KR102659292B1 - 5'-UTR for improving conversion of glucose to glycerol and uses thereof - Google Patents

Abstract

A strain with ultimately increased glycerol production by controlling the transcription or protein expression level of a gene through modification of the 5'-UTR (untranslated region) polynucleotide sequence to increase the conversion rate from glucose to glycerol, and a method for producing glycerol using the same It's about.

Description

5'-UTR for improving conversion of glucose to glycerol and uses thereof {5'-UTR for improving conversion of glucose to glycerol and uses thereof}

A strain with ultimately increased glycerol production by controlling the transcription or protein expression level of a gene through modification of the 5'-UTR (untranslated region) polynucleotide sequence to increase the conversion rate from glucose to glycerol, and a method for producing glycerol using the same It's about.

Glycerol is used as a raw material for pharmaceuticals, cosmetics, personal care products, or food, or is widely used in various industrial fields as paint, printing ink, and analytical reagents. In addition, glycerol is a highly functionalized molecule compared to hydrocarbons produced petrochemically, so many high-value chemical products can be produced through various types of chemical reactions.

Glycerol is produced through various methods, such as separation from animal fat and similar raw materials through hydrolysis reaction, saponification reaction in soap production, or transesterification reaction in biodiesel production, but large-scale production is mainly through transesterification method. However, the glycerol produced at this time contains impurities such as catalysts, water, soap, salts, and esters and has low purity, so a separate purification process is required.

Glycerol can also be produced through microbial fermentation. However, not all microorganisms have the ability to naturally synthesize glycerol. For example, bacteria such as Bacillus licheniformis or Lactobacillus lycopersica synthesize glycerol, and Dunaliella sp. or Asteromonas gracilis It is known that algae such as gracilis or yeast of the genus Saccharomyces can synthesize glycerol as a means of protection against high external salt concentration or osmotic pressure. However, the production volume of glycerol from these strains is insufficient to utilize it at an industrial level.

In the case of E. coli, conversion from glucose to glycerol is impossible, so in order to produce glycerol from E. coli, a process for producing glycerol was studied by introducing a heterogeneous enzyme gene involved in converting glucose into glycerol. However, it has not yet reached a commercial level in terms of productivity, yield, and economic feasibility of the medium.

In order to increase the conversion rate of glycerol from glucose in strains that naturally synthesize glycerol or are genetically engineered to synthesize glycerol, the development of technology to increase the activity or control the expression level of enzymes that mediate the glycerol biosynthetic pathway is required.

Domestic Patent Publication No. 10-2004-0104165 (2004.12.10.)

In the present invention, the 5'-UTR (untranslated region) polynucleotide sequence modification is used to regulate gene transcription or protein expression to increase the conversion rate from carbon sources such as glucose to glycerol, ultimately producing a strain with increased glycerol production. And a method for producing glycerol using the same is provided.

As an example, a gene encoding glycerol-3-phosphate dehydrogenase (GPD) into which a synthetic 5'-UTR was introduced, glycerol-3-phosphate phosphatase into which a synthetic 5'-UTR was introduced ( Provided is a microorganism that produces glycerol, transformed with a gene encoding glycerol-3-phosphate phosphatase (GPP), or both.

As another example, a microorganism may be cloned with a gene encoding glycerol-3-phosphate dehydrogenase with an introduced synthetic 5'-UTR, a gene encoding glycerol-3-phosphate phosphatase with an introduced synthetic 5'-UTR, or both. Transforming; and culturing the transformed microorganism in a medium containing a carbon source to produce glycerol.

In another example, an isolated 5'-UTR polynucleotide is provided that increases the transcription amount of the gene encoding glycerol-3-phosphate dehydrogenase.

In another example, an isolated 5'-UTR polynucleotide is provided that increases the amount of transcription of a gene encoding glycerol-3-phosphate phosphatase.

The present invention relates to glycerol-3-phosphate dehydrogenase (GPD) and glycerol-3-phosphate phosphatase (GPP), which are enzymes that convert glucose into glycerol using microorganisms. By introducing a randomly generated synthetic 5'-UTR sequence, the optimal expression level was found and the corresponding 5'-UTR sequence combination was derived.

According to one aspect of the invention, a gene encoding glycerol-3-phosphate dehydrogenase into which a synthetic 5'-UTR has been introduced, a gene encoding glycerol-3-phosphate phosphatase into which a synthetic 5'-UTR has been introduced, or Microorganisms producing glycerol, transformed with both, are provided.

In one embodiment, a gene encoding glycerol-3-phosphate dehydrogenase into which the synthetic 5'-UTR of SEQ ID NO: 3 was introduced and glycerol-3-phosphate phosphatase into which the synthetic 5'-UTR of SEQ ID NO: 11 was introduced. A glycerol-producing microorganism transformed with the encoding gene is provided.

