KR101760340B1 - 3-hydroxypropionic acid-producing recombinant microorganism and method of producing 3-hydroxypropionic acid using the same - Google Patents

Abstract

The present invention relates to a recombinant microorganism producing 3-hydroxypropionic acid and a process for producing 3-hydroxypropionic acid using the recombinant microorganism. More particularly, the present invention relates to a process for producing 3-hydroxypropionic acid from glycerol Hydroxypropionic acid, and a method for producing 3-hydroxypropionic acid using the recombinant microorganism. The present invention also relates to a method for producing 3-hydroxypropionic acid using the recombinant microorganism.

Description

HYDROXYPROPIONIC ACID-PRODUCING RECOMBINANT MICROORGANISM AND METHOD OF PRODUCING 3-HYDROXYPROPIONIC ACID USING THE SAME <br> <br> <br> Patents - stay tuned to the technology 3-HYDROXYPROPIONIC ACID-PRODUCING RECOMBINANT MICROORGANISM AND METHOD OF PRODUCING 3-HYDROXYPROPIONIC ACID USING THE SAME

The present invention relates to a recombinant microorganism producing 3-hydroxypropionic acid and a process for producing 3-hydroxypropionic acid using the recombinant microorganism. More particularly, the present invention relates to a process for producing 3-hydroxypropionic acid from glycerol Hydroxypropionic acid, and a method for producing 3-hydroxypropionic acid using the recombinant microorganism. The present invention also relates to a method for producing 3-hydroxypropionic acid using the recombinant microorganism.

3-Hydroxypropionic acid (3-HP) is a compound that can be converted into various platform compounds such as acrylic acid, acrylamide, and propiolactone. In particular, 3-HP was selected as an important high-value-added compound that could be converted from biomass by the US DOE in 2004, and the importance of 3-HP can be seen from the market value of acrylic acid of 18 trillion won.

3-HP can be chemically synthesized, but it is not environmentally friendly because it involves expensive initial materials and toxic substances generated during the reaction. In contrast, 3-HP biosynthesis through bio-processes using microorganisms has received a lot of attention recently because it is eco-friendly. Naturally, Klebsiella Microorganisms such as pneumoniae , Lactobacillus sp ., and Chloroflexus aurantiacus produce 3-HP as an intermediate or terminator in a variety of biosynthetic pathways. Since the early 2000s, the development of recombinant E. coli through the introduction of genes involved in the biosynthetic pathway in these microorganisms has begun. In 2008, the possibility of 3-HP production of 0.58 g / L from glycerol, a by-product in the biodiesel industry, was reported through the expression of B-12 dependent GDHt (glycerol dehydratase) and ALDH (aldehyde dehydrase) from K. pneumoniae (Rathnasigh et al.) have reported the possibility of producing 3-HP at 0.19 g / L through the introduction of an enzyme capable of converting 3-HP into malonyl-coA from C. aurantiacus And 3-HP production through the beta-alanine pathway.

Among biosynthesis methods of various 3-HPs through microorganisms, methods using B12-dependent GDHt and ALDH from glycerol are the most studied. This reaction has the disadvantage of adding expensive B12, but it can achieve a simple reaction process, followed by high yield and high productivity. Therefore, various methods for increasing 3-HP production through methods such as enzyme engineering, glycerol metabolism pathway, and high-density cell culture have been disclosed since the discovery of pathway using GDHt and ALDH.

However, when 3-HP is biosynthesized from glycerol to a B12-dependent biosynthetic pathway, the accumulation of 3-HPA, an intermediate product due to an imbalance in the enzymatic activity of GDHt and ALDH, becomes a problem. When the 3-HPA is accumulated, it not only shows toxicity to the cells but also inhibits the activity of the enzyme itself, resulting in a marked decrease in the productivity of 3-HP. Therefore, it is highly necessary to develop a high production strain in which a cytotoxic substance such as 3-HPA is not produced and a balance of the 3-HP biosynthetic pathway is achieved.

Therefore, the present inventors have found that, by using the synthetic 5'UTR, the expression amount of the gene involved in the biosynthesis pathway of 3-hydroxypropionic acid from glycerol can be precisely controlled to optimize the carbon flow and improve the productivity of 3-hydroxypropionic acid The present invention has been completed by preparing microorganisms.

It is an object of the present invention to provide a recombinant microorganism for producing 3-hydroxypropionic acid.

Another object of the present invention is to provide a method for producing 3-hydroxypropionic acid using the recombinant microorganism.

In order to achieve the above object, the present invention relates to a synthetic 5'UTR and dhaB encoding GDHt (3-HP), which is transformed with a recombinant vector containing the gene of the present invention.

Also, the present invention provides a method for producing 3-hydroxypropionic acid (3-HP), comprising culturing the recombinant microorganism in a medium containing glycerol as a carbon source.

When the expression level of dhaB, which is a gene involved in biosynthesis of 3-HP, is precisely controlled using the synthetic 5'UTR according to the present invention, it is possible to maximally balance the carbon flow without experiencing the metabolic burden of the prior art It is possible to produce a recombinant microorganism maximizing the productivity of 3-HP. In addition, since 3-HP can be produced from glycerol with high efficiency using the recombinant microorganism, it can be widely applied in various industrial fields where 3-HP is utilized.

1 is a schematic diagram showing a biosynthesis process from glycerol to 3-HP in a microorganism.
2 is a diagram showing a vector map of a recombination vector used in an embodiment of the present invention.
FIG. 3 is a graph showing the results of comparing the enzyme activity of a strain (HGL_BK1) overexpressing both the strain (DUBGK) reported in the previous study and the genes involved in the 3-HP biosynthesis circuit prepared in the present invention.
FIG. 4 is a graph showing a 3-HP production profile of a strain (HGL_BK1, B) over-all of genes involved in a strain (DUBGK, A) reported in the previous study and a gene involved in the 3-HP biosynthesis circuit prepared in the present invention to be.
FIG. 5 is a graph showing the results of SDS-PAGE of the expression levels of DhaB1 enzyme in the HGL_BK1 to HGL_BK5 strains prepared in the present invention.
FIG. 6 is a graph showing relative activities of DhaB1 enzymes in the HGL_BK1 to HGL_BK5 strains prepared in the present invention. FIG.
FIG. 7 shows the yields of 3-HP in the HGL_BK1 to HGL_BK5 strains prepared in the present invention.
FIG. 8 is a graph showing the effect of the 5 'UTR variant of various sequences designed in the present invention on the expression of dhaB1 FIG. 3 shows the yield of 3-HP in the recombinant microorganisms (1 to 5) in which the expression level of the gene is regulated.
FIG. 9 is a graph showing production yields of 3-HP and by-products in a strain (HGL_DBK4) from which an ackA -pta or yqhD gene was produced and a strain (HGL_BK4) from which the gene was not removed.
FIG. 10 is a graph showing a metabolite profile when Fed-batch fermentation of the strain HGL_DBK4 prepared in the present invention for 30 hours.

Before describing the specific contents of the present invention, the meanings used in this specification will be described.

In the present invention, the term "gene" or "(poly) nucleotide" refers to a nucleic acid fragment (nucleic acid molecule) that expresses (encrypts) a specific protein. Nucleotides, which are basic constituent units in nucleic acid molecules, include not only natural nucleotides but also analogues in which sugar or base sites are modified.

