KR20220025538A - Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof - Google Patents

Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof Download PDF

Info

Publication number
KR20220025538A
KR20220025538A KR1020200106400A KR20200106400A KR20220025538A KR 20220025538 A KR20220025538 A KR 20220025538A KR 1020200106400 A KR1020200106400 A KR 1020200106400A KR 20200106400 A KR20200106400 A KR 20200106400A KR 20220025538 A KR20220025538 A KR 20220025538A
Authority
KR
South Korea
Prior art keywords
acid
carbon monoxide
strain
metabolism
coli
Prior art date
Application number
KR1020200106400A
Other languages
Korean (ko)
Other versions
KR102507457B1 (en
Inventor
정규열
차상학
임현규
김동환
권석무
Original Assignee
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Priority to KR1020200106400A priority Critical patent/KR102507457B1/en
Priority to PCT/KR2021/009403 priority patent/WO2022045590A1/en
Publication of KR20220025538A publication Critical patent/KR20220025538A/en
Application granted granted Critical
Publication of KR102507457B1 publication Critical patent/KR102507457B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/52—Propionic acid; Butyric acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a composition comprising a mutual symbiotic microorganism consortium for producing organic acids at high efficiency from carbon monoxide and a method using same. The development of a microorganism consortium including a carbon monoxide metabolism utilizing strain and an acetic acid metabolism utilizing strain according to the present invention can remarkably improve the production of 3-hydroxypropionic acid (3-HP) and itaconic acid (ITA) from carbon monoxide as well as the stability of carbon monoxide metabolism in the microorganism. Thus, the present invention proposes the utility of carbon monoxide and can increase the economic benefit of 3-HP and ITA produced therefrom, thus finding various applications in the industrial fields of utilizing corresponding products, such as synthetic resins, latex, and food additives.

Description

일산화탄소로부터 유기산을 고효율로 생산하기 위한 상호공생 미생물 컨소시엄을 포함하는 조성물 및 이를 이용한 방법 {Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof}Composition comprising a mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof

본 발명은 일산화탄소로부터 유기산을 고효율로 생산하기 위한 상호공생 미생물 컨소시엄을 포함하는 조성물 및 이를 이용한 방법에 관한 것이다.The present invention relates to a composition comprising a consortium of symbiotic microorganisms for efficiently producing organic acids from carbon monoxide and a method using the same.

미생물을 이용한 특정 물질의 생산방법에 대한 가격경쟁력을 높이기 위해서, 값싸고 풍부한 다양한 탄소원을 사용하려는 연구가 이루어지고 있다. 특히, 일산화탄소는 석유 정제 공정이나 철강 제련 공정에서 발생하는 부생가스에 풍부하게 존재하는 탄소원으로, 부생가스로부터의 수득이 용이하다는 장점 때문에 미생물 발효를 통한 고부가가치 물질 생산에서 매우 잠재력이 높은 탄소원으로 주목을 받고 있다. 특히, 최근 일산화탄소를 자연적으로 대사할 수 있는 일산화탄소 대사균주들이 발견되고 해당 균주들에 관한 연구가 활발히 진행됨에 따라, 미생물 발효를 통한 일산화탄소 유래의 고부가가치 물질 생산기술 개발에 대한 관심이 증가하고 있다.In order to increase the price competitiveness of the production method of a specific substance using microorganisms, research is being conducted to use a variety of cheap and abundant carbon sources. In particular, carbon monoxide is a carbon source abundantly present in the by-product gas generated in the petroleum refining process or the steel smelting process. Because of the advantage of being easy to obtain from the by-product gas, it is noted as a carbon source with high potential in the production of high value-added substances through microbial fermentation. are receiving In particular, as carbon monoxide metabolizing strains that can naturally metabolize carbon monoxide have recently been discovered and research on the strains has been actively conducted, interest in the development of high-value-added material production technology derived from carbon monoxide through microbial fermentation is increasing.

그럼에도, 현재 미생물 발효를 통해서 일산화탄소로부터 고부가가치 물질을 생산하는데에는 기술적인 한계가 있는데, 미생물을 통한 일산화탄소 대사에서의 불안정성과 일산화탄소 대사균주의 유전자 조작에 관한 기술적인 한계가 주요한 원인으로 여겨진다.Nevertheless, there are currently technical limitations in producing high value-added substances from carbon monoxide through microbial fermentation.

특히, 일산화탄소의 독성에 의해 발생되는 일산화탄소 대사 활성의 급격한 저하는 일산화탄소를 기질로 하는 미생물 발효 공정 개발에 있어 매우 큰 문제로 여겨진다. 일산화탄소는 미생물 내에 존재하는 금속 효소의 활성을 저해함으로써 미생물의 호흡이나 DNA 복제, 에너지 생산 등에 영향을 끼치며, 이로 인해 미생물에 대한 독성을 가질 수 있는 것으로 알려졌다. 이러한 일산화탄소의 독성은 미생물의 대사 활성에 치명적인 영향을 미칠 수 있으며, 결과적으로 미생물의 일산화탄소 대사 활성을 급격하게 저하시키는 원인이 된다. 이처럼, 미생물에 대한 일산화탄소의 독성은 안정적이고 지속적인 일산화탄소의 고부가가치 물질로의 전환을 불가능하게 하기 때문에, 일산화탄소를 기질로 하는 미생물 발효 공정 개발에 있어 매우 큰 문제점으로 여겨진다.In particular, the rapid decrease in carbon monoxide metabolic activity caused by the toxicity of carbon monoxide is considered a very big problem in the development of a microbial fermentation process using carbon monoxide as a substrate. It is known that carbon monoxide affects the respiration, DNA replication, and energy production of microorganisms by inhibiting the activity of metal enzymes present in microorganisms, which may have toxicity to microorganisms. The toxicity of carbon monoxide can have a fatal effect on the metabolic activity of microorganisms, and as a result, it causes a sharp decrease in the carbon monoxide metabolic activity of the microorganism. As such, the toxicity of carbon monoxide to microorganisms is considered to be a very big problem in the development of a microbial fermentation process using carbon monoxide as a substrate, since it makes it impossible to convert the carbon monoxide into a high value-added material stably and continuously.

미생물에 대한 일산화탄소의 독성을 저감시키기 위해서는, 일산화탄소 기체로부터 배지로의 물질 전달 제한조건에서 미생물 배양을 수행하는 것이 중요하다. 물질 전달 제한조건이란, 미생물에 의한 일산화탄소 대사 속도가 기체상으로부터 액체상으로의 일산화탄소의 물질 전달 속도보다 빠른 상태를 말하며, 해당 조건에서는 미생물에 의해 빠른 속도로 일산화탄소 대사가 진행되기 때문에 배지 내에 용존 일산화탄소가 거의 존재하지 않아 균주들이 받는 일산화탄소에 의한 독성을 최소화할 수 있다. 따라서, 안정적이고 지속적인 일산화탄소 기반의 미생물 배양을 위해서는, 이러한 일산화탄소의 물질 전달 제한조건의 유지가 중요하다. 하지만, 미생물의 대사 활성은 다양한 원인에 의해 시간이 지남에 따라 점진적으로 저하될 수 있으며, 이는 일산화탄소의 물질 전달 제한조건 유지를 방해하는 요인이 되어왔다.In order to reduce the toxicity of carbon monoxide to microorganisms, it is important to carry out the microbial culture under conditions that limit the mass transfer from carbon monoxide gas to the medium. The mass transfer limiting condition refers to a state in which the rate of carbon monoxide metabolism by microorganisms is faster than the mass transfer rate of carbon monoxide from the gas phase to the liquid phase. Since it is almost nonexistent, it is possible to minimize the toxicity caused by carbon monoxide received by the strains. Therefore, for stable and continuous carbon monoxide-based microbial culture, it is important to maintain these carbon monoxide mass transfer restrictions. However, the metabolic activity of microorganisms can be gradually decreased over time due to various causes, which has been a factor that prevents maintenance of the carbon monoxide mass transfer restriction condition.

일산화탄소 대사균주들에 대한 부족한 유전적 정보나 유전자 조작에서의 어려움 또한 일산화탄소를 기질로 하는 미생물 발효 공정을 통한 고부가가치 물질 생산의 한계점으로 여겨진다. 일산화탄소를 대사하여 아세트산을 주요산물로 생산하는 것으로 알려진 아세토젠의 경우 일산화탄소로부터 고부가가치 물질을 생산하기 위해 가장 활발히 활용되어 왔으며, 해당 균주들을 사용하여 일산화탄소로부터 아세트산이나 부틸산, 에탄올, 부탄올 등을 생산하기 위한 연구가 이뤄진 바 있다. 하지만, 아세토젠의 제한된 유전적 정보와 유전자 조작기술의 한계 때문에 생산 가능한 물질이 제한되어 왔으며, 효율적으로 다양한 고부가가치 물질을 생산하기 어렵다는 한계가 있다.Insufficient genetic information on carbon monoxide metabolizing strains or difficulties in genetic manipulation are also considered to be a limiting point in the production of high value-added substances through the microbial fermentation process using carbon monoxide as a substrate. Acetogen, which is known to metabolize carbon monoxide to produce acetic acid as a main product, has been most actively used to produce high value-added substances from carbon monoxide, and the strains used to produce acetic acid, butyric acid, ethanol, butanol, etc. from carbon monoxide Research has been done to do this. However, because of the limited genetic information of acetogen and the limitations of genetic manipulation technology, the materials that can be produced have been limited, and there is a limit in that it is difficult to efficiently produce various high value-added materials.

그동안 미생물을 활용한 발효 공정을 위해 공정에서의 불확실성을 최소화하기 위하여 단일 미생물 균주의 배양이 선호되어 왔지만, 최근에는 다종 균주의 공동배양을 통한 미생물 컨소시엄이 가지는 장점들이 주목을 받고 있다. 그동안 선호되어 온 단일 균주 배양을 통한 미생물 발효 공정과는 다르게, 자연계의 미생물은 단일 종의 개체군을 형성하는 것이 아니라 서로 다른 유형의 사회적 상호 작용을 통해 다종 균주의 공동체 네트워크(미생물 컨소시엄)를 형성하여 생존하고 있다. 이러한 미생물들은 지속적으로 변화하는 환경에 대한 적응의 결과로, 다양한 상호관계를 가지는 미생물 컨소시엄을 형성할 수 있는 것으로 알려졌다. 특히, 상호공생 관계는 여러 종이 협력하여 네트워크 전체의 이익을 창출하는 메커니즘이며, 이러한 상호공생 관계는 공동체를 구성하는 종들의 공존을 촉진하기 때문에 생물학적 네트워크의 안정성을 향상시킬 수 있을 것으로 알려졌다. 또한, 최근에는 이러한 미생물 컨소시엄 내에서 형성되는 종간 상호관계를 다양한 목적을 가지는 효율적인 생물학적 공정에 적용하기 위한 연구들이 이루어지고 있다.In the meantime, for the fermentation process using microorganisms, culturing of a single microbial strain has been preferred to minimize uncertainty in the process, but recently, the advantages of a microbial consortium through co-cultivation of multiple strains are attracting attention. Unlike the microbial fermentation process through single-strain culture, which has been preferred so far, microorganisms in nature do not form a population of a single species, but rather form a community network (microorganism consortium) of multiple strains through different types of social interactions. are surviving It is known that these microorganisms can form a microbiological consortium with various interrelationships as a result of adaptation to the continuously changing environment. In particular, the symbiotic relationship is a mechanism by which several species cooperate to create the benefit of the network as a whole, and it is known that such a symbiotic relationship can improve the stability of a biological network because it promotes the coexistence of species constituting a community. In addition, recently, studies have been made to apply the interspecies relationship formed within the microbial consortium to an efficient biological process having various purposes.

한국등록특허 제10-2073308호 (2020.01.29.)Korean Patent Registration No. 10-2073308 (2020.01.29.) 한국등록특허 제10-2089516호 (2020.03.10.)Korean Patent Registration No. 10-2089516 (2020.03.10.)

이에 본 발명자들은 종래 기술의 문제점을 해결하고 일산화탄소로부터 고부가가치의 물질들을 안정적이고 효율적으로 생산하기 위하여, 상호공생 관계의 합성 미생물 컨소시엄을 개발하였으며, 이를 활용한 일산화탄소의 안정적이고 지속적인 대사 및 고부가가치 물질의 생산 가능성을 발견함으로써 본 발명을 완성하였다.Accordingly, the present inventors have developed a consortium of synthetic microorganisms in a symbiotic relationship in order to solve the problems of the prior art and to stably and efficiently produce high value-added substances from carbon monoxide. The present invention was completed by discovering the production possibility of

본 발명의 목적은 유기산 고효율 생산 방법을 제공하는 것이다.It is an object of the present invention to provide a method for producing organic acids with high efficiency.

본 발명의 또 다른 목적은 유기산 고효율 생산용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for high-efficiency production of organic acids.

본 발명은 일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주를 공동배양하는 단계를 포함하는 유기산 고효율 생산 방법을 제공한다.The present invention provides a method for producing high-efficiency organic acid comprising the step of co-culturing a strain using carbon monoxide metabolism and a strain using acetic acid metabolism.

한편, 본 발명은 일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주를 포함하는 유기산 고효율 생산용 조성물을 제공한다.On the other hand, the present invention provides a composition for high-efficiency production of organic acids comprising a strain using carbon monoxide metabolism and a strain using acetic acid metabolism.