According to another aspect of the present invention, a gene encoding glycerol-3-phosphate dehydrogenase into which a synthetic 5'-UTR has been introduced, a gene encoding glycerol-3-phosphate phosphatase into which a synthetic 5'-UTR has been introduced, or transforming the microorganism with both; And a method for producing glycerol is provided, including the step of producing glycerol by culturing the transformed microorganism in a medium containing a carbon source.

In one embodiment, a gene encoding glycerol-3-phosphate dehydrogenase into which the synthetic 5'-UTR of SEQ ID NO: 3 was introduced and glycerol-3-phosphate phosphatase into which the synthetic 5'-UTR of SEQ ID NO: 11 was introduced. A method for producing glycerol using a microorganism transformed with a coding gene is provided.

According to another aspect of the present invention, it consists of a base sequence represented by SEQ ID NO: selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 6, which increases the transcription amount of the gene encoding glycerol-3-phosphate dehydrogenase. , an isolated 5'-UTR polynucleotide is provided. As a specific example, an isolated 5'UTR polynucleotide consisting of the base sequence shown in SEQ ID NO: 3, which increases the transcription amount of the gene encoding glycerol-3-phosphate dehydrogenase, is provided.

According to another aspect of the present invention, an isolated product consisting of a base sequence represented by SEQ ID NO: 7 to SEQ ID NO: 11 increases the transcription amount of the gene encoding glycerol-3-phosphate phosphatase. 5'-UTR polynucleotides are provided. As a specific example, an isolated 5'UTR polynucleotide consisting of the base sequence shown in SEQ ID NO: 11, which increases the transcription amount of the gene encoding glycerol-3-phosphate phosphatase, is provided.

The term "5'-UTR (untranslated region)" or "5'-untranslated region" refers to a region that is present at the 5'-end of an mRNA transcript but is not translated into amino acids. In genomic sequences, the 5'-UTR is generally defined as the region between the transcription start site and the start codon. The 5'-UTR of vertebrate mRNA can range from tens to hundreds of bases in length. The process of translating mRNA into protein begins with the binding of the 30S subunit of the ribosome to the 5'-UTR. Specifically, when the 16S rRNA (16S ribosomal RNA) in the 30S subunit of the ribosome binds to the ribosome binding site (RBS) of the 5'-UTR, and the tRNA recognizes and binds to the start codon (AUG) of the mRNA Translation into protein begins. The ribosome binding site of the 5'-UTR and the start codon are approximately 6 to 8 nucleotides apart, and within the ribosome binding site, there is a sequence complementary to the sequence of the 3' end of 16S rRNA, which is called Shine-Dalgarno (Shine-Dalgarno). Dalgarno) is called the hierarchy.

Therefore, as an example, in the present invention, the 5'-UTR may include a sequence complementary to the sequence of the 3' end of 16S rRNA, that is, a sequence in which the Shine-Dalgarno sequence is conserved and the sequences before and after it are regulated.

The term "synthetic 5'-UTR (untranslated region)" refers to a non-natural 5'-UTR that differs from the native (wild type) 5'-UTR polynucleotide sequence. Synthetic 5'-UTR refers to a modification of one or more bases in the base sequence constituting the natural 5'-UTR, and such modifications include substitution, addition, deletion, or inversion of bases. As a representative example, the Shine-Dalgarno sequence is conserved in the 5'-untranslated region, and may include sequences in which one or more bases are modified by substitution, addition, deletion, or inversion in the base sequences preceding and following it. .

As an example, the synthetic 5'-UTR may be composed of the base sequence 5'-NNNNNNNNNN-AAAGGAGCATC-NNNN-3' or 5'- NNN-AAAGGAGCATC-NNNNNNNNNNNN -3'. At this time, N means A, T, G or C.

As an example, the synthetic 5'-UTR increases the transcription amount of the gene encoding glycerol-3-phosphate dehydrogenase, ultimately contributing to increased glycerol production by increasing the conversion rate of the strain from glucose to glycerol. do. The synthetic 5'-UTR may be an isolated 5'-UTR polynucleotide consisting of a base sequence represented by a sequence number selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 6. As a specific example, the synthetic 5'-UTR may be an isolated 5'-UTR polynucleotide consisting of the base sequence shown in SEQ ID NO: 3.

As an example, the synthetic 5'-UTR increases the transcription amount of the gene encoding glycerol-3-phosphate phosphatase, ultimately increasing the conversion rate of the strain from glucose to glycerol, thereby contributing to increased glycerol production. The synthetic 5'-UTR may be an isolated 5'-UTR polynucleotide consisting of a base sequence represented by a sequence number selected from the group consisting of SEQ ID NO: 7 to SEQ ID NO: 11. As a specific example, the synthetic 5'-UTR may be an isolated 5'-UTR polynucleotide consisting of the base sequence shown in SEQ ID NO: 11.