The gene of the present invention is not limited to a nucleic acid molecule encoding a specific amino acid sequence (polypeptide) described above, and may be a nucleic acid molecule encoding a polypeptide having an amino acid sequence that exhibits substantial identity to a specific amino acid sequence as described above And the like. The above substantial identity is determined by aligning the amino acid sequence encoded by the gene of the present invention so as to correspond to any other sequence as much as possible and analyzing the aligned sequence using an algorithm commonly used in the art. % Homology, more preferably at least 80% homology, and most preferably at least 90% homology. In addition, the polypeptides having the above identity include, for example, polypeptides having an amino acid sequence in which one or more amino acids are deleted, substituted, inserted, and / or added. Such a polypeptide comprises a polypeptide involved in the synthesis of 3-hydroxypropionic acid, wherein the polypeptide comprises an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted, and / or added, / Or the number of additions is preferably small.

In the present invention, the term "vector" means a gene construct containing a nucleotide sequence operably linked to a suitable regulatory sequence so as to be capable of expressing the gene of interest in a suitable host, Promoters capable of initiating, any operator sequences for modulating such transcription, and sequences that regulate the termination of transcription and translation.

The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein to perform a general function. For example, a nucleic acid sequence encoding a promoter and a protein or RNA may be operably linked to affect the expression of the coding sequence. The operative linkage with the recombinant vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage are made using enzymes generally known in the art.

The expression "expression of a target gene" may mean expression of a gene of interest to produce a protein encoded by the gene of interest. In the present invention, a method for expressing a target gene is a method of expressing a protein encoded by the target gene by culturing a transformant (host cell) transformed with a vector containing the target gene, Lt; RTI ID = 0.0 &gt; biosynthetic &lt; / RTI &gt;

In the present invention, the term "transformation" means that DNA is introduced into a host and the DNA becomes replicable as an extrachromosomal factor or by chromosome integration completion. Transformation includes any method of introducing a nucleic acid molecule into an organism, cell, tissue or organ, and can be carried out by selecting a suitable standard technique depending on the host cell, as is known in the art. Such methods include, for example, electroporation, CaPO ₄ precipitation, CaCl ₂ precipitation, microinjection, polyethylene glycol (PEG), DEAE (diethylaminoethyl) -dextran , A cationic liposome method, and a lithium acetate-DMSO method, but the present invention is not limited thereto.

Hereinafter, the present invention will be described in detail.

The present invention relates to a synthetic 5 'UTR (untranslated region) and a dhaB (glycerol dehydratase) encoding GDHt (3-HP), which is transformed with a recombinant vector containing the gene of the present invention.

In the present invention, "3-hydroxypropionic acid (3-HP; C ₃ H ₆ O ₃ - MW 90.08)" is a weak acid having a pKa of 4.51 at 25 ° C., and is a bicarboxylic organic acid having three carbon atoms. 2-hydroxypropionic acid) and isomers. The 3-HP is amorphous, light yellow like syrup, has a specific gravity of 1.25 and a refractive index of 1.45.

The 3-HP is an important synthetic intermediate used in various chemical processes. It contains 1,3-propanediol (C ₃ H ₈ O ₂ - MW 76.09), acrylic acid (C ₃ H ₄ O ₂ - MW 72.06), methyl acrylate _{(C 4 H 6 O 2 -} MW 86.09), acrylamide _{(C 3 H 5 NO - MW} 71.08), ethyl 3-hydroxy-propionic acid _{(C 5 H 10 O 3 -} MW 118.13), words acid (C ₃ H ₄ O ₄ - MW 104.06), propionolactone (C ₃ H ₄ O ₂ - MW 72.06), and acronitrile (C ₃ H ₄ N - MW 53.06). The 3-HP can be produced through a chemical process using ethylene cyanohydrin, beta-idopropionic acid, beta-bromopropionic acid, beta-chloropropionic acid, beta-propiolactone, May be produced from biological processes.

More specifically, it is possible to produce 3-HP from glycerol through a dehydration and oxidation process catalyzed by various biologically active enzymes. The first step is to dehydrate glycerol by glycerol dehydratase, Hydroxpropionic aldehyde production reaction, and the second step is a reaction in which 3-hydroxypropionaldehyde is dehydrogenated by aldehyde dehydrogenase. The specific 3-HP biosynthetic process is shown in FIG. In the production of 3-HP, the metabolic activity of the two steps is not balanced and accumulation of the intermediate product 3-HPA in the cell inhibits cell growth and lowers the productivity of 3-HP. In order to solve the above problems and to achieve optimization of the 3-HP biosynthetic circuit, the present invention provides a new method for preventing the accumulation of 3-HPA and improving the productivity of 3-HP through a metabolic engineering approach And to precisely control the expression level of the gene encoding glycerol dihydratase related to the conversion of glycerol to 3-HPA in order to achieve a balanced maximization of carbon flow.

In the present invention, &quot; 5'UTR (untranslated region) &quot; means an mRNA fragment located upstream of a coding sequence and not translated into a protein, and is generally defined as a region between a transcription initiation site and a start codon do.

In the present invention, &quot; synthetic 5'UTR &quot; means a non-native 5'UTR consisting of a sequence different from that of the wild-type 5'UTR.

In the present invention, &quot; glycerol dehydratase (GDHt) &quot; is any enzyme that converts glycerol to 3-hydroxypropionaldehyde, and includes both vitamin B12-dependent and non-dependent. The GDHt is a small subunit or a subunit which is a protein encoded by the dhaB1 gene, a medium subunit or a beta subunit which is a protein encoded by the dhaB2 gene, γ subunit).

The dhaB gene is expressed in the genus Klebsiella sp . ), Citrobacter sp . ), Clostridium sp . , Salmonella sp . , And the like, preferably derived from Klebsiella pneumoniae , and exhibit the same enzyme activity But is not limited to.

Preferably, the dhaB DhaB2 gene represented by the base sequence of the dhaB1 gene, SEQ ID NO: 64 represented by the nucleotide sequence of SEQ ID NO: 63 Gene and the nucleotide sequence of SEQ ID NO: 65 dhaB3 Gene, but is not limited thereto.

In the present invention, the expression of dhaB (glycerol dehydratase) encoding GDHt The amount of gene expression was controlled differently. The synthetic 5'UTR can be linked to the desired gene by amplification using primers containing the sequence. In this case, the synthetic 5'UTR is preferably at least two kinds of sequences having different sequences, and the first synthetic 5'UTR has a predicted expression amount (au) of any one of the dhaB genes of more than 1 to 200,000, And the second synthetic 5'UTR is designed so that the predicted expression amounts of the remaining two of the dhaB genes are maximized, preferably 500,000 or more.

The concrete diagram is as follows.

More specifically, gene 1 is low, the expression level of, dhaB1 gene when the dhaB1 gene relative compared to the dhaB2 or dhaB3 gene, preferably a predictive expression level (au) is one more than the first composite 20, only one or less is to be designed The 5'UTR may preferably consist of at least one of the nucleotide sequences of SEQ ID NOS: 1-13, but is not limited thereto. At this time, dhaB2 dhaB3 or maximize the expression level of the gene, preferably the second synthetic 5'UTR a design that is adapted to be at least 500,000 is the dhaB2 gene 2 When the gene 3 and the gene 3 are the dhaB3 gene, they may preferably be composed of at least one of the nucleotide sequences of SEQ ID NOS: 39 to 46, and the gene 2 is the dhaB3 gene and the gene 3 is the dhaB2 The gene may be composed of at least one of the nucleotide sequences of SEQ ID NOS: 47 to 54, but is not limited thereto.