본 발명에 따른 일산화탄소 대사 이용 균주와 아세트산 대사 이용 균주로 이뤄진 미생물 컨소시엄의 개발은, 미생물의 일산화탄소 대사 안정성뿐만 아니라 일산화탄소로부터의 3-하이드록시프로피온산(3-hydroxypropionic acid; 3-HP) 및 이타콘산(itaconic acid; ITA)의 생산을 현저하게 향상시킬 수 있다. 따라서, 본 발명은 일산화탄소의 활용성을 제시하고, 이로부터 생산되는 3-HP과 ITA의 경제성을 높일 수 있는바, 해당 생산물들이 활용되는 합성수지, 라텍스 및 식품첨가물 등의 산업 분야에서 다양하게 활용될 수 있다.The development of a microbial consortium consisting of a strain using carbon monoxide metabolism and a strain using acetic acid metabolism according to the present invention, as well as the carbon monoxide metabolic stability of microorganisms, 3-hydroxypropionic acid (3-HP) and itaconic acid (3-hydroxypropionic acid; 3-HP) from carbon monoxide ( It can significantly improve the production of itaconic acid (ITA). Therefore, the present invention suggests the utility of carbon monoxide, and can increase the economic feasibility of 3-HP and ITA produced therefrom. can

도 1은 아세트산 첨가에 따른 유박테리엄 리모섬 균주의 일산화탄소 대사활성을 확인한 도이다.
도 2는 본 발명 합성 미생물 컨소시엄의 설계 모식도이다. a는 상호공생 관계의 합성 미생물 컨소시엄에서 일산화탄소 소비의 안정화 및 개선된 고부가가치 물질 생산을 위한 개략도이고, b는 본 발명 합성 미생물 컨소시엄에서 일산화탄소로부터 3-하이드록시프로피온산(3-HP) 및 이타콘산(ITA)로의 생합성 경로의 개략도이다.
도 3은 야생형 대장균의 호기성 및 혐기성 배양 조건에서 아세트산 대사를 확인한 도이다.
도 4는 산화제 종류가 균주의 대사에 미치는 영향을 확인한 도이다. a는 야생형 대장균의 아세트산 대사를 확인한 결과이고, b는 유박테리엄 리모섬의 일산화탄소 대사활성을 확인한 결과이다.
도 5는 균주에서 일산화탄소 주입에 의한 독성에 따른 a: 유박테리엄 리모섬의 일산화탄소 소비 저해 및 b: 대장균의 아세트산 소비저해를 확인한 도이다.
도 6은 물질 전달 제한조건 확인을 위해 단일배양에서 유박테리엄 리모섬에 대한 일산화탄소 대사활성을 평가한 도이다.
도 7은 시간에 따른 유박테리엄 리모섬의 일산화탄소 대사 및 아세트산의 생산을 확인한 도이다.
도 8은 본 발명 재조합 대장균의 아세트산 대사에 따른 대사 산물 생산능을 확인한 도이다. a는 재조합 CL 대장균의 아세트산 대사에 따른 3-HP의 생산능을 확인한 결과이고, b는 재조합 WCIAG4 대장균의 아세트산 대사에 따른 ITA의 생산능을 확인한 결과이다.
도 9는 유박테리엄 리모섬의 단독 배양 및 재조합 CL 대장균과 유박테리엄 리모섬의 공동배양에 따른 일산화탄소 유래 3-HP 생산을 비교한 도이다. a는 총 일산화탄소 소비를 확인한 결과이고, b는 아세테이트 축적을 확인한 결과이며, c는 3-HP의 생산을 확인한 결과이다.
도 10은 공동배양에서 본 발명의 CL 대장균의 농도 증가에 따른 대사변화를 비교한 도이다. a는 CL 대장균의 농도 및 배양 시간에 따른 일산화탄소의 소비능을 확인한 결과이고, b는 CL 대장균의 농도에 따른 총 일산화탄소 소비량을 확인한 결과이며, c는 CL 대장균의 농도에 따른 아세테이트 축적량을 확인한 결과이고, d는 CL 대장균의 농도에 따른 3-HP 생산량을 확인한 결과이며, e는 배양 시간에 따른 일산화탄소 흡수량, 아세테이트 축적량 및 3-HL 생산량을 확인한 결과이다.
도 11은 공동배양에서 본 발명의 WCIAG4 대장균의 농도 증가에 따른 대사변화를 비교한 도이다. a는 WCIAG4 대장균의 농도 및 배양 시간에 따른 일산화탄소의 흡수능을 확인한 결과이고, b는 WCIAG4 대장균의 농도에 따른 총 일산화탄소 흡수량을 확인한 결과이며, c는 WCIAG4 대장균의 농도에 따른 아세테이트 축적량을 확인한 결과이고, d는 CL 대장균의 농도에 따른 ITA 생산량을 확인한 결과이며, e는 배양 시간에 따른 일산화탄소 흡수량, 아세테이트 축적량 및 ITA 생산량을 확인한 결과이다.1 is a diagram confirming the carbon monoxide metabolic activity of Eubacterium rimosum strain according to the addition of acetic acid.
Figure 2 is a schematic diagram of the design of the present invention synthetic microorganisms consortium. a is a schematic diagram for stabilization of carbon monoxide consumption and improved production of high value-added substances in the synthetic microorganism consortium in a symbiotic relationship, and b is 3-hydroxypropionic acid (3-HP) and itaconic acid (3-HP) from carbon monoxide in the synthetic microorganism consortium of the present invention ( A schematic diagram of the biosynthetic pathway to ITA).
3 is a diagram confirming acetic acid metabolism in aerobic and anaerobic culture conditions of wild-type E. coli.
4 is a view confirming the effect of the type of oxidizing agent on the metabolism of the strain. a is the result of confirming the acetic acid metabolism of wild-type E. coli, and b is the result of confirming the carbon monoxide metabolic activity of Eubacterium limosum.
5 is a diagram confirming a: inhibition of carbon monoxide consumption of Eubacterium rimosum and b: inhibition of acetic acid consumption of Escherichia coli according to toxicity by carbon monoxide injection in the strain.
6 is a diagram evaluating the metabolic activity of carbon monoxide for Eubacterium limosum in a single culture to confirm the mass transfer restriction conditions.
7 is a diagram confirming the carbon monoxide metabolism and acetic acid production of Eubacterium rimosum over time.
8 is a view confirming the metabolite production ability according to acetic acid metabolism of recombinant E. coli of the present invention. a is the result of confirming the production ability of 3-HP according to acetic acid metabolism of recombinant CL E. coli, and b is the result of confirming the production ability of ITA according to the acetic acid metabolism of recombinant WCIAG4 E. coli.
Figure 9 is a diagram comparing the production of 3-HP derived from carbon monoxide according to the single culture of Eubacterium limosum and the co-culture of recombinant CL E. coli and Eubacterium limosum. a is the result of confirming the total carbon monoxide consumption, b is the result of confirming the accumulation of acetate, and c is the result of confirming the production of 3-HP.
10 is a diagram comparing metabolic changes according to an increase in the concentration of CL E. coli of the present invention in co-culture. a is the result of confirming the carbon monoxide consumption according to the concentration and culture time of CL E. coli, b is the result of confirming the total carbon monoxide consumption according to the concentration of CL E. coli, c is the result of confirming the accumulation of acetate according to the concentration of CL E. coli, and , d is the result of confirming the 3-HP production according to the concentration of CL E. coli, and e is the result of confirming the carbon monoxide absorption, acetate accumulation, and 3-HL production according to the incubation time.
11 is a diagram comparing metabolic changes according to an increase in the concentration of WCIAG4 Escherichia coli of the present invention in co-culture. a is the result of confirming the carbon monoxide absorption capacity according to the concentration and incubation time of WCIAG4 E. coli, b is the result of confirming the total carbon monoxide absorption according to the concentration of WCIAG4 E. coli, c is the result of confirming the amount of acetate accumulation according to the concentration of WCIAG4 E. coli, d is the result of confirming the ITA production according to the concentration of CL E. coli, and e is the result of confirming the carbon monoxide absorption, acetate accumulation and ITA production according to the culture time.

본 발명자는 미생물 배양을 통한 일산화탄소 유래의 고부가가치 물질 생산에서, 일산화탄소의 독성과 일산화탄소 대사 균주의 유전자 조작기술의 부재를 해결하고자 하였다. 일산화탄소 대사 아세토젠은 일산화탄소로부터 독성 대사물질인 아세트산을 고생산하는데, 본 발명자들은 이러한 아세트산의 축적이 아세토젠의 대사활성에 부정적인 영향을 줄 것이라고 가정하였고, 이러한 가정을 기반으로 상호공생 관계의 합성 미생물 컨소시엄을 개발하였으며, 이를 활용한 일산화탄소의 안정적이고 지속적인 대사 및 고부가가치 물질의 생산 가능성을 발견함으로써 본 발명을 완성하였다.The present inventors tried to solve the toxicity of carbon monoxide and the absence of genetic manipulation technology of carbon monoxide metabolizing strains in the production of high value-added substances derived from carbon monoxide through microbial culture. Carbon monoxide metabolism Acetogen highly produces acetic acid, a toxic metabolite, from carbon monoxide, and the present inventors hypothesized that the accumulation of acetic acid would negatively affect the metabolic activity of acetogen. Based on this assumption, synthetic microorganisms in a symbiotic relationship A consortium was developed, and the present invention was completed by discovering the possibility of stable and continuous metabolism of carbon monoxide and the production of high value-added substances using the consortium.

따라서, 본 발명은 일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주를 공동배양하는 단계를 포함하는 유기산 고효율 생산 방법 및 일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주를 포함하는 유기산 고효율 생산용 조성물을 제공한다. 이때, 유기산은, 바람직하게는 아세톤산, 아디프산, 아스코르브산, 아크릴산, 시트르산, 2,5-다이케토-D-글루콘산, 포름산, 푸마르산, 글루카르산, 글루콘산, 글루쿠론산, 글루타르산, 3-하이드록시프로피온산, 이타콘산, 락트산, 말레산, 말산, 말론산, 옥살산, 옥살로아세트산, 프로피온산, 숙신산 및 자일자일론부터 선택된 1종 이상일 수 있으며, 더욱 바람직하게는 3-하이드록시프로피온산(3-hydroxypropionic acid) 또는 이타콘산(itaconic acid)인 것이 좋다.Accordingly, the present invention provides a method for producing high-efficiency organic acid comprising co-culturing a strain using carbon monoxide metabolism and a strain using acetic acid metabolism, and a composition for high-efficiency production of organic acid comprising a strain using carbon monoxide metabolism and acetic acid metabolism. In this case, the organic acid is preferably acetonic acid, adipic acid, ascorbic acid, acrylic acid, citric acid, 2,5-diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, It may be at least one selected from glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, maleic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid and xylylone, more preferably 3- Hydroxypropionic acid (3-hydroxypropionic acid) or itaconic acid (itaconic acid) is preferred.

본 발명에 있어서, "3-하이드록시프로피온산(3-hydroxypropionic acid, 3-HP)"은 화학식 C3H6O3, 분자량 90.08MW, 25℃에서 pKa 4.51인 약산으로, 구조적으로 탄소 3개를 가지는 비카이랄 유기산으로 젖산(2-하이드록시프로피온산)과 이성질체이다. 상기 3-HP는 비결정질이고, 시럽과 같은 연한 노란색을 띠며, 비중은 1.25, 굴절률은 1.45이다.In the present invention, "3-hydroxypropionic acid (3-HP)" is a weak acid with the formula C 3 H 6 O 3 , molecular weight 90.08MW, and pKa 4.51 at 25° C., structurally containing 3 carbons. Eggplant is an achiral organic acid, an isomer with lactic acid (2-hydroxypropionic acid). The 3-HP is amorphous, has a light yellow color like syrup, has a specific gravity of 1.25, and has a refractive index of 1.45.

상기 3-HP는 여러 화학공정에 사용되는 중요한 합성 중간체로, 1,3-프로판디올 (C3H8O2 - MW 76.09), 아크릴산 (C3H4O2 - MW 72.06), 메틸 아크릴에이트 (C4H6O2 - MW 86.09), 아크릴아미드 (C3H5NO - MW 71.08), 에틸 3-하이드록시프로피온산 (C5H103 - MW 118.13), 말로닉산 (C3H4O4 - MW 104.06), 프로피온락톤 (C3H4O2 - MW 72.06), 아크로니트릴 (C3H4N - MW 53.06) 등을 생산할 수 있는 원료로 사용된다. 상기 3-HP는 에틸렌 사이아노하이드린, 베타-아이도프로피온산, 베타-브로모프로피온산, 베타-클로로프로피온산, 베타-프로피오락톤, 아크릴산 등을 중간체로 하여 화학적 공정을 통해 생산될 수 있고, 글리세롤로부터 생물학적 공정을 통해 생산될 수도 있다.The 3-HP is an important synthetic intermediate used in various chemical processes, 1,3-propanediol (C 3 H 8 O 2 - MW 76.09), acrylic acid (C 3 H 4 O 2 - MW 72.06), methyl acrylate (C 4 H 6 O 2 - MW 86.09), acrylamide (C 3 H 5 NO - MW 71.08), ethyl 3-hydroxypropionic acid (C 5 H 1 0 3 - MW 118.13), malonic acid (C 3 H 4 O 4 - MW 104.06), propionlactone (C 3 H 4 O 2 - MW 72.06), acrylonitrile (C 3 H 4 N - MW 53.06) is used as a raw material that can be produced. The 3-HP may be produced through a chemical process using ethylene cyanohydrin, beta-idopropionic acid, beta-bromopropionic acid, beta-chloropropionic acid, beta-propiolactone, acrylic acid, etc. as an intermediate, and glycerol It can also be produced through biological processes from

보다 구체적으로, 생물학적으로 여러 효소가 촉매하는 탈수 및 산화 공정을 통하여 글리세롤로부터 3-HP를 생산할 수 있으며, 첫 번째 단계는 글리세롤 디하이드라타제(glycerol dehydratase)에 의해 글리세롤을 탈수화시켜 중간물질인 3-하드록시프로피온알데히드 생산 반응을 촉매시키는 반응이며, 두 번째 단계는 알데히드 디하이드로게나제(aldehyde dehydrogenase)에 의해 3-히드록시프로피온알데히드가 탈수소화되는 반응이다. 3-HP의 생산에 있어서, 두 단계의 대사적 활성도가 균형이 맞지 않아 중간 산물인 3-HPA가 세포 내에 축적될 경우 세포 성장이 저해되고, 3-HP의 생산성이 떨어지게 된다.More specifically, 3-HP can be produced from glycerol through the dehydration and oxidation process catalyzed by various enzymes biologically. It is a reaction that catalyzes the production of 3-hydroxypropionaldehyde, and the second step is a reaction in which 3-hydroxypropionaldehyde is dehydrogenated by aldehyde dehydrogenase. In the production of 3-HP, when the metabolic activity of the two steps is not balanced and the intermediate product 3-HPA accumulates in the cells, cell growth is inhibited and the productivity of 3-HP is lowered.