As an example, the synthetic 5'-UTR is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the base sequence of any one of the polynucleotides in SEQ ID NOs: 1 to 11. and may have substantially the same 5'-UTR activity as any one of the polynucleotides of SEQ ID NOs: 1 to 11.

“% identity” of a sequence refers to the degree to which bases are identical when two or more polynucleotide sequences are aligned to match each other as much as possible and then the sequences are compared. Percent sequence identity is obtained by, for example, comparing two optimally aligned sequences across a comparison region and determining the number of positions where the same amino acid or nucleic acid appears in both sequences to obtain the number of matched positions. , can be calculated by dividing the number of matched positions by the total number of positions within the comparison range (i.e., range size), and multiplying the result by 100 to obtain the percentage of sequence identity. The percent sequence identity can be determined using a known sequence comparison program, examples of which include BLASTN (NCBI), CLC Main Workbench (CLC bio), MegAlignTM (DNASTAR Inc), etc.

According to another aspect of the invention, vectors comprising the synthetic 5'-UTR described herein are provided. Vectors are contemplated to include any embodiment of the synthetic 5'-UTR polynucleotide sequence described herein.

An embodiment for introducing a synthetic 5'-UTR to enhance the conversion from a carbon source such as glucose to glycerol and ultimately increase the production of glycerol, is to introduce a synthetic 5'-UTR encoding glycerol-3-phosphate dehydrogenase. It may include steps of linking to a gene, a gene encoding glycerol-3-phosphate phosphatase, or both, respectively, and introducing the gene linked to the synthetic 5'-UTR into the strain.

Several pathways are known to biosynthesize glycerol from carbon substrates such as glucose, but representative examples are as follows. First, glucose is converted to glucose-6-phosphate by hexokinase in the presence of ATP. Glucose-6-phosphate is converted to fructose-6-phosphate by glucose-phosphate isomerase, and then converted to fructose-1,6-diphosphate by the action of 6-phosphofructokinase. The diphosphate is converted to dihydroxyacetone phosphate (DHAP) by aldolase. Finally, NADH-dependent glycerol-3-phosphate dehydrogenase (GPD) converts DHAP into glycerol-3-phosphate (G3P), and G3P is then dephosphorylated by glycerol-3-phosphate phosphatase to become glycerol.

The term “glycerol-3-phosphate dehydrogenase (GPD)” refers to the enzyme activity that catalyzes the conversion of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P). refers to a polypeptide that has Glycerol-3-phosphate dehydrogenase is known as NADH, NADPH or FAD- It may be a dependency. Regardless of its origin, glycerol-3-phosphate dehydrogenase is included in the scope of the present application as long as it is an enzyme that has the enzymatic activity of catalyzing the conversion of DHAP to G3P, and examples of genes encoding it include GPD1 or GPD2. there is. In one example of the present application, the GPD1 gene derived from Saccharomyces cerevisiae was used, and its sequence information can be found in SEQ ID NO: 27. However, this only corresponds to a representative embodiment of the present application, and the present invention is not limited thereto.

The term “glycerol-3-phosphate phosphatase (GPP)” refers to a polypeptide with enzymatic activity that catalyzes the conversion of glycerol-3-phosphate (G3P) to glycerol. Regardless of its origin, glycerol-3-phosphate phosphatase is included in the scope of the present application as long as it has an enzymatic activity that catalyzes the conversion of G3P to glycerol, and examples of genes encoding it include GPP1 or GPP2. In one example of the present application, the GPP2 gene derived from Saccharomyces cerevisiae was used, and its sequence information can be found in SEQ ID NO: 28. However, this only corresponds to a representative embodiment of the present application, and the present invention is not limited thereto.

The gene encoding glycerol-3-phosphate dehydrogenase into which a synthetic 5'-UTR was introduced and the gene encoding glycerol-3-phosphate phosphatase into which a synthetic 5'-UTR was introduced are each cloned into a vector and injected into the cell. can be introduced. Alternatively, the two genes can be cloned into one vector and introduced into cells. Here, the vector refers to a genetic construct containing essential regulatory elements operably linked to express the gene insert encoding the target protein in the cells of the individual, and can be used in various forms such as plasmids, viral vectors, bacteriophage vectors, cosmid vectors, etc. A vector of can be used.

A vector is preferred in which the gene inserted into the vector is irreversibly fused into the genome of the host cell, allowing gene expression to continue stably for a long period of time within the cell. These vectors contain transcriptional and translational expression control sequences that allow the gene of interest to be expressed in the selected host. Expression control sequences may include promoters to effect transcription, optional operator sequences to regulate such transcription, and/or sequences to regulate termination of transcription and translation. Initiation codons and stop codons are generally considered to be part of the nucleic acid sequence encoding the protein of interest, must be functional in the subject when the genetic construct is administered, and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible. Additionally, in the case of an expression vector capable of replication, an origin of replication may be included. In addition, it may appropriately include an enhancer, an untranslated region at the 3' end of the gene of interest, a selection marker (eg, antibiotic resistance marker), or a replicable unit. Vectors can self-replicate or integrate into host genomic DNA.