Also, Gene 1 is low, the expression level of, dhaB2 gene when the dhaB2 gene as compared to the relatively dhaB1 or dhaB3 gene, preferably a predictive expression level (au) a first synthetic 5'UTR a is 1 or less than 200,000 can be designed Preferably, at least one of the nucleotide sequences of SEQ ID NOS: 14 to 21, but is not limited thereto. At this time, dhaB1 or maximize the expression level of the dhaB3 gene, preferably the second synthetic 5'UTR designed such that more than 50 million will have two genes dhaB1 When the gene 3 and the gene 3 are the dhaB3 gene, they may preferably be composed of one or more of the nucleotide sequences of SEQ ID NOS: 30 to 38, and the gene 2 is the dhaB3 gene and the gene 3 is the dhaB1 The gene may be composed of at least one of the nucleotide sequences of SEQ ID NOS: 47 to 54, but is not limited thereto.

In addition, gene 1 is relatively low, preferably a predictive expression level (au) is greater than 1 200 000 are to be designed by the first synthesis than 5, compared to the expression level of, dhaB3 gene when the dhaB3 gene for dhaB1 or dhaB2 gene The UTR may preferably be composed of at least one of the nucleotide sequences of SEQ ID NOS: 22 to 29, but is not limited thereto. At this time, dhaB1 dhaB2 or maximize the expression level of the gene, preferably the second synthetic 5'UTR designed such that more than 50 million will have two genes dhaB1 When the gene 3 and the gene 3 are dhaB2 genes, they may preferably be composed of at least one of the nucleotide sequences of SEQ ID NOS: 30 to 38, and the gene 2 is the dhaB2 gene and the gene 3 is dhaB1 When the gene is a gene, it may be composed of at least one of SEQ ID NOs: 39 to 46, but is not limited thereto.

The specific sequences and predicted expression levels of the first synthetic 5'UTR are shown in Table 1, and the specific sequences and the predicted expression levels of the second synthetic 5'UTR are shown in Table 2.

The sequence of the synthetic 5'UTR presented above is designed to control the expression amount of a gene located behind, and is for the purpose of illustrating the present invention, and the content of the present invention is not limited to the specific sequence range thereof, It is obvious that the present invention is within the scope of the present invention as long as it is designed to express a specific expression amount to be presented.

The vector of the present invention is not particularly limited as long as it is replicable in a cell, and any vector known in the art can be used, including plasmid, cosmid, phage particle, and viral vector. For example, vectors which are commercially available in the art, such as pUC19, pSTV28, pBBR1MCS, pBluscriptII, pBAD, pTrc99A, pET, pACYC184 and pBR322 series can be used as expression vectors.

The recombinant vector according to the present invention may be a gdrAB gene encoding a glycerol dihydratase reactivation factor (GDHt reactivase) Gene. &Lt; / RTI &gt;

In the present invention, &quot; GDHt reactivase &quot; acts to maintain the activity of the catalyst during the catalytic reaction of the glycerol dihydratase. The gdrAB The gene is called Klebsiella sp . ), Citrobacter sp . ), Clostridium sp . , Salmonella sp . , And the like . Preferably, it is a microorganism homologous to a microorganism providing glycerol dihydratase. If the same enzyme activity is exhibited But is not limited thereto.

The gdrAB gene is preferably, may be of a gdrB gene represented by the base sequence of the gene gdrA and SEQ ID NO: 67 represented by the nucleotide sequence of SEQ ID NO: 66, but is not limited thereto.

The gdrAB The gene may be expressed in a recombinant vector by a separate promoter or a synthetic 5'UTR, preferably the dhaB The amount of expression can be regulated by a second synthetic 5'UTR designed to give a maximum expression amount by locating genes 2 and 3 in the gene, but the present invention is not limited thereto.

The recombinant vector according to the present invention can be produced by introducing a KGDh gene encoding an aldehyde dehydrogenase (ALDH) Gene. &Lt; / RTI &gt;

In the present invention, &quot; aldehyde dehydrogenase (ALDH) &quot; serves to convert 3-hydroxypropionaldehyde to 3-hydroxypropionic acid. Kgsadh Genes can be derived from Pseudomonas, etc. E. coli or her labor Rouge, preferably azo RY rilrum bridal chamber Lawrence (Azospirillum brasilense ), but is not limited thereto.

Kgsadh The gene may preferably be represented by the nucleotide sequence of SEQ ID NO: 68, but is not limited thereto.

Kgsadh It is preferable that the expression level of the gene is regulated by a synthetic 5'UTR designed to maximize the expression level, preferably 500,000 or more, and the synthetic 5'UTR preferably comprises one or more bases of SEQ ID NOS: 55 to 62 Sequence, but is not limited thereto.

The specific sequence and predicted expression level of the synthetic 5'UTR are shown in Table 3 below.

The gene combination according to the present invention can insert each gene constituting the corresponding combination into one vector or into two or more kinds of vectors. When two or more genes are inserted into a single vector, the genes may be inserted into a form having a constant promoter (for example, constitutive lac promoter), an operator, a terminator, etc., but not limited thereto .

In one embodiment of the present invention, dhaB Gene and gdrAB Lt; RTI ID = 0.0 &gt; kgsadh &lt; / RTI &gt; Recombinant microorganisms were prepared using two or more kinds of vectors such as recombinant vectors containing genes.

The recombinant microorganism according to the present invention may be one in which the ackA -pta gene for producing acetate or the yqhD gene for producing 1,3-PDO is removed in order to minimize the byproducts produced during the biosynthesis of 3-HP .

Microorganism usable for the production of a recombinant microorganism of the present invention or the like bacteria, yeast, fungi, preferably Escherichia coli (E. coli), Bacillus (Bacillus sp.), Pseudomonas species (Pseudomonas sp . ), The genus Agrobacterium sp .), Rhodobacter sp .), Erwinia sp . ), And more preferably Escherichia coli, but is not limited thereto.

In one embodiment according to the present invention, through the design of the synthetic 5'UTR, one of the genes involved in the first step of biosynthesis of 3-HP from glycerol, dhaB1 The predicted expression level of the gene is made to be 200,000 or less, and the remaining dhaB Gene and gdrAB gene, the second step involved in kgsadh A recombinant microorganism that reduces the metabolic burden and maximizes the carbon flow was prepared by linking the synthetic 5'UTR of different sequences to maximize the expression amount of the gene, and then the ackA -pta gene and the yqhD gene were removed, Production efficiency. At this time, the gene encoding the enzyme involved in the first step is preferably expressed through a plasmid having a moderate copy number, for example, pACYC can be used, and a gene coding for an enzyme involved in the second step The gene is preferably expressed through a plasmid having a high copy number, for example, but not limited to, pUC.

In addition, the present invention provides a method for producing 3-hydroxypropionic acid (3-HP), comprising culturing the recombinant microorganism in a medium containing glycerol as a carbon source.

In the present invention, the cultivation of the recombinant microorganism can be carried out using a conventionally known culture method.