본 발명은 3-HP 생합성 회로의 최적화를 달성하기 위하여, 대사 공학적인 접근 방법을 통하여 3-HPA의 축적을 방지하고 3-HP의 생산성을 높이기 위한 새로운 방법을 제공하고자 하였다.The present invention was to provide a novel method for preventing the accumulation of 3-HPA and increasing the productivity of 3-HP through a metabolic engineering approach in order to achieve the optimization of the 3-HP biosynthetic circuit.

본 발명에 있어, "이타콘산(itaconic acid)"은 탄소 5개로 이루어진 디카르복실산으로, 구조적 특성으로 인하여 플라스틱 및 라텍스 등과 같은 고분자 합성의 전구체로 이용된다.In the present invention, "itaconic acid (itaconic acid)" is a dicarboxylic acid consisting of 5 carbons, and is used as a precursor of polymer synthesis such as plastics and latex due to structural characteristics.

본 발명의 실시예에 따르면, 본 발명은 일산화탄소 대사균주의 일산화탄소 대사 안정성 향상을 위한 미생물 컨소시엄 배양 방법을 제공하는데, 상기 미생물 컨소시엄은 두 종류 이상의 균주를 공동배양하는 것을 의미한다. 본 발명의 목표는 일산화탄소 대사균주와 재조합 미생물로 구성된 미생물 컨소시엄을 구축함으로써 일산화탄소로부터 효율적으로 고부가가치 물질을 생산하는 데에 있다.According to an embodiment of the present invention, the present invention provides a microbial consortium culture method for improving carbon monoxide metabolic stability of a carbon monoxide metabolizing strain, wherein the microbial consortium means co-culturing two or more types of strains. It is an object of the present invention to efficiently produce high value-added substances from carbon monoxide by establishing a microbial consortium composed of a carbon monoxide metabolizing strain and a recombinant microorganism.

본 발명의 유기산 고효율 생산 방법에 있어, 상기 공동배양은, 바람직하게는 대체전자 수용체가 추가된 혐기성 조건에서 수행되는 것이 좋다. 이때, 상기 대체전자 수용체는, 바람직하게는 질산염 (nitrate) 또는 TMAO (trimethylamine N-oxide)인 것이 좋고, 더욱 바람직하게는 TMAO (trimethylamine N-oxide)인 것이 좋다. 본 발명의 일 실시예에서는 산화제로써, 질산염(nitrate), 아질산염(nitrite), DMSO (dimethyl sulfoxide), TMAO (trimethylamine N-oxide), 푸마르산염(fumarate)을 이용하였을 시, 그 중 질산염 및 TMAO가 재조합 미생물의 빠른 아세트산 대사를 가능하게 하였고, 특히 TMAO 첨가에 의해 일산화탄소 대사 활성에 대한 저감 효과가 낮아졌음을 확인하였다.In the organic acid high-efficiency production method of the present invention, the co-culture is preferably performed under anaerobic conditions in which an alternative electron acceptor is added. In this case, the alternative electron acceptor is preferably nitrate or trimethylamine N-oxide (TMAO), more preferably TMAO (trimethylamine N-oxide). In one embodiment of the present invention, when nitrate, nitrite, DMSO (dimethyl sulfoxide), TMAO (trimethylamine N-oxide), and fumarate are used as the oxidizing agent, among them, nitrate and TMAO are It was confirmed that the rapid acetic acid metabolism of the recombinant microorganism was enabled, and in particular, the reduction effect on carbon monoxide metabolic activity was lowered by the addition of TMAO.

본 발명에 있어, 일산화탄소 대사균주란 생물학적으로 일산화탄소를 탄소원으로 사용할 수 있는 미생물을 의미한다. 자연계에 존재하는 대표적인 일산화탄소 대사균주로는 유박테륨 리모숨 (Eubacterium limosum), 무렐라 서모아세티카 (Moorella thermoacetica), 클로스트리디움 융달리 (Clostridium ljungdahlii), 시트로박터 아말로나티쿠스 (Citrobactor amalonaticus) Y19 등이 있다. 일산화탄소의 생물학적 대사는 주로 일산화탄소 탈수소 효소에 의해 일산화탄소가 이산화탄소로 산화되는 과정으로부터 시작되며, 해당 산화 과정으로부터 얻은 환원력을 사용하여 미생물의 성장 및 생존에 필요한 에너지를 생산하는 것으로 알려졌다. 이때, 환원력을 사용하여 에너지를 얻는 경로에 따라 일산화탄소 대사균주는 황산염 환원균, 수소 생성균, 메탄 생성균, 아세토젠으로 분류된다.In the present invention, the carbon monoxide metabolizing strain refers to a microorganism that can biologically use carbon monoxide as a carbon source. As a representative carbon monoxide metabolizing strain that exists in nature, Eubacterium rimosum ( Eubacterium limosum ), Murella thermoacetica ( Moorella thermoacetica ), Clostridium jungdaly ( Clostridium ljungdahlii ), Citrobacter amalonaticus ( Citrobactor amalonaticus ) Y19. Biological metabolism of carbon monoxide mainly starts from the process of carbon monoxide being oxidized to carbon dioxide by carbon monoxide dehydrogenase, and it is known that the reducing power obtained from the oxidation process is used to produce energy necessary for the growth and survival of microorganisms. At this time, depending on the route to obtain energy using the reducing power, carbon monoxide metabolizing strains are classified into sulfate reducing bacteria, hydrogen producing bacteria, methanogenic bacteria, and acetogen.

본 발명의 유기산 고효율 생산 방법에 있어, 상기 일산화탄소 대사 이용 균주는, 바람직하게는 아세토젠(acetogen)인 것이 좋다.In the organic acid high-efficiency production method of the present invention, the strain using carbon monoxide metabolism is preferably acetogen.

본 발명의 구체적 예에 있어서, 상기 일산화탄소 대사균주는 박테리아, 고세균으로 구성된 군에서 선택되는 것을 특징으로 할 수 있고, 바람직하게는 유박테리엄 (Eubacterium) 속 또는 클로스트리디움 (Clostridium) 속 미생물일 수 있고, 더욱 바람직하게는 유박테리엄 리모섬 (Eubacterium limosum) 또는 클로스트리디움 드라케이(Clostridium drakei)일 수 있다. 하지만, 본 발명에서 사용되는 일산화탄소 대사균주는 일산화탄소를 생물학적으로 대사 가능한 미생물이면 특별히 한정되지 않는다.In a specific example of the present invention, the carbon monoxide metabolizing strain may be characterized in that it is selected from the group consisting of bacteria and archaea, preferably Eubacterium genus or Clostridium genus microorganisms. and, more preferably, Eubacterium rimosum ( Eubacterium limosum ) or Clostridium drakei ( Clostridium drakei ). However, the carbon monoxide metabolizing strain used in the present invention is not particularly limited as long as it is a microorganism capable of biologically metabolizing carbon monoxide.

본 발명의 유기산 고효율 생산 방법에 있어, 상기 아세트산 대사 이용 균주는, 바람직하게는 아세트산으로부터 유기산을 생산하는 대사경로가 도입된 재조합 미생물인 것이 좋다.In the organic acid high-efficiency production method of the present invention, the strain using acetic acid metabolism is preferably a recombinant microorganism into which a metabolic pathway for producing an organic acid from acetic acid is introduced.

특히, 본 발명에 있어서, "일산화탄소 대사균주와 공생 가능한 재조합 미생물"은, 일산화탄소 대사균주가 생산하는 아세트산을 대사물질로 이용하여 목적하는 유용한 유기산을 합성할 수 있는 미생물을 의미한다.In particular, in the present invention, "a recombinant microorganism capable of symbiosis with a carbon monoxide metabolizing strain" refers to a microorganism capable of synthesizing a desired useful organic acid using acetic acid produced by the carbon monoxide metabolizing strain as a metabolite.

본 발명에 있어서, 상기 "재조합 미생물"은 재조합 벡터로 형질전환된 것을 말한다. 본 발명에서 "형질전환"은 본 발명에 따른 프로모터, 또는 추가적으로 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 숙주세포 내에 도입 하는 것을 의미한다. 또한, 형질전환 된 목적 단백질을 코딩하는 유전자는 숙주세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치할 수 있다.In the present invention, the "recombinant microorganism" refers to one transformed with a recombinant vector. In the present invention, "transformation" means introducing the promoter according to the present invention or a vector including a gene encoding a target protein additionally into a host cell. In addition, as long as the gene encoding the transformed target protein can be expressed in the host cell, it may be inserted into the chromosome of the host cell or located outside the chromosome.

상기 재조합 미생물은 박테리아, 효모, 곰팡이로 구성된 군에서 선택되는 것을 특징으로 할 수 있고, 바람직하게는 에스케리치아 (Escherichia) 속 미생물일 수 있고, 더욱 바람직하게는 대장균 (Escherichia coli)일 수 있다. 하지만, 본 발명에서 사용되는 재조합 미생물은 아세트산을 대사하여 고부가가치 물질을 생산할 수 있는 미생물이면 특별히 한정되지 않는다.The recombinant microorganism may be characterized in that it is selected from the group consisting of bacteria, yeast, mold, preferably Escherichia ( Escherichia ) It may be a microorganism of the genus, more preferably Escherichia coli ( Escherichia coli ) It may be. However, the recombinant microorganism used in the present invention is not particularly limited as long as it is a microorganism capable of metabolizing acetic acid to produce a high value-added substance.

본 발명의 구체적 예에 있어, 상기 재조합 미생물은, 바람직하게는 3-하이드록시프로피온산(3-hydroxypropionic acid) 생산용 재조합 대장균이며, 대장균 W 균주에서, 클로로플렉서스 아우란티아커스 (Chloroflexus aurantiacus) 유래 mcr 유전자 및 acs 유전자가 과발현된 것이 좋다.In a specific example of the present invention, the recombinant microorganism is preferably a 3-hydroxypropionic acid (3-hydroxypropionic acid) production recombinant E. coli, in E. coli W strain, Chloroflexus aurantiacus (Chloroflexus aurantiacus) derived It is preferable that the mcr gene and the acs gene are overexpressed.

본 발명에서 용어 "야생형 대장균"은 대장균 W 균주의 야생형 (wild type) 균주를 의미하고, 용어 "재조합 대장균"은 대장균 W 균주에서 클로로플렉서스 아우란티아커스 (Chloroflexus aurantiacus) 유래 mcr 유전자 및 acs 유전자가 과발현된 균주를 의미하며, 용어 "대장균"은 야생형 대장균과 재조합 대장균을 모두 포함하는 전반적인 의미로 사용되었다.In the present invention, the term "wild type E. coli" refers to a wild type strain of E. coli W strain, and the term "recombinant E. coli" refers to the mcr gene and acs gene derived from Chloroflexus aurantiacus in E. coli W strain. means an overexpressed strain, and the term "E. coli" was used in an overall sense including both wild-type E. coli and recombinant E. coli.

구체적으로 상기 재조합 대장균은 말로닐-코에이 의존적 대사회로에서, 아세트산은 내생 효소를 통해 아세틸-코에이를 거쳐 말로닐-코에이로 전환되며, 이는 클로로플렉스스 아우란티아커스 유래의 외래 효소인 말로닐-코에이 환원효소를 통해 3-HP로 전환된다. 따라서, 본 발명에서는 대장균 W 균주 내에 말로닐-코에이 환원효소를 암호화하고 있는 외래 유전자인 mcr 유전자를 과발현하였다.Specifically, in the recombinant E. coli malonyl-CoA-dependent metabolic cycle, acetic acid is converted to malonyl-CoA via acetyl-CoA through an endogenous enzyme, which is an exogenous enzyme derived from Chloroplex aurantiacus. It is converted to 3-HP through malonyl-Coei reductase. Therefore, in the present invention, the mcr gene, which is a foreign gene encoding malonyl- Coei reductase , was overexpressed in the E. coli W strain.

또한, 대장균의 아세트산 대사속도를 향상시키기 위하여 아세틸-코에이 합성효소를 암호화하는 내생 유전자인 acs 유전자를 과발현하였다.In addition, the acs gene, which is an endogenous gene encoding an acetyl-CoA synthetase, was overexpressed in order to improve the acetic acid metabolism rate in E. coli.

상기 재조합 대장균은, 말로닐-코에이 환원효소의 활성을 향상시키기 위하여 해당 효소에 기존에 알려진 3개의 돌연변이 (N940V, K1106W 및 S1114R)를 추가적으로 가할 수 있으며, 글라이옥실산 회로에 포함된 aceBAK 유전자의 발현 억제인자를 암호화하고 있는 iclR 유전자의 결실을 추가적으로 유도함으로써 글라이옥실산 회로를 활성화할 수도 있다.In the recombinant E. coli, three known mutations (N940V, K1106W and S1114R) can be additionally added to the enzyme in order to improve the activity of malonyl-Coei reductase, and the aceBAK gene included in the glyoxylic acid cycle It is also possible to activate the glyoxylic acid cycle by additionally inducing deletion of the iclR gene, which encodes an expression repressor of

또한, 상기 재조합 미생물은, 바람직하게는 이타콘산(itaconic acid) 생산용 재조합 대장균이며, 서열번호 5의 염기서열로 표시되는 합성 5' UTR(untranslated region), cad 유전자, acs 유전자, aceA 유전자 및 gltA 유전자가 과발현되고, icIR 유전자가 결실된 것이 좋다.In addition, the recombinant microorganism is preferably a recombinant Escherichia coli for itaconic acid production, and a synthetic 5' untranslated region (UTR) represented by the nucleotide sequence of SEQ ID NO: 5, cad gene, acs gene, aceA gene, and gltA It is preferable that the gene is overexpressed and the icIR gene is deleted.