Each component within the vector must be operably linked to each other, and linking of these component sequences can be accomplished by ligation at convenient restriction enzyme sites, or, if such sites do not exist, by conventional methods. It can be performed using a synthetic oligonucleotide adapter or linker.

Examples of useful expression control sequences include the early and late promoters of adenovirus, simian virus 40 (SV40), mouse mammary tumor virus (MMTV) promoter, long terminal repeat (LTR) promoter of HIV, Moloney virus, cytomegalo. Viral (CMV) promoter, Epstein virus (EBV) promoter, Roux Sarcoma virus (RSV) promoter, RNA polymerase II promoter, T3 and T7 promoters, major operator and promoter region of phage lambda, and prokaryotic or eukaryotic cells. or other sequences whose composition and induction are known to regulate the expression of viral genes and various combinations thereof.

According to one aspect of the invention, a strain or cell is provided into which the synthetic 5'-UTR described herein has been introduced.

The strain may have the ability to produce glycerol or may be a strain that has been genetically engineered to have the ability to produce glycerol. The strain may be capable of producing a higher level of glycerol than a microorganism in which a synthetic 5'-UTR is not introduced. The production of glycerol includes production within the strain, production within the cell and secretion outside the cell, or a combination thereof. Glycerol produced within the strain can be converted from other metabolites such as 3-hydroxypropionic acid (3-HP). The glycerol production is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 50% or more, about 60% or more compared to microorganisms in which synthetic 5'-UTR is not introduced. , it may be increased by about 70% or more, about 100% or more, 200% or more, or 300% or more.

Introduction into the strain involves introducing the GPD coding gene linked to the synthetic 5'-UTR, the GPP coding gene linked to the synthetic 5'-UTR, or both into the host cell so that the nucleic acid acts as an extrachromosomal factor or to complete chromosomal integration. This means that it can be copied. For example, a synthetic 5'-UTR can be used to replace a wild-type 5'-UTR by directly introducing a vector containing the synthetic 5'-UTR and a sequence homologous to the adjacent sequence of the wild-type 5'-UTR to be replaced in the strain. , can be introduced into the host organism. As another example, an integration vector containing a synthetic 5'-UTR can be introduced into the strain and thus inserted into the genome of the strain. Tissue-specificity of insertion can be controlled, for example, by the route of vector administration. As another example, a non-integrating vector containing a synthetic 5'-UTR can be introduced into the host organism by introducing it into the host organism.

The strain may be a prokaryotic strain, for example, E. coli (e.g., E. coli DH5a, E. coli JM101 , E. coli K12, E. coli W3110 , E. coli It may be the Escherichia genus, which includes .coli XL1-Blue). However, it is not limited to this, and includes Pseudomonas, Bacillus, Streptomyces, Erwinia, Serratia, Providencia, Corynebacterium, Leptospira, Salmonella, Brevibacteria, and Hypomonas. It can be applied to a variety of strains, including the genus Chromobacterium and Nocadia. Once introduced into an appropriate strain, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself.

Introducing an enzyme gene linked to a synthetic 5'-UTR into a strain can be accomplished using suitable standard techniques, such as electroporation, electroinjection, microinjection, etc., as known in the art. Calcium phosphate co-precipitation, calcium chloride/rubidium chloride method, retroviral infection, DEAE-dextran, cationic liposome method, polyethylene glycol precipitation Methods such as polyethylene glycol-mediated uptake and gene guns may be used, but are not limited thereto. At this time, the circular vector can be cut with an appropriate restriction enzyme and introduced in the form of a linear vector. The medium used for cultivating a strain must appropriately meet the requirements of the specific strain. The medium may contain various carbon sources, nitrogen sources, phosphorus and trace element components.

The carbon source in the medium may include glucose. In addition, monosaccharides, oligosaccharides, polysaccharides, single carbon substrates, or mixtures thereof may be used. Monosaccharides, for example fructose; Oligosaccharides such as sucrose, maltose or lactose; polysaccharides such as starch or cellulose; Examples include single-carbon substrates such as methanol, formaldehyde, or formate. Additionally, lower alcohols such as ethanol, propanol, and butanol; polyhydric alcohols such as glycerol; Organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid, and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, and dodecanoic acid may be included, but are not limited thereto. These substances can be used individually or as mixtures.

Nitrogen sources in the medium include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. It is not limited to this. Nitrogen sources can also be used individually or in mixtures.