In the present invention, the separation and recovery of 3-HP from the recombinant microorganism and the culture solution thereof can be carried out according to the physicochemical properties of the substance, and for example, distillation, electrodialysis, pervaporation, chromatography , Solvent extraction, reaction extraction, HPLC, and the like. These may be used in combination, but the present invention is not limited thereto.

Hereinafter, preferred embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the invention.

Example  1. Preparation of recombinant Escherichia coli for 3-HP production

In order to optimize the carbon flow of the 3-HP biosynthesis circuit, genes encoding enzymes responsible for the two steps involved in the 3-HP biosynthetic process were expressed using plasmids with different replication numbers. That is, the enzyme involved in the first step was expressed through the plasmid pACYC (including p15A origin), which has the normal copy number, and the enzyme involved in the second step was the plasmid pUC (including pMB1 origin) Lt; / RTI &gt;

First, the azo RY rilrum encoding ALDH (aldehyde dehydrogenase) Bra room lances (Azospirillum brasilense) was produced in the pUC / K plasmid to express the gene derived from kgsadh. At this time, kgsadh In order to maximize the expression level of the gene, the existing expression cassette in the pUC / KGSADH plasmid was replaced with an expression cassette utilizing the tac promoter and synthetic 5'UTR. For synthetic 5'UTR kgsadh The synthetic 5'UTR designed to maximize the expression level of the gene is designed to have a predicted expression level of 500,000 or more through the UTR Designer. For example, one of SEQ ID NOs: 55 to 62 of Table 3 The synthetic 5'UTR of SEQ ID NO: 55 was used. The pUC / KGADH plasmid as a template for this purpose and after each amplification plasmid or target gene using the pUC-F / pUC-B primer set or O-kgsadh-F1 / F2 / B primer set, SacI And HindIII restriction endonuclease. The pUC / K plasmid was finally constructed by inserting the target gene region into the plasmid.

Next, GDHt (glycerol dehydratase) in the coding dhaB1,dhaB2, dhaB3 gene GDHt re-activating factor (GDHt reactivase) coding and Ella pneumoniae during which keurep (Klebsiella pneumoniae- derived gdrA , gdrB A pACYC_B0 plasmid was constructed to express the gene. At this time, in order to regulate the activity of GDHt , one of the subunits constituting GDHt , dhaB1 (Including the first synthetic 5'UTR and the second synthetic 5'UTR) to precisely regulate the expression level of the gene and to over-express the remaining subunit genes.

More specifically, the plasmid region was amplified using a pACYC_duet plasmid (Novagen) as a template and a pACYC-F / B primer set. To the plasmid, dhaB2, dhaB3 , gdrA , gdrB To insert the gene, the target gene region was amplified using the pDK7 (p15A) _DhaB123, gdrAB plasmid as a template and the O-dhaB2-F1 / F2 / B primer set. speI and pacI By cloning using restriction enzyme sequences, the pACYC plasmid contains dhaB2 , dhaB3 , gdrA , gdrB The pACYC_B0 plasmid was constructed by inserting the gene region. At this time, dhaB2 , dhaB3 , gdrA , gdrB To maximize the expression level of the gene, the most upstream gene, dhaB2 The 5'UTR region of the gene was changed to a synthetic 5'UTR designed to have a predicted expression level of 500,000 or more through UTR Designer. As an example, synthesis 5'UTR of SEQ ID NO: 39, which is one of SEQ ID NOs: 39 to 46 of Table 2, UTR was used. dhaB2,dhaB3,gdrA, and in line with a gene which is located at the front in the sequence shown gdrB be appropriate to change the sequence of the synthetic 5'UTR.

In addition, a primer set of O-dhaB1-F1 / O-dhaB2-F2 / O-dhaB1-B1 / BO-dhaB1-B2 was prepared using the pDK7 (p15A) _DhaB123 and gdrAB plasmids as the template for insertion of the dhaB1 gene in the pACYC_B0 plasmid And the target gene region was amplified using speI Plasmid pACYC_B1 (including dhab1-V1) was finally prepared through cloning using restriction enzyme sequences. On the other hand, dhaB1 In order to control the amount of gene expression, the 5'UTR region of the dhaB1 gene was changed to a synthetic 5'UTR designed with a different sequence according to the predicted expression amount through the UTR Designer. For this, the O-dhaB1- (including dhab1-V2), pACYC_B3 (including dhab1-V3), and pACYC_B4 (including dhab1-V4) plasmids were produced by cloning in the same manner except that dhaB1-F1-V2, Respectively.

FIG. 2 shows a schematic diagram of two plasmids constructed by the above process, and it is shown in FIG. 2 that Escherichia coli W strain (KCTC1039) to produce recombinant E. coli (HGL_BK1, HGL_BK2, HGL_BK3, HGL_BK4, HGL_BK5).

Phusion DNA Polymerase and restriction enzymes used in the above experiments were purchased from New England Biolabs, and materials for culture preparation were purchased from BD Bioscience and Sigma. In addition, information on the strains and plasmids used in the above experiments are shown in Table 4, the sequences of the primers used in the PCR amplification are shown in Table 5, and the synthesized 5'UTR sequences and predicted expression amounts produced in the present invention are shown in Table 6. In Table 5, F means a forward primer, B means a reverse primer, and an underlined portion means a restriction enzyme site for cloning. In Table 6, the red portion indicates the ribosome binding site.

name Characteristic Strain E. coli W Acid tolerant strain HGL_BK1 W / pACYC_B1 / pUC_K HGL_BK2 W / pACYC_B2 / pUC_K HGL_BK3 W / pACYC_B3 / pUC_K HGL_BK4 W / pACYC_B4 / pUC_K HGL_BK5 W / pACYC_B0 / pUC_K Plasmid pUC_KGSADH pMB1 ori, Kan ^R , P _lac - kgsAdh pACYC_Duet Expression vector; p15A ori, Cm ^R pACYC_B0 p15A ori, Cm ^R , P _tac -SynUTR _dhaB2 - dhaB2 - dhaB3 - gdrA - gdrB pACYC_B1 _{^{p15A ori, Cm R, P tac}} -SynUTR1 dhaB1 - dhaB1 - P tac -SynUTR dhaB2 - dhaB2 - dhaB3 - gdrA - gdrB pACYC_B2 p15A ori, Cm ^R , P _tac -SynUTR2 _dhaB1 - dhaB1 -P _tac- SynTr _dhaB2 - dhaB2 - dhaB3 - gdrA - gdrB pACYC_B3 p15A ori, Cm ^R , P _tac -SynUTR3 _dhaB1 - dhaB1 -P _tac -SynUTR _dhaB2 - dhaB2 - dhaB3 - gdrA - gdrB pACYC_B4 p15A ori, Cm ^R , P _tac -SynUTR4 _dhaB1 - dhaB1 -P _tac- SynTR _dhaB2 - dhaB2 - dhaB3 - gdrA - gdrB pUC / K pMB1 ori, Kan ^R , P _tac -SynUTR _kgsadh - kgsad h

