V/V), being inoculated into seed culture medium, is to cultivate and within 12 hours, obtain seed liquor under the condition of 7.0,37 ℃ and 100rpm in pH value, for fermention medium, inoculates.

(2) fermentation culture: in 250ml triangular flask, fermention medium is 25ml, by seed liquor according to final concentration OD ₅₅₀=0.1 inoculum size is inoculated in fermention medium, under the condition of 37 ℃ and 250rpm, is cultured to OD ₅₅₀=0.3, adding final concentration is the IPTG of 0.1mM, proceeds to 30 ℃ and induces fermentation 48 hours with 250rpm, obtains fermented liquid.Fermented liquid is all substances in fermentor tank.

Analytical procedure: use Agilent (Agilent-1200) high performance liquid chromatograph to measure the component in fermented liquid.Glucose in fermented liquid, isopropylcarbinol and organic acid concentration are measured the AminexHPX-87H organic acid analysis column that adopts Bole (Biorad) company.Isopropylcarbinol standard substance are purchased from SIGMA company, and catalog number is 58448.

Result: aerobic fermentation 48 hours, ATCC8739 has produced the isopropylcarbinol of 2.87mM, and sugar alcohol transformation efficiency is 0.014 mol/mol; AS47 has produced the isopropylcarbinol of 2.51mM, and sugar alcohol transformation efficiency is 0.013mol/mol; AS48 has produced the isopropylcarbinol of 4.57mM, and sugar alcohol transformation efficiency is 0.022mol/mol; AS50 has produced the isopropylcarbinol of 13.31mM, and sugar alcohol transformation efficiency is 0.058mol/mol (Fig. 8 A).

The 5th step, is used the intestinal bacteria ATCC8739 that has transformed plasmid, AS47, and AS48 and AS50 anaerobism are produced isopropylcarbinol.

Glucose 20g/L, yeast extract 5g/l, peptone 10g/l, sodium-chlor 10g/l.

Anaerobically fermenting, comprises the following steps:

(2) fermentation culture: in 250ml triangular flask, fermention medium is 25ml, by seed liquor according to final concentration OD ₅₅₀=0.1 inoculum size is inoculated in fermention medium, under the condition of 37 ℃ and 250rpm, is cultured to OD ₅₅₀=0.3, adding final concentration is the IPTG of 0.1mM, proceeds to 30 ℃ and induces and ferment to OD with 250rpm ₅₅₀=9, centrifugal collection thalline, is resuspended in fresh fermention medium 25ml, proceeds to anaerobism bottle 30 ℃ of standing cultivations 4 days, obtains fermented liquid.Fermented liquid is all substances in fermentor tank.(there is no blowing air)

The same aerobic fermentation of analytical procedure.

Result: anaerobically fermenting 48 hours, ATCC8739 has produced the isopropylcarbinol of 0.1mM, and sugar alcohol transformation efficiency is 0.0007mol/mol; AS47 has produced the isopropylcarbinol of 0.08mM, and sugar alcohol transformation efficiency is 0.0005mol/mol; AS48 has produced the isopropylcarbinol of 0.19mM, and sugar alcohol transformation efficiency is 0.0012mol/mol; AS50 has produced the isopropylcarbinol of 0.95mM, and sugar alcohol transformation efficiency is 0.0061mol/mol (Fig. 8 B).

Reference:

Atsumi，S.，Hanai，T.，Liao，J.C.2008.Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels.Nature.451：86-89.

Atsumi，S.，Higashide，W.，Liao，J.C.2009.Direct photosynthetic recycling of carbon dioxide to isobutyraldehyde.Nat.Biotechnol.27：1177-1180.

Baez，A.，Cho，K.M.，Liao，J.C.2011.High-flux isobutanol production using engineered Escherichia coli：a bioreactor study with in situ product removal.Appl.Microbiol.Biotechnol.90：1681-1690.

Bastian，S.，Liu，X.，Meyerowitz，J.T.，Snow，C.D.，Chen，M.M.Y,，Arnold，F.H.2011.Engineered ketol-acid reductoisomerase and alcohol dehydrogenase enable anaerobic 2-methylpropan-1-ol production at theoretical yield in Escherichia coli.Metab.Eng.13：345-352.