더욱 구체적으로, 상기 재조합 미생물은, 서열번호 5의 염기서열로 표시되는 합성 5' UTR(untranslated region) 및 cad 유전자를 포함하는 cad 유전자 발현 카세트를 포함하는 이타콘산(itaconic acid) 생산용 재조합 벡터; acs 유전자 발현 카세트를 포함하는 재조합 벡터; 및 aceA 유전자 발현 카세트를 포함하는 재조합 벡터; 및 gltA 유전자 발현 카세트를 포함하는 재조합 벡터;로 이루어진 군에서 선택되는 1종 이상의 재조합 벡터;가 도입되고, icIR 유전자가 결실된 것으로, 본 발명자가 한국등록특허 제10-1973001호를 통해 공개한 재조합 균주이다. 따라서, 해당 균주에 대한 자세한 내용은 한국등록특허 제10-1973001호를 참고할 수 있다.More specifically, the recombinant microorganism comprises a synthetic 5' untranslated region (UTR) represented by the nucleotide sequence of SEQ ID NO: 5 and a cad gene expression cassette including a cad gene, a recombinant vector for production of itaconic acid; a recombinant vector comprising an acs gene expression cassette; and a recombinant vector comprising an aceA gene expression cassette; and a recombinant vector comprising a gltA gene expression cassette; at least one recombinant vector selected from the group consisting of; is introduced and the icIR gene is deleted. is a strain Therefore, for details on the strain, reference can be made to Korean Patent Registration No. 10-1973001.

본 발명의 유기산 고효율 생산 방법에 있어, 상기 일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주는, 바람직하게는 1~5 : 1의 세포 농도로 첨가되는 것이 좋다. 본 발명의 일 실시예에서는 상기한 조건으로 양 균주를 혼합시, 3-하이드록시프로피온산(3-hydroxypropionic acid) 및 이타콘산(itaconic acid)의 고효율 생산이 가능함을 확인하였다.In the organic acid high-efficiency production method of the present invention, the strain using carbon monoxide metabolism and the strain using acetic acid metabolism are preferably added at a cell concentration of 1-5:1. In an embodiment of the present invention, it was confirmed that when both strains were mixed under the above conditions, high-efficiency production of 3-hydroxypropionic acid and itaconic acid was possible.

본 발명에서 용어 "효소 활성 제한조건"이란, 유박테리엄 리모섬에 의한 일산화탄소 대사 속도가 기체상으로부터 액체상으로의 일산화탄소의 물질 전달 속도보다 느린 상태를 말하며, 해당 조건에서는 기체상의 일산화탄소 분압에 의해 배지 내에 용존 일산화탄소가 존재하기 때문에 균주들이 일산화탄소에 의한 독성 효과를 받게 된다. In the present invention, the term "enzyme activity limiting conditions" refers to a state in which the rate of carbon monoxide metabolism by Eubacterium limosum is slower than the mass transfer rate of carbon monoxide from the gas phase to the liquid phase, and under the conditions, the medium by partial pressure of carbon monoxide in the gas phase Because dissolved carbon monoxide is present in the strain, the toxic effect of carbon monoxide is applied.

본 발명에 있어서 "벡터"는, 발현시키고자 하는 목적 폴리펩타이드의 암호화 유전자가 작동 가능하게 연결될 경우, 적절한 숙주 세포에서 상기 목적 폴리펩타이드를 높은 효율로 발현시킬 수 있는 목적 폴리펩타이드의 발현 벡터로 사용될 수 있으며, 상기 재조합 벡터는 숙주 세포에서 발현 가능할 수 있다. 숙주 세포는 바람직하게는 진핵세포일 수 있으며, 숙주세포의 종류에 따라 프로모터(promoter), 종결자(terminator), 인핸서(enhancer) 등과 같은 발현 조절 서열, 막 표적화 또는 분비를 위한 서열 등을 적절히 선택하고 목적에 따라 다양하게 조합할 수 있다.In the present invention, the "vector" is used as an expression vector of a target polypeptide capable of expressing the target polypeptide with high efficiency in an appropriate host cell when the gene encoding the target polypeptide to be expressed is operably linked. In addition, the recombinant vector may be expressed in a host cell. The host cell may preferably be a eukaryotic cell, and an expression control sequence such as a promoter, terminator, enhancer, etc., and a sequence for membrane targeting or secretion are appropriately selected according to the type of host cell. and can be combined in various ways depending on the purpose.

이하, 본 발명의 내용을 하기 실시예 또는 실험예를 통해 더욱 상세히 설명하기로 한다. 다만, 본 발명의 권리범위가 하기 실시예 및 실험예에만 한정되는 것은 아니고, 그와 등가의 기술적 사상의 변형까지를 포함한다.Hereinafter, the contents of the present invention will be described in more detail through the following Examples or Experimental Examples. However, the scope of the present invention is not limited to the following examples and experimental examples, and includes modifications of technical ideas equivalent thereto.

[[ 실시예Example 1: 합성 미생물 컨소시엄의 설계 및 공동배양 조건 설정] 1: Design of synthetic microorganism consortium and setting of co-cultivation conditions]

1. One. 유박테리엄Eubacterium 리모섬과Limo Island and 재조합 대장균으로 구성된 미생물 컨소시엄의 설계 Design of a microbial consortium composed of recombinant E. coli

본 발명자는 미생물 배양을 통한 일산화탄소 유래의 고부가가치 물질 생산에서, 일산화탄소의 독성과 일산화탄소 대사 균주의 유전자 조작기술의 부재를 해결하기 위해, 상호공생 관계의 미생물 컨소시엄 전략을 사용하고자 하였다.The present inventors tried to use a microbial consortium strategy in a symbiotic relationship to solve the toxicity of carbon monoxide and the absence of genetic manipulation technology of carbon monoxide metabolizing strains in the production of high value-added substances derived from carbon monoxide through microbial culture.

일산화탄소 대사 아세토젠은 일산화탄소로부터 독성 대사물질인 아세트산을 고생산하는데, 본 발명자들은 이러한 아세트산의 축적이 아세토젠의 대사활성에 부정적인 영향을 줄 것이라고 가정하였다. 실제로, 도 1에 나타낸 바와 같이, 대표적인 아세토젠 균주인 유박테리엄 리모섬 균주는, 배지에 아세트산을 첨가함에 따라 균주의 일산화탄소 대사활성이 점진적으로 저해됨을 확인할 수 있었다.Carbon Monoxide Metabolism Acetogen highly produces acetic acid, a toxic metabolite, from carbon monoxide, and the present inventors hypothesized that the accumulation of acetic acid would have a negative effect on the metabolic activity of acetogen. In fact, as shown in FIG. 1 , it was confirmed that, in the Eubacterium rimosum strain, which is a representative acetogen strain, the carbon monoxide metabolic activity of the strain was gradually inhibited as acetic acid was added to the medium.

대사산물 축적에 의한 아세토젠의 대사활성 감소는 일산화탄소의 물질 전달 제한조건의 유지를 어렵게 하며, 결과적으로 미생물에 대한 일산화탄소에 의한 독성을 증폭시키는 결과를 야기할 수 있다. 따라서, 아세트산을 탄소원으로 사용하여 고부가가치 물질을 고효율로 생산할 수 있는 타종의 재조합 미생물을 아세토젠과 공동배양한다면, 플랫폼 미생물이 아세트산을 지속적으로 소모함에 따라 아세토젠의 일산화탄소 대사활성을 보다 오래 유지할 수 있을 것이다. 이러한 미생물 컨소시엄에서는 아세토젠과 고부가가치 물질생산 재조합 균주가 서로에게 도움이 되는 상호공생 관계에 있다고 할 수 있다. 또한, 이러한 미생물 컨소시엄 전략은 유전자 조작이 매우 용이한 고부가가치 물질 고생산 균주들을 다양하게 적용할 수 있기 때문에, 본 발명자들은 일산화탄소로부터 생산되는 고부가가치 물질의 다양성 또한 향상시킬 수 있는 전략이라고 생각하였다.The decrease in the metabolic activity of acetogen due to the accumulation of metabolites makes it difficult to maintain the limiting conditions for mass transfer of carbon monoxide, and as a result, it may result in amplification of the toxicity of carbon monoxide to microorganisms. Therefore, if other types of recombinant microorganisms that can produce high-value-added substances with high efficiency using acetic acid as a carbon source are co-cultured with acetogen, the carbon monoxide metabolic activity of acetogen can be maintained longer as the platform microorganisms continuously consume acetic acid. There will be. In this microbial consortium, it can be said that acetogen and a recombinant strain producing high value-added substances have a mutually beneficial relationship with each other. In addition, since this microbial consortium strategy can variously apply high-value-added material high-producing strains that are very easy to genetically manipulate, the present inventors thought that it was a strategy that could also improve the diversity of high-value-added materials produced from carbon monoxide.

일산화탄소로부터 고부가가치 물질의 효율적인 생산을 위해서, 도 2에 나타낸 바와 같이, 유박테리엄 리모섬과 재조합 대장균 (하기 실시예 2 참고)으로 구성된 미생물 컨소시엄을 설계하였다. 유박테리엄 리모섬은 일산화탄소를 단일탄소원으로 사용하여 아세트산을 주요 발효산물로 생산하는 우드-융달 대사경로(Wood-Ljungdahl pathway)를 가지고 있다. 대장균은 아세트산을 포함하는 다양한 탄소원으로부터 고부가가치 생산물의 생산을 위해서 가장 널리 이용되는 플랫폼 균주 중 하나이다. 특히 대장균 W 균주는 아세트산에 관한 높은 내성을 가지는 것으로 잘 알려졌기 때문에 본 발명에서 사용할 균주로 선정하였다.For the efficient production of high value-added substances from carbon monoxide, as shown in FIG. 2 , a microbial consortium composed of Eubacterium rimosum and recombinant E. coli (see Example 2 below) was designed. Eubacterium limosum has a Wood-Ljungdahl pathway that uses carbon monoxide as a single carbon source to produce acetic acid as a major fermentation product. E. coli is one of the most widely used platform strains for the production of high value-added products from various carbon sources including acetic acid. In particular, E. coli W strain was selected as the strain to be used in the present invention because it is well known to have high resistance to acetic acid.

따라서, 본 발명에서는 아세트산으로부터 고부가가치 생산물을 효율적으로 생산하도록 개량된 재조합 대장균 (하기 실시예 2 참고)과 유박테리엄 리모섬을 공동배양함으로써 미생물 컨소시엄을 구축한다면, 일산화탄소로부터 아세트산을 거쳐 원하는 고부가가치 생산물을 효율적으로 생산하는 공정을 개발할 수 있다고 가정하였다.Therefore, in the present invention, if a microbial consortium is constructed by co-culturing Eubacterium limossum with recombinant E. coli (refer to Example 2 below), which has been improved to efficiently produce high value-added products from acetic acid, from carbon monoxide through acetic acid to desired high added value. It was assumed that it was possible to develop a process to efficiently produce products.

2. 2. 유박테리엄Eubacterium 리모섬과Limo Island and 대장균의 단일 배양 Monoculture of E. coli

본 발명에서 설명되는 유박테리엄 리모섬과 대장균을 포함하는 모든 균주의 배양은 산소 분자가 없는 혐기성 조건에서 진행되었다. 균주 배양을 위한 최소배지로는 PBBM 배지(0.9g/L NaCl, 0.3g/L MgSO4·7H2O, 0.2g/L CaCl2·2H2O, 2g/L NH4Cl, 50mM potassium phosphate buffer (pH 7.0), 0.5g/L L-cysteine·HCl, 20mL trace mineral solution, 20mL vitamin solution, 0.02g/L resazurin)가 사용되었으며, 균주 배양을 위한 복합배지로는 RCM 배지 (10g/L peptone, 10g/L beef extract, 3g/L yeast extract, 5g/L dextrose, 5g/L NaCl, 0.5g/L L-cysteine·HCl, 3g/L sodium acetate 및 0.02g/L resazurin)가 사용되었다.All strains including Eubacterium rimosum and E. coli described in the present invention were cultured under anaerobic conditions without oxygen molecules. The minimum medium for strain culture is PBBM medium (0.9g/L NaCl, 0.3g/L MgSO 4 ·7H 2 O, 0.2g/L CaCl 2 ·2H 2 O, 2g/L NH 4 Cl, 50mM potassium phosphate buffer (pH 7.0), 0.5g/L L-cysteine HCl, 20mL trace mineral solution, 20mL vitamin solution, 0.02g/L resazurin) were used, and RCM medium (10g/L peptone, 10g/L beef extract, 3g/L yeast extract, 5g/L dextrose, 5g/L NaCl, 0.5g/L L-cysteine·HCl, 3g/L sodium acetate and 0.02g/L resazurin) were used.

균주 배양은 혐기 조건을 유지하기 위해서 75mL 혹은 500mL의 밀봉된 시럼(serum) 바이알에서 진행되었다. 시럼(serum) 바이알의 기체 부분은 고순도 질소가스 혹은 일산화탄소/질소 혼합가스로 교체되었으며, 질소 혹은 일산화탄소 가스 내에 포함된 미량의 산소분자를 모두 제거하기 위해서 Model 1000 O2 Filter를 사용하였다. 균주 배양은 37℃, 200 rpm 조건에서 수행되었으며, pH 값은 5M HCl 혹은 10M NaOH의 첨가를 통해 7.0 수준으로 유지해 주었다.Strain culture was performed in a sealed serum vial of 75 mL or 500 mL to maintain anaerobic conditions. The gas part of the serum vial was replaced with high-purity nitrogen gas or carbon monoxide/nitrogen mixed gas, and a Model 1000 O 2 Filter was used to remove all trace oxygen molecules contained in nitrogen or carbon monoxide gas. Strain culture was performed at 37 °C, 200 rpm conditions, and the pH value was maintained at a level of 7.0 through the addition of 5M HCl or 10M NaOH.