Persons in the medium include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, or may contain essential growth substances such as amino acids and vitamins, but is not limited thereto. The above-mentioned raw materials can be added to the culture in an appropriate manner, batchwise or continuously, during the cultivation process.

Additionally, if necessary, the pH of the culture can be adjusted by using basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or acid compounds such as phosphoric acid or sulfuric acid in an appropriate manner. Additionally, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Oxygen or oxygen-containing gas (e.g., air) can be injected into the culture to maintain aerobic conditions, and the temperature of the culture is usually 20°C to 45°C, preferably 25°C to 40°C. Cultivation can be continued until the maximum desired production of glycerol is obtained.

Methods for recovering glycerol from fermentation media are known in the art. For example, glycerol can be obtained from cell media by centrifugation, chromatography, extraction, filtration, precipitation, or combinations thereof.

By increasing the conversion rate from glucose to glycerol by controlling the transcription or protein expression level of the GPD or GPP gene through the use of synthetic 5'-UTR, the production of glycerol can ultimately be increased.

Hereinafter, the present invention will be described in more detail through the following examples. However, these are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Synthesis of 5'-UTR sequence

The 5'-UTR sequence in Table 1 was synthesized by Bioneer (Korea). When calculated using UTR Designer (Seo et al., Metabolic Engineering 15 (2013) 67-74), the 5'-UTR sequence or synthetic 5'-UTR sequence of natural GPD and GPP of Saccharomyces cerevisiae The expression levels of GPD and GPP were predicted as follows, respectively.

Synthetic 5'-UTR variants Expected expression value 5'-UTR sequence (5'->3') GPD-1 2921.25 GTTAAAGGAGCATCTGACACCATGG (SEQ ID NO: 1) GPD-2 115863.62 ACCGAGCGAAAAAGGAGCATCAAAT (SEQ ID NO: 2) GPD-3 157595.06 TAGCAGTAAGAAAGGAGCATCCATC (SEQ ID NO: 3) GPD-4 202697.32 GCACTATCCAAAAGGAGCATCCTAA (SEQ ID NO: 4) GPD-5 208445.75 TTGTGGCAAGAAAGGAGCATCCATC (SEQ ID NO: 5) GPD-6 268101.01 AGACAATTGTAAAGGAGCATCCCAA (SEQ ID NO: 6) GPP-1 20416.57 GTTAAAGGAGCATCTGACCATATGA (SEQ ID NO: 7) GPP-2 51492.12 GAGCGATTCAAAAGGAGCATCCCAG (SEQ ID NO: 8) GPP-3 103601.71 CAGTTGTAGTAAAGGAGCATCAAAA (SEQ ID NO: 9) GPP-4 186385.82 CGTTTCAACAAAAGGAGCATCTCTT (SEQ ID NO: 10) GPP-5 268101.01 CAGTTTTAGTAAAGGAGCATCAAAA (SEQ ID NO: 11) Original UTR-GPD 3646.26 AAACACAAATATTGATAATATAAAG (SEQ ID NO: 12) Original UTR-GPP 4519.83 TAAAACAATAAAAACAATATTCGGA (SEQ ID NO: 13)

Example 2. Production of glycerol using synthetic 5' UTR sequences

2-1. Creation of vectors

GPD1 and GPP2 genes from Saccharomyces cerevisiae were PCR (pre-denaturation at 95 degrees for 2 minutes; denaturation at 95 degrees for 1 minute, denaturation at 55 degrees for 30 seconds) using a forward primer containing a synthetic UTR sequence (Table 2). Annealing was repeated 28 times for 2 minutes at 72 degrees; final extension was maintained at 4 degrees for 5 minutes at 72 degrees, and the pRSFDuet-1 vector (Novagen, 71341) was treated with BamHI/SacI and KpnI/XhoI restriction enzymes, respectively. -3) was cloned. At this time, GPD and GPP were expressed under the synthetic promoters J23101 (tttacagctagctcagtcctaggtattatgctagc: SEQ ID NO: 25) and J23108 (ctgacagctagctcagtcctaggtataatgctagc: SEQ ID NO: 26), respectively.