Blattner，F.R.Plunkett III，G.，Bleeh，C.A.，Perna，N.T.，Burland，V.，Riley，M.，Collado-Vides，J.，Glasner，J.D.，Rode，C.K.，Mayhew，G.F.，Gregor，J.，Davis，N.W.，Kirkpatrick，H.A.，Goeden，M.A.，Rose，D.J.，Mau，B.，Shao，Y.1997.The Complete Genome Sequence ofEscherichia coli K-12.Science.277：1453-1462.

Blombach，B.，Riester，T.，Wieschalka，S.，Ziert，C.，Youn，J.W.，Wendisch，V.F.，Eikmanns，B.J.2011.Corynebacterium glutamicum Tailored for Efficient Isobutanol Production.Appl.Environ.Microbiol.77：3300-3310.

Chen，X.，Nielsen，K.F.，Borodina，I.，Kielland-Brandt，M.C.，Karhumaa，K.2011.Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism.Biotechnol.Biofuels.4：21.

Connor，M.R.，Liao，J.C.2009.Microbial production of advanced transportation fuels in non-natural hosts.Curr.Opin.Biotech.20：307-315.

Court，D.L.，Sawitzke，J.A.，Thomason，L.C.2002.Genetic engineering using homologous recombination.Annu.Rev.Genet.36：361-388.

Datsenko，K.A.，Wanner，B.L.2000.One-step inactivation of chromosomal genes in Escherichia coli K-12using PCR products.Proc Natl Acad Sci U S A.97：6640-6645.

Dower，W.J.，Miller，J.F.，Ragsdale，C.W.1988.High efficiency transformation of E.coli by high voltage electroporation.Nucleic Acids Res.16：6127-6145.

E.I.DU PONT DE NEMOURS AND COMPANY.2006.Fermentive production of four carbon alcohols.US，PCT/US2006/041602.

Hawkins，A.，Glassner，D.，Wade，J.，Meinhold，P.，Peters，M.，Gruber，P.，Evanko，W.，Aristidou，A.2009.Methods for the economical production of biofuel from biomass.US，PCT/US2008/082159.

Ingram，L.，Aldrich，H.，Borges，A.，Causey，T.，Martinez，A.，Morales，F.，Saleh，A.，Underwood.S.，Yomano.L.，York.S.，Zaldivar.J.，Zhou.S.1999.Enteric bacterial catalysts for fuel ethanol production.Biotechnol.Progr.15：855-866.

Inokuma，K.，Liao，J.C.，Okamoto，M.，Hanai，T.2010.Improvement of isopropanol production by metabolically engineered Escherichia coli using gas stripping.J.Biosci.Bioeng.110：696-701.

Kawai，S.，Mori，S.，Mukai，T.，Hashimoto，W.，Murata，K.2001.Molecular characterization of Escherichia coli NAD kinase.Eur.J.Biochem.268：4359-4365.

Lee，S.Y.，Park，J.H.，Jang，S.H.，Nielsen，L.K.，Kim，J.，Jung，K.S.2008.Fermentative butanol production by clostridia.Biotechnol.Bioeng.101：209-228.

Liao，J.C.，Atsumi，S.，Smith，K.，Shen，R.，Cann，A.，Connor，M.2008.Biofuel production by recombinant microorganisms.US，PCT/US2008/053514.

Lu，J.，Tang，J.，Liu，Y.，Zhu，X.，Zhang，T.，Zhang，X.2012.Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization.Appl.Microbiol.Biotechnol.93：2455-2462.

Macedo，I.C.，Seabra，J.E.A.，Silva，J.E.A.R.2008.Green house gases emissions in the production and use of ethanol from sugarcane in Brazil：The 2005/2006averages and aprediction for 2020.Biomass.Bioenerg.32：582-595.

Morrison，D.1977.Transformation in Escherichia coli：cryogenic preservation of competent cells.J.Bacteriol.132：349-351.