name The sequence (5'-3 ') pACYC-F caggatccgaattcgagctcg pACYC-B ctggtt ACTAGT aagggagagcgtcgagatcc O-dhaB2-F1 ggaattgtgagcggataacaattaataagcaacaaaaaggaggaaaaggtgcaacagacaacccaaattcag O-dhaB2-F2 (speI) cccaac ACTAGT ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt O-dhaB2-B
(pacI) tctctc TTAATTAA aagctttctagatcagtttctctcacttaacg O-dhaB1-F1 ggaattgtgagcggataacaattccataggtcaaaaggagcatcacaaatgaaaagatcaaaacgatttgcagtactgg O-dhaB1-F1-V2 ggaattgtgagcggataacaattccataggtcaaaaggagcatcaccaatgaaaagatcaaaacgatttgcagtactgg O-dHaB1-F1-V3 ggaattgtgagcggataacaattatttgctccaaaaggagcatatcgaatgaaaagatcaaaacgatttgcagtactgg O-dhaB1-F1-V4 ggaattgtgagcggataacaattcatgcgctaaaacagaagcatcagtgatgaaaagatcaaaacgatttgcagtactgg O-dhaB1-B1 ggttcagcccgacaccattgaataacgcaaaaaaccccgcttcggcggggttttttcgc O-dHaB1-B2 ccaaca ACTAGT gcgaaaaaaccccgccgaag pUC-F ttgccgttcggtcttgccggctacgcgtt pUC-B acacacacgag CTCGAG tgagctaactcacattaattgcgttgc O-kgsAdH-F1 gtgtggaattgtgagcggataacaattattttaggcaaaaggaggatctatcatggctaacgtgacttatacggatacg O-kgsAdH-F2 gagttagctcactc GAGCTC ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt O-kgsAdH-B ccggttcgcttgctgtcc

Example  2. Recombination for 3-HP production In E. coli  Enzyme activity assay

In order to confirm that the 3-HP biosynthesis pathway was amplified in the recombinant E. coli prepared in Example 1, enzyme activity was analyzed in the strain HGL_BK1 in which all the enzymes were overexpressed. As a control, the HGL_BK strain (pDK7 (p15A) _DhaB123, gdrAB (including p15A ori, CmR, Ptac-dhaB123-gdrAB) and W strain transformed with pUC_KGSADH plasmid, DBUGK) used in the previous study were used.

More specifically, 35 mM phosphate buffer (pH 8.0), 50 mM potassium chloride, 50 mM 1,2-propanediol, 2 mM NAD +, 1 mM DTT, 15 uM coenzyme B12 and 10 units / ml Of aldehyde dehydrogenase ( Saccharomyces &lt; RTI ID = 0.0 &gt; After we used the reaction buffer containing cerevisiae origin), mixed with lead to a reaction with each of the recombinant strain and the lysate was hemolyzed using Bugbuster, generating analysis and absorbance at 340 nm to measure the amount of NADH that (Using the Victor3 1420 Multilabel Plate Reader).

In addition, in order to analyze the activity of ALDH, the same method as the above GDHt activity assay method except for using a reaction buffer containing 35 mM phosphate buffer (pH 8.0), 50 mM potassium chloride, 5 mM propionaldehyde and 2 mM NAD + .

The results are shown in Fig.

As shown in FIG. 3, it was confirmed that GDHt and ALDH enzyme activities were observed in the HGL_BK1 strain, which was 27.3% in the case of GDHt and 26.5% in the case of ALDH, compared with that of the control strain HGL_BK (DBUGK). Thus, it was confirmed that the enzymes involved in the 3-HP biosynthetic pathway were overexpressed in the HGL_BK1 strain prepared in Example 1 above.

Example  3. Recombination for 3-HP production In E. coli  3-HP Productivity Analysis

In order to confirm 3-HP productivity in the recombinant E. coli prepared in Example 1, the following experiment was performed using HGL_BK1, a strain overexpressing all the enzymes. As a control, HGL_BK (DBUGK) strain was used.

More specifically, each recombinant strain was cultured in a modified 20 ml glycerol M9 medium (100 mM phosphate buffer, 5 g / L MgSO ₄ .7H ₂ O, 2 g / L NH ₄ Cl, 2 g / L yeast extract, 100 mM glycerol as the sole carbon source) and cultured at 37 ° C at 250 rpm for 24 hours. For the maintenance of the plasmid, 50 μg / ml of kanamycin and 25 μg / ml of chloramphenicol were added to the medium, and 0.1 mM IPTG and 2 μM of coenzyme B12 were added for gene expression. After incubation, organisms in the medium were measured using a HPX-87H column and 0.6 ml of 5 mM H ₂ SO ₄ as a mobile phase. Shodex RI-101 instrument was used for detection. The results are shown in Fig.

As shown in FIG. 4, it was confirmed that the strain HGL_BK1 produces 1.69 g / L of 3-HP, which is a value 45.7% lower than that of the control strain HGL_BK (DBUGK). In addition, the HGL_BK1 strain showed 12.1% and 44.6% decrease in cell growth rate and glycerol uptake rate, respectively, as compared with the control strain HGL_BK (DBUGK). It was determined that the 3-HP biosynthesis enzyme was overexpressed in the HGL_BK1 strain but the metabolic burden was caused by the carbon flow imbalance.

Therefore, in order to increase the productivity of 3-HP, it is required to achieve a maximally balanced carbon flow. In order to solve the above problems, it is desired to control the activity of GDHt, an enzyme involved in the conversion of glycerol to 3-HPA , Synthetic 5'UTR and dhaB1 of different sequences as in Example 1 Recombinant strains (HGL_BK1, HGL_BK2, HGL_BK3, HGL_BK4, and HGL_BK5) showing the expression amounts of different dhaB1 genes were transformed with plasmids containing the same genes. The expression level of DhaB1 in each recombinant strain was analyzed by SDS-PAGE. The activity of GDHt was assayed in the same manner as in Example 2, and the amount of 3-HP produced was measured. The results of the above experiments are shown in Figs. 5 to 7. Fig.

As shown in FIG. 5 and FIG. 6, it was confirmed that the expression level of DhaB1 protein and GDHt activity were regulated according to the sequence of synthetic 5'UTR.

Further, as shown in Fig. 7, dhaB1 It was confirmed that productivity of 3-HP was changed by controlling the gene expression level, and dhaB1 The HGL_BK3 and HGL_BK4 strains showing gene expression showed excellent 3-HP production ability of about 4.5 g / L. This result was 266% higher than that of dHB1 overexpressed dhaB1. It was confirmed that both of the byproducts were produced in a small amount without removal of acetate and 1,3-PDO, which are major by-products of 3-HP biosynthesis. (0.40 g / L and 0.07 g / L, respectively).

Next, the sequences of the synthetic 5'UTRs were designed differently to show a dhaB1 gene expression amount of less than 200,000, and a transformant recombinant strain was prepared using the plasmids containing the respective 5'UTRs . From this, the productivity of 3-HP Respectively. The sequence of the synthetic 5'UTR used in this experiment is shown in Table 7, and the results of the experiment are shown in FIG.

5 ' UTR The predicted expression level (a. U.) AATTGCTCCAAAAGGAGCATATCTA (SEQ ID NO: 9) 72,024 ATTTGCTCCGAAAGGAGCATCTCTA (SEQ ID NO: 10) 33,850 ATTTGCTCCAAAAGGAGCATATCGA (SEQ ID NO: 11) 26,318 AATTGCTCCGAAAGGAGCATCTCGA (SEQ ID NO: 12) 13,080 CTTTGCTCCGAAAGGAGCATATCGA (SEQ ID NO: 13) 9,351

As shown in Fig. 8, a plasmid-transformed recombinant strain containing a synthetic 5'UTR designed to show a dhaB1 gene expression amount of 200,000 or less had a similar level of 3-HP Production capacity.