primer Sequence (5'->3') GPD_1_BamH1_F CATCATCATGGATCCA GTTAAAGGAGCATCTGACACCATGGAtgagcgctgcggctg (SEQ ID NO: 14) GPD_2_BamH1_F CATCATCATGGATCCA ACCGAGCGAAAAAGGAGCATCAAATAtgagcgctgcggctg (SEQ ID NO: 15) GPD_3_BamH1_F CATCATCATGGATCCA TAGCAGTAAGAAAGGAGCATCCATCatgagcgctgcggctg (SEQ ID NO: 16) GPD_4_BamH1_F CATCATCAT GGATCCAGCACTATCCAAAAGGAGCATCCTAA atgagcgctgcggctg (SEQ ID NO: 17) GPD_5_BamH1_F CATCATCATGGATCCA TTGTGGCAAGAAAGGAGCATCCATCatgagcgctgcggctg (SEQ ID NO: 18) GPD_6_BamH1_F CATCATCATGGATCCA AGACAATTGTAAAGGAGCATCCCAA atgagcgctgcggctg (SEQ ID NO: 19) GPP_1_Kpn1_F CATCATCATGGTACCAGTTAAAGGAGCATCTGACCATATGAatgggactcactacgaaaccg (SEQ ID NO: 20) GPP_2_Kpn1_F CATCATCATGGTACCAGAGCGATTCAAAAGGAGCATCCCAGatgggactcactacgaaaccg (SEQ ID NO: 21) GPP_3_Kpn1_F CATCATCATGGTACCACAGTTGTAGTAAAGGAGCATCAAAA atgggactcactacgaaaccg (SEQ ID NO: 22) GPP_4_Kpn1_F CATCATCATGGTACCACGTTTCAACAAAAGGAGCATCTCTTatgggactcactacgaaaccg (SEQ ID NO: 23) GPP_5_Kpn1_F CATCATCATGGTACCACAGTTTTAGTAAAGGAGCATCAAAA atgggactcactacgaaaccg (SEQ ID NO: 24)

2-2. Construction of transformed strains

Escherichia coli W3110 (Alcohol Dehydrogenase, Glycerol Kinase, Acetate Kinase and Lactate Dehydrogenase deletion strain, Quick&easy E. coli gene deletion kit from Gene bridges) was used as the strain. The W3110 strain was plated on an LB plate (containing 10 g tryptone, 5 g yeast extract, 10 g NaCl, and 15 g agar per liter) and cultured at 37°C overnight. The cultured single colony was inoculated into 3-5ml LB liquid medium (medium composition was the same as above but did not contain agar) and cultured overnight at 37°C with agitation. The next morning, the culture was diluted 1:100 in 0.05 liters of LB liquid medium and cultured for 3-6 hours until the OD reached ~0.5. After cooling on ice for 10-15 minutes, cells were collected by centrifugation at 4000 rpm for 10 minutes at 4°C. The cells were resuspended in 1 volume of ice-cold sterile DI water, washed, and centrifuged at 4000 rpm for 10 minutes at 4°C to collect the cells. The collected cells were resuspended in 0.5 volumes of DI water, washed, and centrifuged at 4000 rpm for 10 minutes at 4°C to collect the cells. The collected cells were resuspended in 1 ml of ice-chilled sterile 10% glycerol, and cell aliquots were placed in individual pre-chilled microfuge tubes (90 ul per transformation in a 0.1 cm gap electroporation cuvette). After adding salt-free DNA (1-5 ul) by pipetting, the mixture was transferred to a pre-chilled electroporation cuvette. Electroporation was performed at 1.8 kV, and immediately after the pulse, 1 ml of room temperature LB liquid medium was added to the cells and incubated at 37°C for 1 hour. The culture was plated on LB plates containing kanamycin and excess liquid was allowed to dry/absorb into the plate. The plate was inverted and cultured at 37°C.

2-3. flask culture

For flask culture, a single colony was inoculated into 3 mL of LB (Luria Bertani; peptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L, pH 7.0) medium and incubated at 37°C and 250 rpm for 20 hours. Pre-culture (seed culture) was performed. Afterwards, 1% was inoculated into 100 mL of M9 medium and cultured for 2 days at 37°C and 250 rpm with kanamycin and 2% glucose. _{The M9 medium contains 10 ​ ​} It was prepared by sterilizing it separately, and during main culture, it was composed of 100 mL of 10X M9 salts, 2 mL of 1 M MgSO ₄ , and 0.1 mL of 1 M CaCl ₂ per 1 L of medium.

2-4. Check the production of glycerol

1 mL of the culture medium was centrifuged (4000 rpm, 10 minutes), and the supernatant was prepared using a filter with a size of 0.45 ㎛. Afterwards, glycerol in the culture medium was analyzed using High-Performance Liquid Chromatography (HPLC). For HPLC, 0.5 mM sulfuric acid (H ₂ SO ₄ ) was flowed at a flow rate of 0.4 mL/min using an Aminex HPX-87H ion exclusion column (7.8 * 300 mm, 9㎛), and the temperature of the column was 50°C. Correct. Glycerol was detected at 19.8 minutes on RI. As a result of culturing a total of 16 mutant combinations, glycerol production ranged from 0.1 g/L to 2.9 g/L, and significantly higher glycerol production was obtained in the combination of GPD-3 and GPP-5 (Table 3).