Perlack，R.D.，Wright，L.L.，Turhollow，A.F.，Graham，R.L.，Stokes，B.J.，Erbach，D.C.2005.Biomass as feedstock for a bioenergy and bioproducts industry：the technical feasibility of a billion-ton annual supply.DTIC Document.

Sauer，U.，Canonaco，F.，Heri，S.，Perrenoud，A.，Fischer，E.2004.The soluble and membrane-bound transhydrogenases UdhA and PntAB have divergent functions in NADPH metabolism of Escherichia coli.J.Biol.Chem.279：6613-6619.

Shi，F.，Li，Y.，Li，Y.，Wang，X.2009.Molecular properties，functions，and potential applications of NAD kinases.Acta.Biochim.Biophys.Sin.41：352-361.

Smith，K.M.，Cho，K.M.，Liao，J.C.2010.Engineering Corynebacterium glutamicum for isobutanol production.Appl.Microbiol.Biotechnol.87：1045-1055.

Smith，K.M.，Liao，J.C.2011.An evolutionary strategy for isobutanol production strain development in Escherichia coli.Metab.Eng.13：674-681.

Thomason，L.，Court，D.L.，Bubunenko，M.，Costantino，N.，Wilson，H.，Amos Oppenheim，A.2003.Recombineering：Genetic Engineering in Bacteria Using Homologous Recombination.Curr Protoc Mol Biol.1：1-12.

Vasudevan，P.T.，Briggs，M.2008.Biodiesel production-current state of the art and challenges.J.Ind.Microbiol.Biot.35：421-430.

Werpy，T.，Petersen，G.，Aden，A.，Bozell，J.，Holladay，J.，White，J.，Manheim，A.，Elliot，D.，Lasure，L.，Jones，S.，Gerber，M.，Ibsen，K.，Lumberg，L.，Kelley，S.2004.Top Value Added Chemicals From Biomass.Volume 1-Results of Screening for Potential Candidates From Sugars and Synthesis Gas.DTIC Document.

Zhang，X.，Jantama，K.，Moore，J.C.，Jarboe，L.R.，Shanmugam，K.T.，Ingram，L.O.2009a.Metabolic evolution of energy-conserving pathways for succinate production in Escherichia coli.Proc.Natl Acad.Sci.106，20180-20185.

Zhang，X.，K.T.Shanmugarn，L.O.Ingram.2010.Fernentation of glycerol to succinate by metabolically engineered strains of Escherichia coli.Appl Environ Microbiol，76：2397-2401.

Claims

1. a recombination bacillus coli, it comprises 2-keto acid decarboxylase, alcoholdehydrogenase, acetolactate synthestase, Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase, it is characterized in that in described intestinal bacteria, the activity of pyridine nucleotide transhydrogenase and Nicotinamide Adenine Dinucleotide Kinase is enhanced simultaneously, and the activity that optionally, is selected from 1,2,3,4 in 2-keto acid decarboxylase, alcoholdehydrogenase, acetolactate synthestase, Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase or 5 kind of enzyme is enhanced.

2. the recombination bacillus coli of claim 1, wherein said 2-keto acid decarboxylase and acetolactate synthestase encoding gene are external sources, and optionally, the alcoholdehydrogenase encoding gene that recombination bacillus coli comprises external source.

3. the recombination bacillus coli of claim 2, wherein Acetohydroxy acid isomeroreductase and dihydroxyacid dehydratase activity are enhanced.

4. the recombination bacillus coli of claim 1-3 any one, the increased activity of wherein said enzyme is by the gene coded sequence of described enzyme being placed under the control of strong promoter and/or increasing one or more copy of described enzyme coding gene.

5. the recombination bacillus coli of claim 4, one or more copy and the optional promotor nucleotide sequence existing of wherein said enzyme coding gene are integrated in the genome of described recombination bacillus coli, or the plasmid that comprises described enzyme coding gene is imported in described recombination bacillus coli.

6. the recombination bacillus coli of claim 4, wherein said strong promoter is selected from the promotor of SEQ ID NO:1,2,3,4 or 5 shown in arbitrary.