유박테리엄 리모섬 균주 배양은, 초기 균주배양을 통해 실험에 필요한 세포의 양을 얻기 위해서 RCM 배지가 사용되었다. 글리세롤 스탁으로부터 시작된 배양을 통해 원하는 양의 세포가 얻어지면 해당 균주를 30배로 농축한 뒤 일산화탄소/질소 혼합가스 (10:90, v/v)를 2시간 간격으로 총 16시간 동안 제공해줌으로써, 유박테리엄 리모섬 균주가 일산화탄소를 대사하기 위해서 필요한 효소 (일산화탄소 탈수소효소)의 발현을 유도하였다. 이렇게 일산화탄소에 적응된 유박테리엄 리모섬 균주는 원심분리를 통해 얻어졌으며, 본 배양에 사용되기에 앞서 남아있는 RCM 배지 내 탄소원들을 제거해주기 위해서 최소배지인 PBBM 배지로 3회 씻어주었다. 해당 균주들은 적절한 농도로 30mL의 PBBM 배지에 재현탁된 뒤에 본 배양에 사용되었다.Eubacterium limosum strain culture, RCM medium was used to obtain the amount of cells required for the experiment through the initial strain culture. When the desired amount of cells is obtained through the culture started from the glycerol stock, the strain is concentrated 30 times and then carbon monoxide/nitrogen mixed gas (10:90, v/v) is provided at 2 hour intervals for a total of 16 hours. Liam limosum strain induced the expression of an enzyme (carbon monoxide dehydrogenase) required to metabolize carbon monoxide. The Eubacterium limosum strain adapted to carbon monoxide was obtained through centrifugation, and was washed three times with PBBM medium, which is a minimal medium, in order to remove the carbon sources in the remaining RCM medium before being used for the main culture. The strains were resuspended in 30 mL of PBBM medium at an appropriate concentration and then used for the main culture.

유박테리엄 리모섬 균주의 배양은 각각 효소 활성 제한조건과 물질 전달 제한조건에서 수행되었다. 효소 활성 제한조건은 유박테리엄 리모섬의 일산화탄소 대사 활성 측정 혹은 유박테리엄 리모섬 및 대장균에 대한 일산화탄소의 독성 평가를 위해 사용되었다. 해당 조건에서는 유박테리엄 리모섬에 의한 빠른 속도의 일산화탄소 대사에 의해 배지 내에 용존 일산화탄소가 거의 존재하지 않기 때문에 균주들이 일산화탄소에 의한 독성 효과를 최소한으로 받게 된다. 물질 전달 제한조건은 유박테리엄 리모섬과 대장균의 공동배양을 위해 사용되었다.Cultures of Eubacterium limosum strains were performed under enzyme activity restriction conditions and mass transfer restriction conditions, respectively. The enzyme activity limiting condition was used to measure the carbon monoxide metabolic activity of Eubacterium limosum or to evaluate the toxicity of carbon monoxide to Eubacterium limosum and E. coli. Under these conditions, because there is almost no dissolved carbon monoxide in the medium due to the rapid metabolism of carbon monoxide by Eubacterium limosum, the strains receive the toxic effect of carbon monoxide to a minimum. Mass transfer restrictions were used for co-culture of Eubacterium rimosum and E. coli.

대장균 균주 배양은, 초기 균주 배양을 위해서 2g/L의 효소 추출물(yeast extract)이 포함된 PBBM 배지를 사용하였다. 초기 배양은 OD600가 0.05가 되도록 준비하여 시작되었으며, OD600가 1.0이 되었을 때 세포를 원심분리를 통해 얻은 뒤, 본 배양에 사용되기에 앞서 남아있는 배지 내 탄소원들을 제거해주기 위해서 최소배지인 PBBM 배지로 3회 씻어주었다. 해당 균주들은 적절한 농도로 30mL의 PBBM 배지에 재현탁된 뒤에 본 배양에 사용되었다.E. coli strain culture, PBBM medium containing 2 g / L of enzyme extract (yeast extract) for the initial strain culture was used. The initial culture was started by preparing the OD 600 to be 0.05, and when the OD 600 reached 1.0, the cells were obtained through centrifugation, and then PBBM, a minimum medium, to remove carbon sources in the remaining medium before use in the main culture. The medium was washed 3 times. The strains were resuspended in 30 mL of PBBM medium at an appropriate concentration and then used for the main culture.

배양 중 세포 성장은 UB-1700 분광 광도계 (spectrophotometer)를 사용하여 600nm에서 흡광도를 측정하여 정량되었고, 결과값은 OD600 혹은 OD600 단위 1당 0.31 g DCW/L로 환산하여 계산되었다. 또한, 배지 내 아세트산, 3-하이드록시프로피온산 및 이타콘산은 Aminex HPX-87H 칼럼으로 분당 5mM H2SO4 0.6mL를 이동상으로 이용하여 측정하였으며, 해당 물질들의 검출은 Shodex RI-101 기기를 사용하여 수행하였다. 가스 샘플의 분석을 위해서는 Clarus 680 GC 시스템을 사용하였으며, Carboxen 1010 PLOT 컬럼 (30m x 0.53mm)과 열전도율 검출기 (TCD)를 사용하여 각 물질들을 분리 및 정량하였다.Cell growth during culture was quantified by measuring absorbance at 600 nm using a UB-1700 spectrophotometer, and the result was calculated in terms of OD 600 or 0.31 g DCW/L per OD 600 unit. In addition, acetic acid, 3-hydroxypropionic acid, and itaconic acid in the medium were measured using an Aminex HPX-87H column at 5 mM H 2 SO 4 0.6mL per minute as a mobile phase, and the detection of the substances was detected using a Shodex RI-101 instrument. carried out. For the analysis of gas samples, a Clarus 680 GC system was used, and each material was separated and quantified using a Carboxen 1010 PLOT column (30m x 0.53mm) and a thermal conductivity detector (TCD).

3. 공동배양 조건 설정3. Co-culture condition setting

유박테리엄 리모섬과 대장균의 공동배양을 위해서, 혐기적 조건에서 대장균의 아세트산 대사를 가능하게 해주는 대체전자 수용체를 선별하고자 하였다. 유박테리엄 리모섬은 완전 혐기성 균주로써, 산소에 민감한 효소들을 가지고 있고 과산화물에 대한 저항성이 낮기 때문에 미량의 산소에 의해서도 세포의 생존성이 매우 큰 폭으로 저하된다.For co-culture of Eubacterium limosum and E. coli, an alternative electron acceptor that enables acetic acid metabolism in E. coli under anaerobic conditions was selected. Eubacterium limosum is a completely anaerobic strain, and since it has enzymes sensitive to oxygen and has low resistance to peroxide, the viability of cells is greatly reduced even by a trace amount of oxygen.

한편, 대장균은 도 3에 나타낸 바와 같이, 산소의 유무와 관계없이 성장할 수 있는 통성혐기성 균주이지만, 전자수용체가 없는 조건에서는 아세트산의 대사가 불가능하다. 따라서, 본 발명에서는 해당 두 균주의 공동배양을 위해서 혐기조건에서 대장균이 산소 대신 사용할 수 있는 대체 전자수용체를 선별하여 제공하고자, 대장균이 대체전자수용체로 사용할 수 있다고 알려진 다양한 산화제 [질산염(nitrate), 아질산염(nitrite), DMSO (dimethyl sulfoxide), TMAO (trimethylamine N-oxide), 푸마르산염(fumarate)]를 검사하였다.On the other hand, Escherichia coli is a facultative anaerobic strain that can grow regardless of the presence or absence of oxygen, as shown in FIG. 3 , but in the absence of an electron acceptor, metabolism of acetic acid is impossible. Therefore, in the present invention, in order to select and provide an alternative electron acceptor that can be used instead of oxygen by E. coli under anaerobic conditions for co-culture of the two strains, various oxidizing agents [nitrate (nitrate), nitrite, dimethyl sulfoxide (DMSO), trimethylamine N-oxide (TMAO), and fumarate] were tested.

이를 위하여 야생형 대장균을 OD600이 1이 되도록 준비하였고, 상기에 명시한 산화제들을 각각 다양한 농도 (0, 100, 200 mM)로 첨가한 뒤 각 조건에서 야생형 대장균의 아세트산 대사량을 비교하였다. 이때, 야생형 대장균의 아세트산 대사량은 배양 0시간과 12시간 후의 배지 내 아세트산 농도를 비교함으로써 계산되었다. 도 4의 a에 나타낸 바와 같이, 여러 산화제 중 질산염(nitrate)과 TMAO가 야생형 대장균의 상대적으로 빠른 아세트산 대사를 가능하게 하였다.For this purpose, wild-type E. coli was prepared so that OD 600 became 1, and the oxidizing agents described above were added at various concentrations (0, 100, 200 mM), respectively, and then the acetic acid metabolism of wild-type E. coli was compared under each condition. At this time, the amount of acetic acid metabolism in wild-type E. coli was calculated by comparing the concentration of acetic acid in the medium after 0 hours and 12 hours of culture. As shown in FIG. 4 a, among various oxidizing agents, nitrate and TMAO enabled the relatively rapid metabolism of acetic acid in wild-type E. coli.

추가적으로, 상기한 두 종류의 산화제 (nitrate, TMAO)가 유박테리엄 리모섬의 일산화탄소 대사에 미치는 저해효과를 확인하고자 하였다. 해당 실험을 위해, 효소 활성 제한조건하에서 유박테리엄 리모섬의 단일배양에 질산염과 TMAO를 각각 0, 100, 200mM로 첨가한 뒤 유박테리엄 리모섬의 일산화탄소 대사 활성을 측정하였다. 이때, 유박테리엄 리모섬의 일산화탄소 대사 활성은 배양 초기 6시간 동안 측정된 기체상의 일산화탄소 농도 값을 기반으로 계산되었다. 도 4의 b에 나타낸 바와 같이, 질산염에 비해 TMAO를 첨가했을 때 상대적으로 일산화탄소 대사 활성에 대한 저감 효과가 낮아졌음을 확인하였으며, 이러한 결과를 기반으로 TMAO를 공동배양에 사용할 대체 전자수용체로 선정하였다. 실제 공동배양에서는 100mM의 TMAO를 배양 후 0시간과 36시간에 첨가하였다.Additionally, it was attempted to confirm the inhibitory effect of the two types of oxidizing agents (nitrate, TMAO) on the carbon monoxide metabolism of Eubacterium limosum. For this experiment, nitrate and TMAO were added at 0, 100, and 200 mM, respectively, to a single culture of Eubacterium limosum under enzyme activity limiting conditions, and then the carbon monoxide metabolic activity of Eubacterium limosum was measured. At this time, the carbon monoxide metabolic activity of Eubacterium limosum was calculated based on the gaseous carbon monoxide concentration value measured during the initial 6 hours of culture. As shown in FIG. 4 b, it was confirmed that the reduction effect on carbon monoxide metabolic activity was relatively lowered when TMAO was added compared to nitrate, and based on these results, TMAO was selected as an alternative electron acceptor to be used for co-culture. . In actual co-culture, 100 mM TMAO was added at 0 and 36 hours after incubation.

또한, 도 5에 나타낸 바와 같이, 유박테리엄 리모섬과 대장균 모두 일산화탄소의 독성에 의한 영향을 받을 수 있으며, 이로 인해 대사 활성이 저해된다는 특징을 가짐이 확인되었다.In addition, as shown in FIG. 5, both Eubacterium rimosum and Escherichia coli may be affected by the toxicity of carbon monoxide, thereby confirming that it has a characteristic that metabolic activity is inhibited.

공동배양에 있어 일산화탄소에 의한 독성을 최소화하기 위해서, 본 발명에서는 물질 전달 제한조건을 탐색하였다. 이를 위해 유박테리엄 리모섬을 OD600이 각각 0, 30, 60, 100, 130이 되는 세포밀도로 이들을 101.3kPa의 일산화탄소 분압 조건에서 배양하였고, 이때의 일산화탄소 대사 활성을 측정하였다.In order to minimize the toxicity caused by carbon monoxide in co-culture, in the present invention, mass transfer restriction conditions were explored. To this end, Eubacterium limosum was cultured at a cell density such that OD 600 was 0, 30, 60, 100, and 130, respectively, under a carbon monoxide partial pressure of 101.3 kPa, and carbon monoxide metabolic activity at this time was measured.

도 6에서 나타낸 바와 같이, 사용한 유박테리엄 리모섬의 농도가 OD600 기준 100 이상일 때, 균주의 농도가 높아지더라도 전체 일산화탄소의 대사 활성이 더 이상 증가하지 않음을 확인하였으며, 이는 상기에 명시한 물질 전달 제한조건을 의미한다. 해당 실험을 통해 물질 전달 제한조건이 성공적으로 탐색되었지만, 도 7에 나타낸 바와 같이, 시간이 지남에 따라 지속적으로 감소하는 유박테리엄 리모섬의 일산화탄소 대사 활성을 고려하여 본 발명에서는 공동배양을 위해 유박테리엄 리모섬의 세포밀도가 OD600 기준 150, 일산화탄소 분압이 50.65kPa인 조건을 사용하였다.As shown in FIG. 6, when the concentration of Eubacterium limosum used was 100 or more based on OD 600 , it was confirmed that the metabolic activity of total carbon monoxide does not increase any more, even if the concentration of the strain increases, which is the mass transfer specified above. constraint means. Although the mass transfer restriction condition was successfully explored through the experiment, as shown in FIG. 7, in consideration of the carbon monoxide metabolic activity of Eubacterium limosum, which continuously decreases over time, in the present invention, for co-culture, Conditions were used in which the cell density of Teria limosum was 150 based on OD 600 , and the partial pressure of carbon monoxide was 50.65 kPa.