Results of glycerol biosynthesis in strains introduced with synthetic 5'-UTR number Synthetic 5'-UTR variants for GPD Synthetic 5'-UTR variants for GPP Glycerol production
(g/L) One GPD-1 GPP-1 0.7 ± 0.2 2 GPD-2 GPP-2 1.5 ± 1 3 GPD-2 GPP-3 1.0 ± 0.2 4 GPD-2 GPP-4 0.5 ± 0.2 5 GPD-3 GPP-2 0.1 ± 0.7 6 GPD-3 GPP-3 0.7 ± 0.6 7 GPD-3 GPP-5 2.9 ± 0.2 8 GPD-4 GPP-2 1.0 ± 0.1 9 GPD-4 GPP-3 0.6 ± 0.1 10 GPD-4 GPP-5 0.7 ± 0.1 11 GPD-5 GPP-2 0.9 ± 0.1 12 GPD-5 GPP-3 0.1 ± 0.1 13 GPD-5 GPP-5 0.1 ± 0 14 GPD-6 GPP-2 0.8 ± 0 15 GPD-6 GPP-3 0.6 ± 0.7 16 GPD-6 GPP-5 2.5 ± 2.7

From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

<110> LG CHEM, LTD. <120> 5'-UTR for improving conversion of glucose to glycerol and uses of that <130> DPP20181918KR <160> 28 <170>CopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPD-1) <400> 1 gttaaaggag catctgacac catgg 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPD-2) <400> 2 accgagcgaa aaaggagcat caaat 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPD-3) <400> 3 tagcagtaag aaaggagcat ccatc 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPD-4) <400> 4 gcactatcca aaaggagcat cctaa 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPD-5) <400> 5 ttgtggcaag aaaggagcat ccatc 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPD-6) <400> 6 agacaattgt aaaggagcat cccaa 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPP-1) <400> 7 gttaaaggag catctgacca tatga 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPP-2) <400> 8 gagcgattca aaaggagcat cccag 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPP-3) <400> 9 cagttgtagt aaaggagcat caaaa 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPP-4) <400> 10 cgtttcaaca aaaggagcat ctctt 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR (GPP-5) <400> 11 cagttttagt aaaggagcat caaaa 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Original UTR-GPD <400> 12 aaaacacaaat attgataata taaag 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Original UTR-GPP <400> 13 taaaacaata aaaacaatat tcgga 25 <210> 14 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> GPD_1_BamH1_F <400> 14 catcatcatg gatccagtta aaggagcatc tgacaccatg gatgagcgct gcggctg 57 <210> 15 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> GPD_2_BamH1_F <400> 15 catcatcatg gatccaaccg agcgaaaaag gagcatcaaa tatgagcgct gcggctg 57 <210> 16 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> GPD_3_BamH1_F <400> 16 catcatcatg gatccatagc agtaagaaag gagcatccat catgagcgct gcggctg 57 <210> 17 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> GPD_4_BamH1_F <400> 17 catcatcatg gatccagcac tatccaaaag gagcatccta aatgagcgct gcggctg 57 <210> 18 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> GPD_5_BamH1_F <400> 18 catcatcatg gatccattgt ggcaagaaag gagcatccat catgagcgct gcggctg 57 <210> 19 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> GPD_6_BamH1_F <400> 19 catcatcatg gatccaagac aattgtaaag gagcatccca aatgagcgct gcggctg 57 <210> 20 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> GPP_1_Kpn1_F <400> 20 catcatcatg gtaccagtta aaggagcatc tgaccatatg aatgggactc actacgaaac 60 cg 62 <210> 21 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> GPP_2_Kpn1_F <400> 21 catcatcatg gtaccagagc gattcaaaag gagcatccca gatgggactc actacgaaac 60 cg 62 <210> 22 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> GPP_3_Kpn1_F <400> 22 catcatcatg gtaccacagt tgtagtaaag gagcatcaaa aatgggactc actacgaaac 60 cg 62 <210> 23 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> GPP_4_Kpn1_F <400> 23 catcatcatg gtaccacgtt tcaacaaaag gagcatctct tatgggactc actacgaaac 60 cg 62 <210> 24 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> GPP_5_Kpn1_F <400> 24 catcatcatg gtaccacagt tttagtaaag gagcatcaaa aatgggactc actacgaaac 60 cg 62 <210> 25 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> promoter J23101 <400> 25 tttacagcta gctcagtcct aggtattatg ctagc 35 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> promoter J23108 <400> 26 ctgacagcta gctcagtcct aggtataatg ctagc 35 <210> 27 <211> 1176 <212> DNA <213> Saccharomyces cerevisiae <220> <221> gene <222> (1)..(1176) <223>GPD1 <400> 27 atgagcgctg cggctgatcg tcttaacctg acttccggcc atctgaatgc cggccgtaaa 60 cgcagtagca gttctgtgtc attgaaagct gcagaaaaac ctttcaaggt tacggtgatt 120 ggaagtggga actggggtac tacgatcgcc aaagtggtgg ccgagaattg taagggatac 180 ccggaagttt ttgcgcctat agttcagatg tgggtgttcg aggaagagat taatggtgag 240 aaactgaccg aaatcataaa tactagacat cagaatgtga aatatttgcc tggcataact 300 ctgcccgaca atctggttgc caatccagac ttgattgatt cagtcaaaga tgtcgacatc 360 atcgttttca acattccaca ccagtttttg ccgcgtattt gcagccagtt gaaagggcat 420 gtagattcac acgtccgtgc gatctcctgt ttgaagggtt ttgaagtggg tgcgaaaggc 480 gtgcaattgc tctcctcgta cataaccgaa gagctgggta ttcagtgtgg tgctctgtct 540 ggggcgaaca ttgccaccga agtcgcgcag gagcactgga gcgaaacaac agttgcttat 600 catattccga aagatttccg cggtgagggc aaggacgtcg accacaaggt gcttaaggcc 660 ctcttccaca gaccttattt ccacgtcagt gtgatcgagg atgtcgctgg catttcaatc 720 tgtggtgcgt tgaagaacgt tgttgcctta ggttgcggct tcgttgaggg tctaggctgg 780 gggaataacg cttctgctgc gatccagcga gtcggtttgg gcgagatcat ccggttcggc 840 caaatgtttt tcccagagtc tcgggaagag acctactacc aagaatctgc tggtgttgcg 900 gatttgatca ccacctgcgc tgggggccgc aacgtaaagg ttgctaggct gatggctact 960 tctggtaagg atgcctggga atgcgagaag gagttgttga atggccaatc cgctcagggt 1020 ttaattacct gcaaggaagt tcatgaatgg ttggaaaacat gtgggtctgt agaagacttc 1080 ccactctttg aggccgtata ccagatcgta tataacaatt acccgatgaa gaacctgccg 1140 gacatgatg aagaattaga ccttcatgaa gattga 1176 <210> 28 <211> 753 <212> DNA <213> Saccharomyces cerevisiae <220> <221> gene <222> (1)..(753) <223> GPP2 <400> 28 atgggactca ctacgaaacc gctgagcttg aaagttaatg ctgcgctgtt tgacgtcgat 60 ggcaccatta tcatcagcca gcccgccatt gccgcatttt ggcgcgattt cggtaaggac 120 aaaccttatt ttgatgctga gcacgttatt caagtgagtc atgggtggag aacgtttgat 180 gcaattgcga aattcgcgcc ggatttcgcc aatgaagagt acgtgaataa actggaggct 240 gaaattccgg ttaaatatgg tgaaaaaagc atagaagtgc caggtgcagt taagctgtgc 300 aacgctctta acgcccttcc caaggaaaaa tgggcagtgg cgacgtcagg gacccgtgac 360 atggcacaga agtggttcga acatctgggc atacggcgtc caaagtattt tattaccgct 420 aatgatgtca agcagggtaa gcctcatcca gaaccgtatc tgaagggccg caatggctta 480 ggatatccga tcaacgagca agacccttcg aaatctaaag tggtagtatt tgaggatgct 540 ccggcaggaa ttgccgccgg taaagcggcg gggtgtaaaa tcataggtat tgcaactaca 600 tttgatttgg acttcctgaa ggagaaaggc tgtgatatca ttgtcaagaa ccacgaatcc 660 atccgcgtag gcggatacaa tgcggaaaca gatgaagttg agtttatatt tgatgactac 720 ttatatgcca aagacgatct gctgaaatgg taa 753