Example  4. Culture in high-concentration glycerol medium

In order to confirm the productivity of 3-HP in the HGL_BK4 strain confirmed to have high productivity of 3-HP in Example 3, 400 mM glycerol was cultured in a medium containing only carbon source. Since the pH of the culture medium is lowered during the production of 3-HP, 10 M NaOH aqueous solution was used to calibrate it.

As a result, it was confirmed that the strain HGL_BK4 produced 21.4 g / L of 3-HP in the high-concentration glycerol medium. However, in this case, there was a problem that 2.11 g / L of acetate and 0.54 g / L of 1,3-PDO were mass-produced as by-products.

In order to solve the above problems and to increase the production ability of 3-HP, the ackA -pta and yqhD genes, which digest the enzymes that produce acetates and 1,3-PDO, which are by-products in the HGL_BK4 strain, are removed and HGL_DBK4 HGL_BK4 /? AckA-pta /? YqhD) was prepared and cultured in the same high-concentration glycerol medium. The sequences of the primers used in the PCR amplification in the above experiment are shown in Table 8, and the results are shown in FIG.

As shown in Fig. 9, the strain HGL_DBK4 produced 22.0 g / L of 3-HP in the high-concentration glycerol medium, and the by-product acetate was 1.45 g / L, which was 31.3% lower than that of the strain HGL_BK4, , Which is a decrease of 88.9% compared with that of the control. The production yield of 3-HP versus glycerol consumed in the HGL_DBK4 strain was 0.75 g / g, which was much higher than the previously reported results.

Example  5. Fed-batch culture

For the high production of 3-HP, glycerol and glucose were fed simultaneously to HGL_DBK4 strain and Fed-batch culture was performed. The pH was adjusted to 7 with aqueous ammonia solution and the total glycerol was kept below 10 g / L. The results are shown in Fig.