[[ 실시예Example 2: 합성 미생물 컨소시엄을 통한 일산화탄소로부터 3- 2: 3- from carbon monoxide through a synthetic microbial consortium 하이드록시프로피온산의of hydroxypropionic acid 생산] Produce]

1. 아세트산 유래 3-1. Acetic acid-derived 3- 하이드록시프로피온산hydroxypropionic acid 생산 대장균의 개량 Improvement of production E. coli

설정된 공동배양 조건에서 유박테리엄 리모섬과 재조합 대장균을 공동배양하여 일산화탄소로부터 고부가가치 화학물질을 생산하고자 하였다. 생산하고자 하는 첫 번째 목적화합물로는 3-하이드록시프로피온산을 선택하였으며, 이를 위해 아세트산으로부터 3-하이드록시프로피온산을 고생산할 수 있는 대장균을 개발하고자 하였다.It was attempted to produce high value-added chemicals from carbon monoxide by co-culturing Eubacterium rimosum and recombinant E. coli under the set co-culture conditions. 3-hydroxypropionic acid was selected as the first target compound to be produced, and for this purpose, E. coli capable of producing 3-hydroxypropionic acid from acetic acid was developed.

본 발명자는 기존 연구에서 말로닐-코에이(malonyl-CoA) 의존적 대사회로를 통해서 아세트산으로부터 3-하이드록시프로피온산을 고생산하는 대장균을 개발한 바 있으며, 본 발명에서의 3-하이드록시프로피온산 생산 대장균의 개발은 해당 기존 연구를 참고하여 진행되었다.The present inventors have developed E. coli that highly produces 3-hydroxypropionic acid from acetic acid through a malonyl-CoA-dependent metabolic circuit in a previous study, and 3-hydroxypropionic acid-producing E. coli in the present invention development was carried out with reference to the relevant existing research.

구체적으로, 말로닐-코에이 의존적 대사회로에서, 아세트산은 내생 효소를 통해 아세틸-코에이를 거쳐 말로닐-코에이로 전환되며, 이는 클로로플렉서스 아우란티아커스 (Chloroflexus aurantiacus) 유래의 외래 효소인 말로닐-코에이 환원효소를 통해 3-하이드록시프로피온산으로 전환된다. 기존 연구를 참고하여, 본 발명에서는 대장균 W 균주 내에 말로닐-코에이 환원효소를 암호화하고 있는 외래 유전자인 mcr 유전자를 과발현하였다. 해당 과발현은 중간 복제수의 플라스미드인 pET-duet1 하에서 강한 인듀서블 프로모터인 tac 프로모터와 합성 5'-UTR을 통해 진행되었다. 말로닐-코에이 환원효소의 활성을 향상시키기 위해서 해당 효소에 기존에 알려진 3개의 돌연변이 (N940V, K1106W, S1114R)를 가해주었다. 재조합 대장균의 아세트산 대사속도를 향상시키기 위해서 아세틸-코에이(acetyl-CoA) 합성효소를 암호화하는 내생 유전자인 acs 유전자를 합성 프로모터인 J23100 프로모터와 합성 5'UTR, 낮은 복제수 플라스미드인 pACYC-duet1 하에서 과발현하였다.Specifically, in the malonyl-CoA-dependent metabolic cycle, acetic acid is converted to malonyl-CoA via acetyl-CoA via an endogenous enzyme, which is an exogenous enzyme derived from Chloroflexus aurantiacus . It is converted to 3-hydroxypropionic acid by phosphorus malonyl-Coei reductase. Referring to previous studies, in the present invention, the mcr gene, which is a foreign gene encoding malonyl- Coei reductase , was overexpressed in E. coli W strain. Corresponding overexpression was carried out through a synthetic 5'-UTR with the tac promoter, a strong inducible promoter, under pET-duet1, an intermediate copy number plasmid. In order to improve the activity of malonyl-CoA reductase, three known mutations (N940V, K1106W, S1114R) were added to the enzyme. In order to improve the acetic acid metabolism rate of recombinant E. coli, the acs gene, an endogenous gene encoding an acetyl-CoA synthetase, was combined with the synthetic promoter J23100 promoter and synthetic 5'UTR, under pACYC-duet1, a low copy number plasmid. overexpressed.

본 실시예에서 사용한 모든 플라스미드 및 미생물 균주는 표 1에 나타내었다.All plasmids and microorganism strains used in this Example are shown in Table 1.

이름name 상세 내용Detail Strainsstrains Eubacterium limosumEubacterium limosum An acetogenic microorganism (KCTC3266, ATCC8486)An acetogenic microorganism (KCTC3266, ATCC8486) Escherichia coli W Escherichia coli W An acid tolerant and fast-growing E. coli strain (ATCC9637)An acid tolerant and fast-growing E. coli strain (ATCC9637) CLCL E. coli W ΔiclR/pET-mcr * /pACYC-acs E. coli W Δ iclR/ pET- mcr * /pACYC- acs WCIAG4WCIAG4 E. coli W ΔiclR/pCDF_CAD/pET_ACS/pCOG5 E. coli W Δ iclR/ pCDF_CAD/pET_ACS/pCOG5 PlasmidsPlasmids pKD46pKD46 Red recombinase expression vector, AmpR Red recombinase expression vector, Amp R pCP20pCP20 FLP expression vector, AmpR,CmR FLP expression vector, Amp R , Cm R pRFT3pRFT3 PCR template vector for the red recombination, pMB1 ori, AmpR, KmR, FRT-KmR-FRTPCR template vector for the red recombination, pMB1 ori, Amp R , Km R , FRT-Km R -FRT pET-mcr * pET- mcr * ColE1 ori, AmpR, Ptac-SynUTR mcr -mcr N940V, K1106W, S1114R ColE1 ori, Amp R , P tac -SynUTR mcr - mcr N940V, K1106W, S1114R pACYC-acs pACYC- acs p15A ori, CmR, PBBa_J23100-SynUTR acs -acs p15A ori, Cm R , P BBa_J23100 -SynUTR acs - acs pCDF_CADpCDF_CAD CloDF13 ori, SmR, Ptac-synUTR cad -cad-TerBBa_B1001 CloDF13 ori, Sm R , P tac -synUTR cad -cad -Ter BBa_B1001 pET_ACSpET_ACS ColE1 ori, AmpR, PBBa_J23100-synUTR acs -acs-TerBBa_B1001 ColE1 ori, Amp R , P BBa_J23100 -synUTR acs -acs -Ter BBa_B1001 pCOG5pCOG5 ColA ori, KmR, PBBa_J23100-synUTR gltA -gltA-TerB1001-PBBa_J23100-synUTR aceA -aceA-TerB1001 ColA ori, Km R , P BBa_J23100 -synUTR gltA - gltA -Ter B1001 -P BBa_J23100 -synUTR aceA - aceA -Ter B1001

또한, 글라이옥실산 회로(glyoxylate cycle)에 포함된 aceBAK 유전자의 발현 억제인자를 암호화하고 있는 iclR 유전자를 제거함으로써 글라이옥실산 회로를 활성화시켰다. 상기 iclR 유전자의 제거를 위해서 Lambda-Red 리콤비네이션 시스템을 이용하였다. 상기 Lambda-Red 리콤비네이션 시스템은 벡터 pKD46 및 pcp20와 FRT-KanR_FRT 단편을 이용하는 방법이다. 상기 FRT-KanR-FRT 단편은 iclR 유전자 제거를 위한 것으로, 프라이머 R-iclR-F 및 R-iclR-B를 이용하여 FRT-KanR-FRT를 증폭시킨 것이다. 해당 리콤비네이션의 진행 후에는 프라이머 C-iclR-F 및 C-iclR-B를 사용하여 게놈 유전자의 일부분을 증폭시킨 뒤 프라이머 C-iclR-F를 사용하여 유전자 서열을 확인함으로써 iclR 유전자의 결실을 확인하였다. 사용된 프라이머의 염기서열은 표 2에 나타내었다. 상기의 대장균 개량을 통해서 아세트산 유래 3-하이드록시프로피온산의 고생산 대장균인 CL 균주를 개발하는데 성공하였다.In addition, the glyoxylate cycle was activated by removing the iclR gene, which encodes an expression repressor of the aceBAK gene included in the glyoxylate cycle. For the removal of the iclR gene, a Lambda-Red recombination system was used. The Lambda-Red recombination system is a method using the vectors pKD46 and pcp20 and the FRT-KanR_FRT fragment. The FRT-KanR-FRT fragment is for removing the iclR gene, and FRT-KanR-FRT is amplified using primers R-iclR-F and R-iclR-B. After the recombination, a portion of the genomic gene is amplified using primers C-iclR-F and C-iclR-B, and then the deletion of the iclR gene is confirmed by confirming the gene sequence using the primer C-iclR-F. did The nucleotide sequences of the primers used are shown in Table 2. Through the above-mentioned E. coli improvement, it succeeded in developing a CL strain, which is a high-producing E. coli of 3-hydroxypropionic acid derived from acetic acid.

프라이머명Primer name 폴리뉴클레오타이드 서열 (5'→3')Polynucleotide sequence (5'→3') 서열번호SEQ ID NO: R-iclR-FR-iclR-F TGCCACTCAGGTATGATGGGCAGAATATTGCCTCTGCCCGCCAGAAAAAGGCATGACCGGCGCGATGCTGCCACTCAGGTATGATGGGCAGAATATTGCCTCTGCCCGCCAGAAAAAGGCATGACCGGCGCGATGC 1One R-iclR-BR-iclR-B TAACAATAAAAATGAAAATGATTTCCACGATACAGAAAAAGGAGACTGTCGCTCAGCGGATCTCATGCGCTAACAATAAAAATGAAAATGATTTCCACGATACAGAAAAAGGAGACTGTCGCTCAGCGGATCTCATGCGC 22 C-iclR-FC-iclR-F CAACATTAACTCATCGGATCAGCAACATTAACTCATCGGATCAG 33 C-iclR-BC-iclR-B TCTATTGCCACTCAGGTATGATGGGCTCTATTGCCACTCAGGTATGATGGGC 44

개량된 CL 균주의 아세트산 유래 3-하이드록시프로피온산의 생산성을 평가하기 위해 혐기성 조건에서 CL 균주를 배양하였다. 4g/L의 아세트산이 유일탄소원으로 포함된 PBBM 배지에 100mM의 TMAO를 첨가한 뒤에 혐기성 조건에서 OD600 기준 1 세포 농도의 CL 균주를 72시간 동안 배양하였다. 도 8의 a에 나타낸 바와 같이 CL 균주는 TMAO가 제공된 혐기성 조건에서 72시간 동안 0.81g/L의 아세트산을 소모하여 14.38mg/L의 3-HP를 생산할 수 있음을 확인하였다.In order to evaluate the productivity of 3-hydroxypropionic acid derived from acetic acid of the improved CL strain, the CL strain was cultured under anaerobic conditions. After adding 100 mM TMAO to PBBM medium containing 4 g/L of acetic acid as the sole carbon source, the CL strain at a concentration of 1 cell based on OD 600 was cultured under anaerobic conditions for 72 hours. As shown in FIG. 8 a, it was confirmed that the CL strain was able to produce 14.38 mg/L of 3-HP by consuming 0.81 g/L of acetic acid for 72 hours under anaerobic conditions provided with TMAO.

2. 미생물 컨소시엄을 통한 일산화탄소 유래 3-2. Carbon monoxide-derived 3- through microbial consortium 하이드록시프로피온산hydroxypropionic acid 생산 Produce

일산화탄소로부터 3-하이드록시프로피온산을 생산하기 위해서 유박테리엄 리모섬과 대장균 CL 균주를 공동배양하였다. 상기에 명시한 바와 같이, 유박테리엄 리모섬은 일산화탄소의 물질 전달 제한조건을 위해서 OD600 기준 150의 세포 농도를 사용하였으며, 대장균 CL 균주는 상기 실험에서 사용한 OD600 기준 1의 세포 농도를 사용하였다. 배양은 일산화탄소 50.65kPa 조건에서 수행하였다.To produce 3-hydroxypropionic acid from carbon monoxide, Eubacterium rimosum and Escherichia coli CL strains were co-cultured. As stated above, Eubacterium limosum used a cell concentration of 150 based on OD 600 for the restriction of mass transfer of carbon monoxide, and E. coli CL strain used a cell concentration of 1 based on OD 600 used in the experiment. Cultivation was performed under the conditions of carbon monoxide 50.65 kPa.

도 9에 나타낸 바와 같이, 공동배양의 전체 일산화탄소 소모량은 유박테리엄 리모섬의 단일배양에 비해 약 10% 정도 증가하였다. 해당 공동배양은 이러한 일산화탄소 대사의 향상뿐만 아니라, 보다 낮은 수준의 아세트산 축적 (1.06g/L)과 이로부터 12.80mg/L 수준의 3-하이드록시프로피온산의 생산을 보였다.As shown in Figure 9, the total amount of carbon monoxide consumption of the co-culture increased by about 10% compared to the single culture of Eubacterium limosum. The co-culture showed not only this enhancement of carbon monoxide metabolism, but also a lower level of accumulation of acetic acid (1.06 g/L) and the production of 3-hydroxypropionic acid at a level of 12.80 mg/L therefrom.