Claims (7)

A gene encoding glycerol-3-phosphate dehydrogenase (GPD) into which the synthetic 5'-UTR (untranslated region) of SEQ ID NO: 3 was introduced and the synthetic 5'-UTR of SEQ ID NO: 11 Transformed with a gene encoding the introduced glycerol-3-phosphate phosphatase (GPP),
Microorganisms that produce glycerol. A gene encoding glycerol-3-phosphate dehydrogenase (GPD) into which the synthetic 5'-UTR (untranslated region) of SEQ ID NO: 3 was introduced and the synthetic 5'-UTR of SEQ ID NO: 11 Transforming a microorganism with a gene encoding the introduced glycerol-3-phosphate phosphatase (GPP); and
Comprising the step of producing glycerol by culturing the transformed microorganism in a medium containing a carbon source,
Method of producing glycerol. The method of claim 2, wherein the carbon source is a monosaccharide, oligosaccharide, polysaccharide, single carbon substrate, or a mixture thereof. An isolated 5'UTR polynucleotide consisting of the base sequence represented by SEQ ID NO: 3, which increases the transcription amount of the gene encoding glycerol-3-phosphate dehydrogenase (GPD). An isolated 5'UTR polynucleotide consisting of the base sequence represented by SEQ ID NO: 11, which increases the transcription amount of the gene encoding glycerol-3-phosphate phosphatase (GPP). delete delete