As shown in FIG. 10, 3-HP was accumulated in the reactor after addition of IPTG in HGL_DBK4 culture, and initial productivity was confirmed to be 0.3 g / L / h. In addition, after 15 hours of culture, the maximum productivity reached 3.2 g / L / h. Finally, it was confirmed that 30-hour culture resulted in production of 40.51 g / L of 3-HP.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> 3-HYDROXYPROPIONIC ACID-PRODUCING RECOMBINANT MICROORGANISM AND          METHOD OF PRODUCING 3-HYDROXYPROPIONIC ACID USING THE SAME <130> 1-24 <160> 68 <170> Kopatentin 2.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 1 tcaaatctgg aaaggagcat ccgat 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 2 tcaaatctgg aaaggagcat cagat 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 3 tcaaatctga aaaggagcat cagat 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 4 ggtagcactg aaaggagcat cgcca 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 5 tcatatctgg aaaggagcat cagat 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 6 tcgttttgac aaaggagcat cggct 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 7 ggagggcccg aaaggagcat cgcca 25 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 8 catgcgctaa aacagaagca tcagtg 26 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 9 aattgctcca aaaggagcat atcta 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 10 atttgctccg aaaggagcat ctcta 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 11 atttgctcca aaaggagcat atcga 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 12 aattgctccg aaaggagcat ctcga 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 13 ctttgctccg aaaggagcat atcga 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 14 ttgggattga aaaggagtat cagca 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 15 ttgggattga aaaggagttt gagca 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 16 aacaggttca aaaggagctt catct 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 17 aacgggttca aaaggagctt catct 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 18 ttgggattga aaaggagcat cagca 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 19 ctcgtaagac aaaggagcat ctgtt 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 20 ttgggattga aaagtagctt gagca 25 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 21 ttgggattga aaagtagttt gagca 25 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 22 gcctgattct aaaggagcat caaga 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 23 gcatgagtct aaaggagcat cagga 25 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 24 gcctgattct aaaggagcat caagt 25 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 25 attaggtttg aaaggagcat cagct 25 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 26 agagcaaaat aaaggagcat ctcga 25 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 27 gttatccgcg aaaggagcat cgctt 25 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 28 tgcggtatcg aaaggagcat caggc 25 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 29 gcatgggtcc aaaggagcat cgcga 25 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 30 aaaacaaaaa aaaggagcat ctaac 25 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 31 aaatggaaaa aaaggagcat ctaac 25 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 32 aaaacgaaaa aaaggagcat ctaat 25 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 33 taaatgtaaa aaaggagcat ctaag 25 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 34 ccataggtca aaaggagcat cacaa 25 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 35 aaaatgtaag aaaggagcat ctaag 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 36 aacttctaaa aaaggagcat ctaag 25 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 37 aaaacgaaaa aaaggagcat ctcag 25 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dhaB1 <400> 38 ccataggtca aaaggagcat cacca 25 <210> 39 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 39 aataagcaac aaaaaggagg aaaag 25 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 40 ctctaacaag aaaggaggat cttga 25 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 41 ctccaacaag caaggaggat cttga 25 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 42 ctccaccaag caaggaggat cttga 25 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 43 ctccaccaag aaaggaggat cttga 25 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 44 aaaacaaccc aaaggagcat caa 23 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 45 taaaatatca aaaggagcat cgc 23 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB2 <400> 46 caagctaccc aaaggagcat caa 23 <210> 47 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 47 atgacccttg aaaggaggag ccaaa 25 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 48 atgacccttg aaaggaggat tcaaa 25 <210> 49 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 49 agggcccttg aaaggaggat tcaaa 25 <210> 50 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 50 atggcccttg aaaggaggat tcaaa 25 <210> 51 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 51 aggacccttg aaaggaggag ccaaa 25 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 52 aggacccttg aaaggaggag tcaaa 25 <210> 53 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 53 atggcccttg aaaggaggag tcaaa 25 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 5 'UTR-dHaB3 <400> 54 agggcccttg aaaggaggag ccaaa 25 <210> 55 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 55 attttaggca aaaggaggat ctatc 25 <210> 56 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 56 gtcttaaccc aaaggagaat ctatt 25 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 57 aaaatatcgg aaaggagcat ctaca 25 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 58 tctcaaatgg aaaggagcat caaaa 25 <210> 59 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 59 aaactttcgg aaaggagcat cacca 25 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 60 aaattttcgg aaaggagcat cacaa 25 <210> 61 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 61 tcgcatatgg aaaggagcat caaaa 25 <210> 62 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'UTR - KGSADH <400> 62 aaaatatctg aaaggagcat ctaca 25 <210> 63 <211> 1668 <212> DNA <213> Artificial Sequence <220> <223> dhaB1 gene <400> 63 atgaaaagat caaaacgatt tgcagtactg gcccagcgcc ccgtcaatca ggacgggctg 60 gcccggtg tcagtaaaag tggacaacgg tctgatcgtc gagctggacg gcaaacgccg ggaccagttt 180 gacatgatcg accgatttat cgccgattac gcgatcaacg ttgagcgcac agagcaggca 240 atgcgcctgg aggcggtgga aatagcccgc atgctggtgg atattcacgt cagtcgggag 300 gagatcattg ccatcactac cgccatcacg ccggccaaag cggtcgaggt gatggcgcag 360 atgaacgtgg tggagatgat gatggcgctg cagaagatgc gtgcccgccg gaccccctcc 420 aaccagtgcc acgtcaccaa tctcaaagat aatccggtgc agattgctgc tgacgccgcc 480 gaggccggga tccgcggctt ctcagaacag gagaccacgg tcggtatcgc gcgctatgcg 540 ccgtttaacg ccctggcgct gttggtcggt tcgcagtgcg gccgccccgg cgttttgacg 600 cagtgctcgg tggaagaggc caccgagctg gagctgggca tgcgtggctt aaccagctac 660 gccgagacgg tgtcggtcta cggcaccgaa gcggtattta ccgacggcga tgatactccg 720 tggtcaaagg cgttcctcgc ctcggcctac gcctcccgcg ggttgaaaat gcgctacacc 780 tccggcaccg gatccgaagc gctgatgggc tattcggaga gcaagtcgat gctctacctc 840 gaatcgcgct gcatcttcat taccaaaggc gccggggttc aggggctgca aaacggcgcg 900 gtgagctgta tcggcatgac cggcgctgtg ccgtcgggca ttcgggcggt gctggcggaa 960 aacctgatcg cctctatgct cgacctcgaa gtggcgtccg ccaacgacca gactttctcc 1020 cactcggata ttcgccgcac cgcgcgcacc ctgatgcaga tgctgccggg caccgacttt 1080 attttctccg gctacagcgc ggtgccgaac tacgacaaca tgttcgccgg ctcgaacttc 1140 gatgcggaag attttgatga ttacaacatc ctgcagcgtg acctgatggt tgacggcggc 1200 ctgcgtccgg tgaccgaggc ggaaaccatt gccattcgcc agaaagcggc gcgggcgatc 1260 caggcggttt tccgcgagct ggggctgccg ccaatcgccg acgaggaggt ggaggccgcc 1320 acctacgcgc acggtagcaa cgagatgccg ccgcgtaacg tggtggagga tctgagtgcg 1380 gtggaagaga tgatgaagcg caacatcacc ggcctcgata ttgtcggcgc gctgagccgc 1440 agcggctttg aggatatcgc cagcaatatt ctcaatatgc tgcgccagcg ggtcaccggc 1500 gattacctgc agacctcggc cattctcgat cggcagttcg aggtggtgag tgcggtcaac 1560 gacatcaatg actatcaggg gccgggcacc ggctatcgca tctctgccga acgctgggcg 1620 gagatcaaaa atattccggg cgtggttcag cccgacacca ttgaataa 1668 <210> 64 <211> 585 <212> DNA <213> Artificial Sequence <220> <223> The dhaB2 gene <400> 64 gtgcaacaga caacccaaat tcagccctct tttaccctga aaacccgcga gggcggggta 60 gcttctgccg atgaacgcgc cgatgaagtg gtgatcggcg tcggccctgc cttcgataaa 120 caccagcatc acactctgat cgatatgccc catggcgcga tcctcaaaga gctgattgcc 180 ggggtggaag aagaggggct tcacgcccgg gtggtgcgca ttctgcgcac gtccgacgtc 240 tcctttatgg cctgggatgc ggccaacctg agcggctcgg ggatcggcat cggtatccag 300 tcgaagggga ccacggtcat ccatcagcgc gatctgctgc cgctcagcaa cctggagctg 360 ttctcccagg cgccgctgct gacgctggaa acctaccggc agattggcaa aaacgccgcg 420 cgctatgcgc gcaaagagtc accttcgccg gtgccggtgg tgaacgatca gatggtgcgg 480 ccgaaattta tggccaaagc cgcgctattt catatcaaag agaccaaaca tgtggtgcag 540 gacgccgagc ccgtcaccct gcacgtcgac ttagtaaggg agtga 585 <210> 65 <211> 426 <212> DNA <213> Artificial Sequence <220> <223> The dhaB3 gene <400> 65 atgagcgaga aaaccatgcg cgtgcaggat tatccgttag ccacccgctg cccggagcat 60 atcctgacgc ctaccggcaa accattgacc gatattaccc tcgagaaggt gctctctggc 120 gaggtgggcc cgcaggatgt gcggatctcc tgccagaccc ttgagtacca ggcgcagatt 180 gccgagcaga tgcagcgcca tgcggtggcg cgcaatttcc gccgcgcggc ggagcttatc 240 gccattcctg acgagcgcat tctggctatc tataacgcgc tgcgcccgtt ccgctcctcg 300 caggcggagc tgctggcgat cgccgacgag ctggagcaca cctggcatgc gacagtgaat 360 gccgcctttg tccgggagtc ggcggaagtg tatcagcagc ggcataagct gcgtaaagga 420 agctaa 426 <210> 66 <211> 1824 <212> DNA <213> Artificial Sequence <220> <223> The gdrA gene <400> 66 atgccgttaa tagccgggat tgatatcggc aacgccacca ccgaggtggc gctggcgtcc 60 gacgacccgc aggcgagggc gtttgttgcc agcgggatcg tcgcgacgac gggcatgaaa 120 gggacgcggg acaatatcgc cgggaccctc gccgcgctgg agcaggccct ggcgaaaaca 180 ccgtggtcga tgagcgatgt ctctcgcatc tatcttaacg aagccgcgcc ggtgattggc 240 gatgtggcga tggagaccat caccgagacc attatcaccg aatcgaccat gatcggtcat 300 aacccgcaga cgccgggcgg ggtgggcgtt ggcgtgggga cgactatcgc cctcgggcgg 360 ctggcgacgc tgccggcggc gcagtatgcc gaggggtgga tcgtactgat tgacgacgcc 420 gtcgatttcc ttgacgccgt gtggtggctc aatgaggcgc tcgaccgggg gatcaacgtg 480 gtggcggcga tcctcaaaaa ggacgacggc gtgctggtga acaaccgcct gcgtaaaacc 540 ctgccggtgg tagatgaagt gacgctgctg gagcaggtcc ccgagggggt aatggcggcg 600 gtggaagtgg ccgcgccggg ccaggtggtg cggatcctgt cgaatcccta cgggatcgcc 660 accttcttcg ggctaagccc ggaagagacc caggccatcg tccccatcgc ccgcgccctg 720 attggcaacc gttcagcggt ggtgctcaag accccgcagg gggatgtgca gtcgcgggtg 780 atcccggcgg gcaacctcta cattagcggc gaaaagcgcc gcggagaggc cgatgtcgcc 840 gagggcgcgg aagccatcat gcaggcgatg agcgcctgcg ctccggtacg cgacatccgc 900 ggcgaaccgg gcactcacgc cggcggcatg cttgagcggg tgcgcaaggt aatggcgtcc 960 ctgaccgacc atgagatgag cgcgatatac atccaggatc tgctggcggt ggatacgttt 1020 attccgcgca aggtgcaggg cgggatggcc ggcgagtgcg ccatggaaaa tgccgtcggg 1080 atggcggcga tggtgaaagc ggatcgtctg caaatgcagg ttatcgcccg cgaactgagc 1140 gcccgactgc agaccgaggt ggtggtgggc ggcgtggagg ccaacatggc catcgccggg 1200 gcgttaacca ctcccggctg tgcggcgccg ctggcgatcc tcgacctcgg cgccggctcg 1260 acggatgcgg cgatcgtcaa cgcggagggg cagataacgg cggtccatct cgccggggcg 1320 gggaatatgg tcagcctgtt gattaaaacc gagctgggcc tcgaggatct ttcgctggcg 1380 gaagcgataa aaaaataccc gctggccaaa gtggaaagcc tgttcagtat tcgtcacgag 1440 aatggcgcgg tggagttctt tcgggaagcc ctcagcccgg cggtgttcgc caaagtggtg 1500 tacatcaagg agggcgaact ggtgccgatc gataacgcca gcccgctgga aaaaattcgt 1560 ctcgtgcgcc ggcaggcgaa agagaaagtg tttgtcacca actgcctgcg cgcgctgcgc 1620 caggtctcac ccggcggttc cattcgcgat atcgcctttg tggtgctggt gggcggctca 1680 tcgctggact ttgagatccc gcagcttatc acggaagcct tgtcgcacta tggcgtggtc 1740 gccgggcagg gcaatattcg gggaacagaa gggccgcgca atgcggtcgc caccgggctg 1800 ctactggccg gtcaggcgaa ttaa 1824 <210> 67 <211> 354 <212> DNA <213> Artificial Sequence <220> <223> GdRB gene <400> 67 atgtcgcttt caccgccagg cgtacgcctg ttttacgatc cgcgcgggca ccatgccggc 60 gccatcaatg agctgtgctg ggggctggag gagcaggggg tcccctgcca gaccataacc 120 tatgacggag gcggtgacgc cgctgcgctg ggcgccctgg cggccagaag ctcgcccctg 180 cgggtgggta ttgggctcag cgcgtccggc gagatagccc tcactcatgc ccagctgccg 240 gcggacgcgc cgctggctac cggacacgtc accgatagcg acgatcatct gcgtacgctc 300 ggcgccaacg ccgggcagct ggttaaagtc ctgccgttaa gtgagagaaa ctga 354 <210> 68 <211> 1446 <212> DNA <213> Artificial Sequence <220> <223> kgsadh gene <400> 68 atggctaacg tgacttatac ggatacgcaa ctgctgatcg acggcgagtg ggtcgacgcc 60 gcgagcggca agacgatcga cgtcgtgaac ccggcgaccg gcaagccgat cggcagggtg 120 gcccatgcgg gcatcgccga tctcgaccgt gcgctcgccg ccgcgcaaag cggcttcgag 180 gcatggcgca aggtgcccgc gcacgagcgc gcggcgacga tgcgcaaggc ggccgcgctg 240 gtgcgtgaac gcgccgacgc gatcgcgcag ctgatgacgc aggagcaggg caagccgctc 300 accgaagcgc gcgtcgaagt gctgtcggcg gcggacatca tcgaatggtt cgcggacgaa 360 ggccgccgcg tgtacggccg gatcgtgccg ccgcgcaacc tcggcgcaca gcagacggtc 420 gtgaaggagc cggtcggccc ggtcgccgcg ttcacgccgt ggaatttccc ggtcaaccag 480 gtcgtgcgca agctgagcgc cgcgctggca accggctgtt cgttcctcgt gaaagcgccg 540 gaagaaaccc ccgcgtcgcc ggccgcgctg ctgcgcgcct tcgtcgacgc aggcgtgccg 600 gccggcgtga tcggcctcgt gtacggcgat ccggccgaaa tctcgtcgta cctgatcccg 660 cacccggtga tccgcaaggt cacgttcacg ggttcgacgc cggtcggcaa gcagctcgcc 720 tcgctggcgg gcctgcacat gaagcgcgcg acgatggagc tgggcgggca cgcaccggtg 780 atcgtggccg aagacgccga cgttgcgctc gcggtgaaag cggccggcgg cgcgaagttc 840 cgcaacgcgg ggcaggtctg catctcgccg acgcgcttcc tcgtgcacaa cagcatccgc 900 gacgaattca cgcgcgcgct ggtcaagcat gccgaagggc tgaaggtcgg caacggcctc 960 gaggaaggca cgacgctcgg cgcgctcgcg aacccgcgcc ggctgaccgc gatggcgtcg 1020 gtcatcgaca acgcgcgcaa ggtcggtgcg agcatcgaaa ccggcggcga gcggatcggc 1080 tcggaaggca acttcttcgc gccgaccgtg atcgcgaacg tgccgctcga tgcggacgtg 1140 ttcaacaacg agccgttcgg cccggtcgcg gcgattcgcg gtttcgacaa gctcgaagag 1200 gcgatcgcgg aagcgaaccg tttgccgttc ggtcttgccg gctacgcgtt cacgcgttcg 1260 ttcgcgaacg tgcacctgct cacgcagcgc ctcgaagtcg ggatgctgtg gatcaaccag 1320 ccggcgacgc cgtggccgga aatgccgttc ggcggcgtga aggactcggg ctacggttcg 1380 gaaggcggcc cggaagcgct cgagccgtac ctggtcacga agtcggtgac ggtgatggcc 1440 gtctga 1446