이러한 연구 결과는 유박테리엄 리모섬과 대장균 CL 균주로 구성된 미생물 컨소시엄이 상기에 명시한 상호공생 관계를 형성하였음을 시사하며, 이를 통해 일산화탄소 대사 수준의 향상과 일산화탄소 유래의 3-하이드록시프로피온산의 생산이 가능함을 보여준다.These study results suggest that the microbial consortium composed of Eubacterium limosum and Escherichia coli CL strain formed the above-mentioned mutual symbiotic relationship, through which the improvement of carbon monoxide metabolic level and the production of 3-hydroxypropionic acid derived from carbon monoxide show that it is possible

[[ 실시예Example 3: 미생물 컨소시엄 내 상호공생 관계의 증폭을 통한 3- 3: 3- through the amplification of symbiotic relationships within the microbial consortium 하이드록시프로피온산의of hydroxypropionic acid 생산성 향상] Increased productivity]

상기에 명시한 결과를 기반으로, 본 발명자들은 대장균 CL 균주의 군집 크기를 증가시킴으로써 미생물 컨소시엄 내 상호공생 관계를 보다 증폭시킨다면, 일산화탄소 대사활성의 안정성의 추가적인 향상과 이로부터 비롯되는 3-하이드록시프로피온산 생산의 극대화가 가능할 것이라고 가정하였다. 따라서, 공동배양을 위한 CL 균주의 농도 의존적으로 3-HP의 생산량이 증가하는지를 확인하기 위하여, OD600 기준 1, 5, 10, 25, 50 세포 농도의 CL 균주를 유박테리엄 리모섬과 공동배양하였다. 유박테리엄 리모섬의 세포 농도는 일산화탄소의 물질 전달 제한조건을 위해 OD600 기준 150을 사용하였으며, 50.65kPa 분압의 일산화탄소 조건에서 배양을 진행하였다.Based on the results specified above, the present inventors further improved the stability of carbon monoxide metabolic activity and 3-hydroxypropionic acid production resulting therefrom, if the symbiotic relationship within the microbial consortium was further amplified by increasing the colony size of the E. coli CL strain. It is assumed that maximization of Therefore, in order to confirm whether the production of 3-HP is increased in a concentration-dependent manner of the CL strain for co-culture, CL strains of 1, 5, 10, 25, and 50 cell concentrations based on OD 600 were co-cultured with Eubacterium limosum. did For the cell concentration of Eubacterium limosum, an OD 600 standard of 150 was used to limit the mass transfer of carbon monoxide, and culture was performed under a carbon monoxide condition of a partial pressure of 50.65 kPa.

도 10의 a, b에 나타낸 바와 같이, CL 균주의 세포 농도가 증가함에 따라 미생물 컨소시엄의 일산화탄소 대사 안정성이 향상됨을 확인하였다. 유박테리엄 리모섬 단일배양은, 배양 시작 18시간 이후부터 유박테리엄 리모섬의 일산화탄소 대사량이 급격히 감소함을 확인할 수 있었고, 이는 일산화탄소 물질 전달 제한조건의 붕괴로 인해 발생한 현상으로 추측된다.As shown in FIG. 10 a, b, it was confirmed that the carbon monoxide metabolic stability of the microbial consortium was improved as the cell concentration of the CL strain increased. In the single culture of Eubacterium limosum, it was confirmed that the carbon monoxide metabolism of Eubacterium limosum decreased sharply from 18 hours after the start of the culture, which is presumed to be a phenomenon caused by the collapse of the carbon monoxide mass transfer restriction condition.

반면, 미생물 컨소시엄의 경우, CL 균주의 세포 농도가 증가함에 따라 일산화탄소 대사 수준이 향상되었다. 이러한 일산화탄소 대사의 향상은 배양 후반부에 더욱 극명하게 드러났으며, 이는 배양의 안정성이 향상되었음을 보여준다. 특히, 가장 높은 농도인 OD600 기준 50 수준의 CL 균주를 사용했을 때에는 유박테리엄 리모섬의 단일배양에 비해 배양 시작 후 48시간과 72시간 사이의 일산화탄소 대사량이 약 2.64배 증가하였다. 결과적으로, OD600 기준 50 수준의 CL 균주를 사용했을 때 총 72시간 동안의 배양 동안 전체 일산화탄소 대사량이 유박테리엄 리모섬의 단일배양에 비해 약 1.67배 증가하였다.On the other hand, in the case of the microbial consortium, the level of carbon monoxide metabolism improved as the cell concentration of the CL strain increased. This improvement in carbon monoxide metabolism was more evident in the latter half of the culture, indicating that the stability of the culture was improved. In particular, when the CL strain of 50 level based on the highest OD 600 was used, the amount of carbon monoxide metabolism increased by about 2.64 times between 48 hours and 72 hours after the start of the culture compared to the single culture of Eubacterium limosum. As a result, when the CL strain of 50 level based on OD 600 was used, the total carbon monoxide metabolism increased by about 1.67 times compared to the monoculture of Eubacterium limosum during the culture for a total of 72 hours.

본 발명에서는 일산화탄소 대사량뿐만 아니라 중간물질인 아세트산의 축적과 목적화합물인 3-하이드록시프로피온산의 생산을 확인하였다. 도 10의 c에 나타낸 바와 같이, 아세트산의 축적량은 미생물 컨소시엄 내 CL 균주의 세포 농도가 증가함에 따라 감소하였다. 특히, OD600 기준 50 수준의 CL 균주를 사용했을 때에는 매우 미량의 아세트산만이 배지 내에 남아있었으며 (0.09g/L), 이는 유박테리엄 리모섬의 단일배양과 비교했을 때 약 15.85배 감소한 수준이다.In the present invention, the accumulation of acetic acid as an intermediate material as well as the metabolic rate of carbon monoxide and the production of the target compound, 3-hydroxypropionic acid, were confirmed. As shown in Fig. 10c, the amount of accumulation of acetic acid decreased as the cell concentration of the CL strain in the microbial consortium increased. In particular, when a CL strain of 50 level based on OD 600 was used, only a very small amount of acetic acid remained in the medium (0.09 g/L), which was reduced by about 15.85 times compared to the single culture of Eubacterium limosum. .

도 10의 d, e에 나타낸 바와 같이, CL 균주 세포 농도 증가에 따른 유박테리엄 리모섬의 일산화탄소 대사 안정성과 CL 균주의 아세트산 대사 수준 향상은 3-하이드록시프로피온산의 생산성 증진으로 이어졌다. 총 3번의 독립적인 공동배양 실험 결과, OD600 기준 50 수준의 CL 균주를 사용했을 때 평균 6.05mmol의 일산화탄소로부터 45.67mg/L (최대 47.82mg/L)의 3-하이드록시프로피온산이 생산되었음을 확인하였다. 이는 가장 낮은 세포 농도의 CL 균주 (OD600 기준 1)를 사용한 미생물 컨소시엄에 비해 3-하이드록시프로피온산의 생산성이 약 3.57배 증가한 결과이다.As shown in FIG. 10 d, e, the carbon monoxide metabolic stability of Eubacterium rimosum and the improvement of the acetic acid metabolism level of the CL strain according to the increase in the cell concentration of the CL strain led to the improvement of the productivity of 3-hydroxypropionic acid. As a result of a total of three independent co-culture experiments, it was confirmed that 45.67 mg/L (up to 47.82 mg/L) of 3-hydroxypropionic acid was produced from an average of 6.05 mmol of carbon monoxide when using a CL strain of 50 level based on OD 600 . . This is a result of about 3.57-fold increase in productivity of 3-hydroxypropionic acid compared to the microorganism consortium using the CL strain with the lowest cell concentration (1 based on OD 600 ).

결론적으로, 이러한 결과는 합성 미생물 컨소시엄의 구축이 일산화탄소로부터의 고부가가치 물질 생산에 있어 효율적인 접근임을 보여주며, 컨소시엄 내에서 형성되는 상호공생 관계는 일산화탄소의 대사 안정성 향상을 통해 전체 탄소 흐름을 높은 수준으로 유지하는데 기여한다는 점에서 매우 큰 의미를 가진다.In conclusion, these results show that the establishment of a synthetic microbial consortium is an efficient approach to the production of high-value-added substances from carbon monoxide, and the symbiotic relationship formed within the consortium improves the overall carbon flow to a high level through the improvement of the metabolic stability of carbon monoxide. It is very meaningful in that it contributes to maintaining it.

[[ 실시예Example 4: 상호공생 합성 미생물 컨소시엄의 4: Consortium of symbiotic synthetic microorganisms 이타콘산itaconic acid 생산에의 적용] application to production]

1. 아세트산 유래 1. From acetic acid 이타콘산itaconic acid 생산 균주 ( production strain ( WCIAG4WCIAG4 )의 )of 혐기적anaerobic 생산성 검토 Productivity Review

상호공생 관계의 합성 미생물 컨소시엄의 다양한 고부가가치 목적화합물 생산에의 적용 가능성을 검토하기 위해, 일산화탄소로부터 이타콘산의 생산을 시도하였다. 이타콘산 생산을 위해, 본 발명자가 한국등록특허 제10-1973001호를 통해 공개한 이타콘산 고생산 대장균 균주인 WCIAG4 균주를 사용하였다. 본격적인 유박테리엄 리모섬과의 공동배양에 앞서, WCIAG4의 혐기적 단일 배양을 통한 아세트산 유래 이타콘산 생산성에 대해 우선적으로 검토하였다.In order to examine the applicability of the consortium of synthetic microorganisms in a symbiotic relationship to the production of various high value-added target compounds, the production of itaconic acid from carbon monoxide was attempted. For the production of itaconic acid, the WCIAG4 strain, which is a high-producing E. coli strain of itaconic acid disclosed by the present inventors through Korean Patent No. 10-1973001, was used. Prior to co-culture with Eubacterium limosum, the productivity of acetic acid-derived itaconic acid through anaerobic monoculture of WCIAG4 was first reviewed.

도 8의 b에 나타낸 바와 같이, 4g/L의 아세트산과 100mM의 TMAO가 포함된 PBBM 배지에서 혐기적으로 배양을 수행한 결과, 72시간 동안 0.51g/L의 아세트산으로부터 7.72mg/L의 이타콘산이 생산되었음을 확인하였다.As shown in FIG. 8 b, as a result of anaerobic culture in PBBM medium containing 4 g/L acetic acid and 100 mM TMAO, 7.72 mg/L itacone from 0.51 g/L acetic acid for 72 hours. It was confirmed that acid was produced.

2. 미생물 컨소시엄을 통한 일산화탄소 유래 2. Derived from carbon monoxide through a microbial consortium 이타콘산의of itaconic acid 생산 Produce

아세트산 유래 이타콘산의 생산성이 검토된 WCIAG4 균주를 유박테리엄 리모섬과 혐기적 조건에서 공동배양함으로써 일산화탄소로부터 이타콘산을 생산하고자 시도하였다. 3-하이드록시프로피온산 생산의 경우와 유사하게, 다양한 세포 농도의 WCIAG4 균주 (OD600 기준 1, 10, 25, 75)를 OD600 기준 150 수준의 유박테리엄 리모섬과 공동배양하였다.An attempt was made to produce itaconic acid from carbon monoxide by co-culturing the WCIAG4 strain, whose productivity of acetic acid-derived itaconic acid was examined, with Eubacterium limosum under anaerobic conditions. Similar to the case of 3-hydroxypropionic acid production, WCIAG4 strains of various cell concentrations (1, 10, 25, 75 based on OD 600 ) were co-cultured with Eubacterium limosum at a level of 150 based on OD 600 .

도 11의 a, b에 나타낸 바와 같이, 상기에 명시한 유박테리엄 리모섬과 CL 균주의 미생물 컨소시엄과 유사하게, 미생물 컨소시엄 내 WCIAG4 균주의 세포 농도가 증가함에 따라 일산화탄소의 대사 안정성이 향상됨이 확인되었으며, 일산화탄소 대사 수준의 향상은 배양 후반부에 극명하게 드러났다. 특히, WCIAG4 균주의 세포 농도가 OD600 기준 75 수준이었을 때, 배양 초반의 높은 일산화탄소 대사 수준이 배양 전반에 걸쳐 지속적으로 유지되었으며, 결과적으로 해당 미생물 컨소시엄의 전체 일산화탄소 대사량은 유박테리엄 리모섬의 단일 배양에 비해 약 1.52배 증가하였다.As shown in a and b of Figure 11, similar to the microorganism consortium of Eubacterium limosum and CL strain specified above, as the cell concentration of the WCIAG4 strain in the microbial consortium increased, it was confirmed that the metabolic stability of carbon monoxide was improved. , the enhancement of carbon monoxide metabolic level was evident in the latter half of the culture. In particular, when the cell concentration of the WCIAG4 strain was 75 based on OD 600 , the high carbon monoxide metabolism level at the beginning of the culture was continuously maintained throughout the culture, and as a result, the total carbon monoxide metabolism of the microbial consortium was It increased about 1.52 times compared to the culture.

도 11의 c, d 및 e에 나타낸 바와 같이, 아세트산의 축적량 및 이타콘산의 생산량 또한 WCIAG4 균주의 세포 농도가 증가함에 따라 각각 감소 및 증가하는 추세를 보였으며, 이는 가장 낮은 농도의 WCIAG4 균주 (OD600 기준 1)를 포함하고 있는 미생물 컨소시엄 대비 각각 9.63배 감소 및 12.74배 증가한 결과이다. 총 3번의 독립적인 공동배양 실험 결과, OD600 기준 75 수준의 WCIAG4 균주를 사용했을 때 평균 5.49mmol의 일산화탄소로부터 23.15mg/L (최대 25.84mg/L)의 이타콘산 생산이 가능함을 확인하였다.11 c, d and e, the accumulation amount of acetic acid and the production of itaconic acid also showed a trend of decreasing and increasing, respectively, as the cell concentration of the WCIAG4 strain increased, which was the lowest concentration of the WCIAG4 strain (OD Compared to the microbial consortium containing 600 standard 1), it is a result of a decrease of 9.63 times and an increase of 12.74 times, respectively. As a result of a total of three independent co-culture experiments, it was confirmed that 23.15 mg/L (maximum of 25.84 mg/L) of itaconic acid could be produced from an average of 5.49 mmol of carbon monoxide when using the WCIAG4 strain at an OD 600 level of 75.

결론적으로, 이러한 결과는 상호 공생 관계의 합성 미생물 컨소시엄의 구축이 일산화탄소로부터의 고부가가치 물질 생산에 있어 효율적인 접근임을 보여주며, 컨소시엄의 모듈화된 설계를 통해 목적화합물의 다양화 또한 가능하다는 점을 증명한다.In conclusion, these results show that the establishment of a consortium of synthetic microorganisms in a symbiotic relationship is an efficient approach for the production of high value-added substances from carbon monoxide, and it is also possible to diversify target compounds through the modular design of the consortium. .