7. the recombination bacillus coli of claim 4, it comprises:

(a) Acetohydroxy acid isomeroreductase of increased activity;

(b) dihydroxyacid dehydratase of increased activity;

(c) external source is for example from the 2-keto acid decarboxylase of Lactococcus lactis;

(d) external source is for example from the acetolactate synthestase of subtilis; And

Under the pyridine nucleotide transhydrogenase encoding gene pntAB gene of described recombination bacillus coli is placed in strong promoter for example the promotor shown in SEQID NO:1,2,3,4 or 5 is controlled; And under Nicotinamide Adenine Dinucleotide Kinase encoding gene yfjB is placed in strong promoter for example the promotor shown in SEQ ID NO:1,2,3,4 or 5 controlled.

8. the recombination bacillus coli of claim 1-7 any one, the activity that is selected from one or more following endogenous enzyme in wherein said intestinal bacteria is lowered, for example, by inactivation:

(i) serum lactic dehydrogenase;

(ii) pyruvate formate-lyase;

(iii) fumaric reductase;

(iv) phosphate acetyltransferase;

(v) E.C. 2.7.2.1;

(vi) ethanol dehydrogenase;

(vii) propionate kinase;

(viii) formate acetyltransferase; With

(ix) methylglyoxal synthase.

9. the recombination bacillus coli of claim 8, it comprises:

(e) the acetolactate synthestase encoding gene alsS of subtilis, it is incorporated into respectively described recombination bacillus coli chromosomal propionate kinase encoding gene tdcD site and lactic dehydrogenase enzyme coding gene ldhA site, and is placed in respectively under the promotor control shown in SEQ ID NO:1 and 5; And

The original promotor of the pyridine nucleotide transhydrogenase encoding gene pntAB gene of described recombination bacillus coli is replaced by the promotor shown in SEQ ID NO:1,3,4 or 5; And the original promotor of Nicotinamide Adenine Dinucleotide Kinase encoding gene yfjB is replaced by the promotor shown in SEQ ID NO:2,3 or 4; And

10. the application of the recombination bacillus coli described in claim 1-9 any one in producing isopropylcarbinol.

11. 1 kinds of methods of producing isopropylcarbinol, comprising:

(a) recombination bacillus coli of fermentation culture claim 1-9 any one;

(b) separated and gather in the crops isopropylcarbinol.

The method of 12. claims 11, wherein

-leavening temperature is 25 ℃-39 ℃;

The pH value of-fermentation system is 6.0-8.0;

-fermentation time is 24 hours-144 hours;

The fermentation inoculum size volume percent of-bacterium liquid inoculation medium is 0.01%-10%, for example 0.01%, 0.3% or 10%;

Fermention medium is the aqueous solution consisting of the following composition: glucose, KH ₂pO ₄, K ₂hPO ₄, (NH ₄) ₂hPO ₄, MgSO ₄7H ₂o and CaCl ₂2H ₂o; FeCl ₃6H ₂o, CoCl ₂6H ₂o, CuCl ₂2H ₂o, ZnCl ₂, Na ₂moO ₄2H ₂o and MnCl ₂4H ₂o.

Wherein

Glucose is 50g/L-150g/L;

KH ₂pO ₄for 0.5g/L-5g/L;

K ₂hPO ₄for 0.5g/L-10g/L;

(NH ₄) ₂hPO ₄for 1g/L-10g/L;

MgSO ₄7H ₂o is 0.1g/L-5g/L;

CaCl ₂2H ₂o is 0.1g/L-5g/L;

FeCl ₃6H ₂o is 0.2 μ g/L-5 μ g/L;

CoCl ₂6H ₂o is 0.05 μ g/L-5 μ g/L;

CuCl ₂2H ₂o is 0.05 μ g/L-5 μ g/L;

ZnCl ₂be 0.05 μ g/L-5 μ g/L;

Na ₂moO ₄2H ₂o is 0.05 μ g/L-5 μ g/L; With

MnCl ₂4H ₂o is 0.05 μ g/L-5 μ g/L.

13. claims 11 or 12 method, wherein said fermentation is aerobic fermentation or anaerobically fermenting.

The method of 14. claims 13, wherein the air flow of aerobic fermentation is 0.1-3.0L/minL.