Claims (10)

A first synthetic 5'UTR (untranslated region) and a second synthetic 5'UTR represented by different base sequences; And
A recombinant microorganism for producing 3-hydroxypropionic acid (3-HP), which is transformed with a recombinant vector comprising a dhaB gene consisting of dhaB1, dhaB2 and dhaB3 encoding GDHt (glycerol dehydratase)
The first synthetic 5'UTR is represented by any one of the nucleotide sequences of SEQ ID NOS: 1 to 29, and the first synthetic 5'UTR is a predicted expression level of any one of the dhaB genes selected from the group consisting of dhaB1, dhaB2 and dhaB3 (au) of not less than 1 and not more than 200,000,
Wherein the second synthetic 5'UTR is for regulating the expression levels of two other genes not regulated by the first synthetic 5'UTR of the dhaB gene selected from the group consisting of dhaB1, dhaB2 and dhaB3 , Recombinant microorganisms for the production of propionic acid (3-hydroxypropionic acid, 3-HP).
delete delete 2. The method according to claim 1, wherein the first synthetic 5'UTR is for regulating the expression level of the dhaB1 gene and is represented by any one of SEQ ID NOS: 1 to 13, 3-hydroxypropionic acid 3-HP).
2. The method according to claim 1, wherein the first synthetic 5'UTR is for regulating the expression level of the dhaB2 gene, (3-HP). 3. A recombinant microorganism for the production of 3-hydroxypropionic acid (3-HP).
3. The method according to claim 1, wherein the first synthetic 5'UTR is for regulating the expression level of the dhaB3 gene and is represented by any one of SEQ ID NOs: 22 to 29. 3. The 3' -hydroxypropionic acid 3-HP).
2. The recombinant vector according to claim 1, wherein the recombinant vector is selected from the group consisting of gdrAB (GDHt &lt; RTI ID = 0.0 &gt; Recombinant microorganism for the production of 3-hydroxypropionic acid (3-HP).
2. The recombinant microorganism of claim 1, wherein the recombinant vector further comprises a kgsadh gene encoding ALDH (aldehyde dehydrogenase).
The recombinant microorganism according to claim 1, wherein the recombinant microorganism is a recombinant microorganism for producing 3-hydroxypropionic acid (3-HP), wherein the ackA -pta or yqhD gene is removed.
9. A method for producing 3-hydroxypropionic acid (3-HP), comprising culturing the recombinant microorganism of any one of claims 1 to 9 in a medium comprising glycerol as a carbon source.

Images