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Design of mutualistic microbial consortia for stable conversion of carbon monoxide to value-added chemicals <130> POSTECH1.88P <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of FRT-KanR-FRT fragment. This is named "R-iclR-F". <400> 1 tgccactcag gtatgatggg cagaatattg cctctgcccg ccagaaaaag gcatgaccgg 60 cgcgatgc 68 <210> 2 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of FRT-KanR-FRT fragment. This is named "R-iclR-B". <400> 2 taacaataaa aatgaaaatg atttccacga tacagaaaaa ggagactgtc gctcagcgga 60 tctcatgcgc 70 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of a part of genome and confirmation the deletion of iclR gene. This is named "C-iclR-F". <400> 3 caacattaac tcatcggatc ag 22 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of a part of genome. This is named "C-iclR-B". <400> 4 tctattgcca ctcaggtatg atgggc 26 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> cad 5' UTR <220> <221> 5'UTR <222> (1)..(25) <400> 5 aaaaaaaaca aaaggagcat caccc 25 <110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Design of mutualistic microbial consortia for stable conversion of carbon monoxide to value-added chemicals <130> POSTECH1.88P <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of FRT-KanR-FRT fragment. This is named "R-iclR-F". <400> 1 tgccactcag gtatgatggg cagaatattg cctctgcccg ccagaaaaag gcatgaccgg 60 cgcgatgc 68 <210> 2 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of FRT-KanR-FRT fragment. This is named "R-iclR-B". <400> 2 taacaataaa aatgaaaatg atttccacga tacagaaaaa ggagactgtc gctcagcgga 60 tctcatgcgc 70 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of a part of genome and confirmation the deletion of iclR gene. This is named "C-iclR-F". <400> 3 caacattaac tcatcggatc ag 22 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> This is primer for amplification of a part of genome. This is named "C-iclR-B". <400> 4 tctattgcca ctcaggtatg atgggc 26 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> cad 5' UTR <220> <221> 5'UTR <222> (1)..(25) <400> 5 aaaaaaaaca aaaggagcat caccc 25

Claims (12)

일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주를 공동배양하는 단계를 포함하는 유기산 고효율 생산 방법.
A method for high-efficiency production of organic acids comprising the step of co-culturing a strain using carbon monoxide metabolism and a strain using acetic acid metabolism.
 제1항에 있어서,
상기 유기산은,
아세톤산, 아디프산, 아스코르브산, 아크릴산, 시트르산, 2,5-다이케토-D-글루콘산, 포름산, 푸마르산, 글루카르산, 글루콘산, 글루쿠론산, 글루타르산, 3-하이드록시프로피온산, 이타콘산, 락트산, 말레산, 말산, 말론산, 옥살산, 옥살로아세트산, 프로피온산, 숙신산 및 자일자일론부터 선택된 1종 이상인 것을 특징으로 하는 유기산 고효율 생산 방법.
The method of claim 1,
The organic acid is
Acetic acid, adipic acid, ascorbic acid, acrylic acid, citric acid, 2,5-diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxy acid Propionic acid, itaconic acid, lactic acid, maleic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid and xylylone, characterized in that at least one selected from the organic acid high-efficiency production method.
 제1항에 있어서,
상기 공동배양은,
대체전자 수용체가 추가된 혐기성 조건에서 수행되는 것을 특징으로 하는 유기산 고효율 생산 방법.
The method of claim 1,
The co-culture is
A method for high-efficiency production of organic acid, characterized in that it is carried out under anaerobic conditions to which an alternative electron acceptor is added.
 제3항에 있어서,
상기 대체전자 수용체는,
질산염 (nitrate) 또는 TMAO (trimethylamine N-oxide)인 것을 특징으로 하는 유기산 고효율 생산 방법.
4. The method of claim 3,
The alternative electron acceptor is
An organic acid high-efficiency production method, characterized in that nitrate (nitrate) or TMAO (trimethylamine N-oxide).
 제1항에 있어서,
상기 일산화탄소 대사 이용 균주는,
아세토젠(acetogen)인 것을 특징으로 하는 유기산 고효율 생산 방법.
The method of claim 1,
The carbon monoxide metabolism using strain is,
A method for high-efficiency production of organic acid, characterized in that it is acetogen.
 제5항에 있어서,
상기 아세토젠(acetogen)은,
유박테리엄 리모섬(Eubacterium limosum) 또는 클로스트리디움 드라케이(Clostridium drakei)인 것을 특징으로 하는 유기산 고효율 생산 방법.
6. The method of claim 5,
The acetogen is,
Eubacterium limosum limosum ) or Clostridium drakei ( Clostridium drakei ) Organic acid high-efficiency production method, characterized in that.
 제1항에 있어서,
상기 아세트산 대사 이용 균주는,
아세트산으로부터 유기산을 생산하는 대사경로가 도입된 재조합 미생물인 것을 특징으로 하는 유기산 고효율 생산 방법.
The method of claim 1,
The acetic acid metabolism using strain is,
A method for high-efficiency production of organic acids, characterized in that the recombinant microorganisms have introduced a metabolic pathway for producing organic acids from acetic acid.
 제7항에 있어서,
상기 재조합 미생물은, 3-하이드록시프로피온산(3-hydroxypropionic acid) 생산용 재조합 대장균이며,
대장균 W 균주에서, 클로로플렉서스 아우란티아커스 (Chloroflexus aurantiacus) 유래 mcr 유전자 및 acs 유전자가 과발현된 것인 유기산 고효율 생산 방법.
8. The method of claim 7,
The recombinant microorganism is a recombinant E. coli for production of 3-hydroxypropionic acid,
In E. coli W strain, Chloroflexus aurantiacus (Chloroflexus aurantiacus) derived mcr gene and acs gene are overexpressed organic acid high-efficiency production method.
 제7항에 있어서,
상기 재조합 미생물은, 이타콘산(itaconic acid) 생산용 재조합 대장균이며,
서열번호 5의 염기서열로 표시되는 합성 5' UTR(untranslated region), cad 유전자, acs 유전자, aceA 유전자 및 gltA 유전자가 과발현되고, icIR 유전자가 결실된 것인 유기산 고효율 생산 방법.
8. The method of claim 7,
The recombinant microorganism is a recombinant E. coli for production of itaconic acid,
Synthetic 5' UTR (untranslated region), cad gene, acs gene, aceA gene and gltA gene represented by the nucleotide sequence of SEQ ID NO: 5 are overexpressed, and the icIR gene is deleted.
 제1항에 있어서,
상기 일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주는,
1~5 : 1의 세포 농도로 첨가되는 것을 특징으로 하는 유기산 고효율 생산 방법.
According to claim 1,
The strain using carbon monoxide metabolism and the strain using acetic acid metabolism,
A method for high-efficiency production of organic acids, characterized in that they are added at a cell concentration of 1 to 5: 1.
 일산화탄소 대사 이용 균주 및 아세트산 대사 이용 균주를 포함하는 유기산 고효율 생산용 조성물.
A composition for high-efficiency production of organic acids comprising a strain using carbon monoxide metabolism and a strain using acetic acid metabolism.
 제11항에 있어서,
상기 유기산은,
아세톤산, 아디프산, 아스코르브산, 아크릴산, 시트르산, 2,5-다이케토-D-글루콘산, 포름산, 푸마르산, 글루카르산, 글루콘산, 글루쿠론산, 글루타르산, 3-하이드록시프로피온산, 이타콘산, 락트산, 말레산, 말산, 말론산, 옥살산, 옥살로아세트산, 프로피온산, 숙신산 및 자일자일론부터 선택된 1종 이상인 것을 특징으로 하는 유기산 고효율 생산용 조성물.12. The method of claim 11,
The organic acid is
Acetic acid, adipic acid, ascorbic acid, acrylic acid, citric acid, 2,5-diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxy acid A composition for high efficiency production of organic acids, characterized in that at least one selected from propionic acid, itaconic acid, lactic acid, maleic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid and xylylon.
KR1020200106400A 2020-08-24 2020-08-24 Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof KR102507457B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020200106400A KR102507457B1 (en) 2020-08-24 2020-08-24 Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof
PCT/KR2021/009403 WO2022045590A1 (en) 2020-08-24 2021-07-21 Composition comprising mutual symbiotic microorganism consortium for producing organic acid at high efficiency from carbon monoxide and method using same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200106400A KR102507457B1 (en) 2020-08-24 2020-08-24 Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof

Publications (2)

Publication Number Publication Date
KR20220025538A true KR20220025538A (en) 2022-03-03
KR102507457B1 KR102507457B1 (en) 2023-03-07

Family

ID=80353513

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200106400A KR102507457B1 (en) 2020-08-24 2020-08-24 Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof

Country Status (2)

Country Link
KR (1) KR102507457B1 (en)
WO (1) WO2022045590A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023219188A1 (en) * 2022-05-12 2023-11-16 광주과학기술원 Culture medium composition for increasing growth and metabolic rates of acetogenic strain and method for culturing acetogenic strain by using same

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160092931A (en) * 2015-01-28 2016-08-05 에보니크 데구사 게엠베하 A method of producing higher alcohols
KR20190029964A (en) * 2017-09-13 2019-03-21 울산과학기술원 Novel recombinant E. coli strains and method for producing 3- hydroxypropionic acid using thereof
KR101973001B1 (en) * 2017-10-30 2019-04-26 포항공과대학교 산학협력단 Recombinant microorganism producing itaconic acid and production method of itaconic acid using the same
KR102073308B1 (en) 2017-08-29 2020-02-05 광주과학기술원 Method for Converting Non-Ethanol Producing Acetogen to Ethanol Producing Acetogen and Method for Preparing Ethanol Using Carbon Monoxide from the Ethanol Producing Acetogen
KR102089516B1 (en) 2016-01-06 2020-03-16 주식회사 씨원켐 CO hydrating enzyme and method for producing formic acid using the same

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106119112B (en) * 2008-03-27 2021-07-13 基因组股份公司 Microorganisms for the production of adipic acid and other compounds
KR101571322B1 (en) * 2009-01-13 2015-11-26 한국과학기술연구원 Method for manufacturing of bio- alcohol by biological process using hollow fiber membrane from waste and synthetic gases
KR101760340B1 (en) * 2016-01-07 2017-07-21 포항공과대학교 산학협력단 3-hydroxypropionic acid-producing recombinant microorganism and method of producing 3-hydroxypropionic acid using the same
KR102012643B1 (en) * 2016-11-28 2019-08-28 한양대학교 산학협력단 A method for producing C4-C6 organic acids by co-culturing Megasphaera elsdenii and Megasphaera hexanoica strain

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160092931A (en) * 2015-01-28 2016-08-05 에보니크 데구사 게엠베하 A method of producing higher alcohols
KR102089516B1 (en) 2016-01-06 2020-03-16 주식회사 씨원켐 CO hydrating enzyme and method for producing formic acid using the same
KR102073308B1 (en) 2017-08-29 2020-02-05 광주과학기술원 Method for Converting Non-Ethanol Producing Acetogen to Ethanol Producing Acetogen and Method for Preparing Ethanol Using Carbon Monoxide from the Ethanol Producing Acetogen
KR20190029964A (en) * 2017-09-13 2019-03-21 울산과학기술원 Novel recombinant E. coli strains and method for producing 3- hydroxypropionic acid using thereof
KR101973001B1 (en) * 2017-10-30 2019-04-26 포항공과대학교 산학협력단 Recombinant microorganism producing itaconic acid and production method of itaconic acid using the same

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023219188A1 (en) * 2022-05-12 2023-11-16 광주과학기술원 Culture medium composition for increasing growth and metabolic rates of acetogenic strain and method for culturing acetogenic strain by using same

Also Published As

Publication number Publication date
KR102507457B1 (en) 2023-03-07
WO2022045590A1 (en) 2022-03-03

Similar Documents

Publication Publication Date Title
Zhou et al. Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110
US7977075B2 (en) Materials and methods for the efficient production of acetate and other products
Yazdani et al. Engineering Escherichia coli for the efficient conversion of glycerol to ethanol and co-products
Zhang et al. L-malate production by metabolically engineered Escherichia coli
US9034615B2 (en) Glycolic acid production by fermentation from renewable resources
Zhu et al. High glycolytic flux improves pyruvate production by a metabolically engineered Escherichia coli strain
JP4637372B2 (en) Synthetic method and synthetic material for organic products
US8900835B2 (en) Engineering of thermotolerant Bacillus coagulans for production of D(−)-lactic acid
EP3006556B1 (en) Recombinant escherichia coli for producing succinic acid and application thereof
Hong et al. Strain isolation and optimization of process parameters for bioconversion of glycerol to lactic acid
Li et al. Engineering Escherichia coli for fumaric acid production from glycerol
Underwood et al. Genetic changes to optimize carbon partitioning between ethanol and biosynthesis in ethanologenic Escherichia coli
JP2012506716A (en) Microaerobic culture for converting glycerol to chemicals
Niu et al. Metabolic engineering of Escherichia coli for the de novo stereospecific biosynthesis of 1, 2-propanediol through lactic acid
JP7395501B2 (en) Acid-resistant yeast with suppressed ethanol production pathway and method for producing lactic acid using the same
Li et al. Directed pathway evolution of the glyoxylate shunt in Escherichia coli for improved aerobic succinate production from glycerol
Cha et al. Design of mutualistic microbial consortia for stable conversion of carbon monoxide to value-added chemicals
CN103397055A (en) Method for production of hydroxycarboxylic acid by enhancing synthesis of coenzyme
Zhu et al. Identification of the enzymes responsible for 3-hydroxypropionic acid formation and their use in improving 3-hydroxypropionic acid production in Gluconobacter oxydans DSM 2003
Lu et al. Overcoming glutamate auxotrophy in Escherichia coli itaconate overproducer by the Weimberg pathway
Phosriran et al. An efficient production of bio-succinate in a novel metabolically engineered Klebsiella oxytoca by rational metabolic engineering and evolutionary adaptation
KR102507457B1 (en) Composition comprising mutualistic microbial consortia for high efficiency production of organic acid and method for using thereof
US9441251B2 (en) Variant microorganism able to produce large amount of fermentation product, and fermentation product production method using same
Kim et al. Short-Term adaptation modulates anaerobic metabolic flux to succinate by activating ExuT, a Novel D-Glucose transporter in Escherichia coli
JP2005102625A (en) Method for producing d-lactic acid

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant