KR20220089528A - E.coli strain with increased 3-hydroxypropionic acid production and method for producing 3-hydroxypropionic acid using the same - Google Patents

Abstract

It relates to a microorganism having improved production of 3-hydroxypropionic acid (3-HP) and a method for producing 3-HP using the same.

Description

E. coli strain with increased production of 3-hydroxypropionic acid and production method of 3-hydroxypropionic acid using the same {E.coli strain with increased 3-hydroxypropionic acid production and method for producing 3-hydroxypropionic acid using the same}

It relates to an E. coli strain having improved production of 3-hydroxypropionic acid (3-HP) and a method for producing 3-HP using the same.

3-Hydroxypropionic acid (3-HP) is an isomer of lactic acid (2-hydroxypropionic acid) and is used as a crosslinking agent for polymer coatings, metal lubricants, and antistatic agents for fibers. Acrylic acid, 1,3-propanediol, methyl acrylate , ethyl 3-hydroxypropionic acid, malonic acid, propionlactone, acronitrile, or acrylamide, are platform compounds that can be converted into several commercially important chemicals.

3-HP can be produced through a chemical process using ethylene cyanohydrin, beta-idopropionic acid, beta-bromopropionic acid, beta-chloropropionic acid, beta-propiolactone, acrylic acid, etc. as intermediates, and from glycerol It can also be produced through biological processes. However, most of these chemicals are toxic and carcinogenic, consume a large amount of energy under conditions of high temperature and pressure, and discharge large amounts of pollutants.

3-HP can also be produced through microbial fermentation. Although the 3-HP production process using E. coli or Krebsiella pneumoniae has been studied so far, it has not yet reached a commercial level in terms of productivity, yield, economic feasibility, etc. of the medium.

Therefore, there is a need to develop a technique for increasing the production of 3-HP from microorganisms.

Domestic patent registration 10-1048485 (2011.07.05)

In one example, the activity of cyclopropane fatty acid synthetase is increased than the intrinsic activity, and provides an E. coli strain with improved ability to produce 3-hydroxypropionic acid (3-HP).

Another example provides a method for producing 3-hydroxypropionic acid (3-HP), comprising culturing the strain.

According to one aspect of the present invention, the activity of cyclopropane fatty acid synthetase (cyclopropane fatty acid synthetase) is increased than the intrinsic activity, there is provided an E. coli strain with improved ability to produce 3-hydroxypropionic acid (3-HP).

In one embodiment, the strain may have increased activity by increasing the expression level of the cfa gene encoding cyclopropane fatty acid synthase.

In another embodiment, the increase in the expression level of the gene may be made by introducing one or more copies of the cfa gene in addition to the endogenous gene of the Escherichia coli strain.

In another embodiment, the introduced gene may be inserted into an E. coli chromosome.

In another embodiment, the E. coli strain is a gene encoding glycerol dehydratase, a gene encoding aldehyde dehydrogenase, and glycerol dehydratase reactivase ) may include one or more selected from the group consisting of a gene encoding.

According to another aspect of the present invention, there is provided a method for producing 3-hydroxypropionic acid (3-HP), comprising the step of culturing the E. coli strain.

Hereinafter, the present invention will be described in more detail.

The term "cyclopropane fatty acid synthetase" refers to S-adenosyl-L-methionine and phospholipid olefinic fatty acid, S- It refers to an enzyme that catalyzes the conversion of adenosyl-L-homocysteine into S-adenosyl-L-homocysteine and phospholipid cyclopropane fatty acid. The enzyme, regardless of its origin, is included in the scope of the present application as long as it is an enzyme having cyclopropane fatty acid synthase activity, and cfa may be exemplified as a gene encoding it. In one example of the present application, the cfa gene derived from E. coli was used, and its sequence information can be confirmed in GenBank registration number VWQ02623.1. In the present application, the amino acid sequence is shown in SEQ ID NO: 1, and the nucleotide sequence of the nucleic acid encoding it is shown in SEQ ID NO: 2. However, this corresponds only to a representative embodiment of the present application, and the present invention is not limited thereto.

In the E. coli strain of the present application, the activity of cyclopropane fatty acid synthetase is increased than the intrinsic activity of E. coli by the original endogenous enzyme, and the ability to produce 3-hydroxypropionic acid (3-HP) is characterized by improvement.

In the E. coli strain of the present application, the ability to produce 3-hydroxypropionic acid (3-HP) is improved, and the growth rate is improved, compared to the strain in which the activity of cyclopropane fatty acid synthetase is not increased compared to the intrinsic activity. is characterized by

The increased activity of cyclopropane fatty acid synthase may be due to an increase in the expression level of a gene encoding the enzyme. For example, the expression level of a gene may be increased by increasing the copy number of the gene encoding the enzyme, replacing the native promoter with a stronger promoter, or regulating the amount of RNA transcription through 5'-UTR sequence modification. However, the present invention is not limited thereto, and any means capable of increasing the activity of cyclopropane fatty acid synthase, such as amplification of an endogenous gene, or increase in enzyme activity by mutation, for example, deletion of some bases , substitution, insertion, or inversion, such as point mutation, frame shift mutation, missense mutation, nonsense mutation, treatment with a mutagen, and the like.

In a preferred embodiment, the increased activity of the cyclopropane fatty acid synthase may be achieved by introducing one or more copies of the gene encoding the enzyme into the strain from a foreign source. For example, the introduction of the gene may be through a vector, and the introduced gene may exist outside the E. coli chromosome or may be inserted into the chromosome. Insertion of a gene into a chromosome can be accomplished by any method known in the art, for example, by homologous recombination.

In one example of the present application, the cfa gene used for introduction into the E. coli strain has the amino acid sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2. However, the present application is not limited to the protein or nucleic acid of the specific sequence, and is construed to include an amino acid or nucleotide sequence showing substantial identity to the sequence. The substantial identity is about 60% or more when the amino acid or base sequence of the present invention and any other sequence are aligned so as to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. , 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, about 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, Enzymes that have at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity Refers to an amino acid or nucleotide sequence that exhibits activity.

The strain herein may include a pathway for biosynthesis of 3-HP in order to produce 3-HP. Several pathways are known as a pathway for biosynthesis of 3-HP from a carbon substrate such as glycerol, but representative examples are as follows: First, glycerol is dehydrated by glycerol dehydratase to dehydrate the intermediate 3-hydroxypropion It is converted to aldehyde (3-Hydroxypropionaldehyde: 3-HPA), and 3-hydroxypropionaldehyde (3-HPA) is oxidized by aldehyde dehydrogenase (ALDH) to 3-HP. Therefore, in order to increase 3-HP production, the strain of the present application contains genes of enzymes involved in the biosynthesis pathway of 3-HP, for example, a gene encoding glycerol dehydratase and/or aldehyde dehydrogenase. A gene encoding an agent may be further introduced. In addition, the strain of the present application may further introduce a gene encoding glycerol dehydratase reactivase for reactivating glycerol dehydratase in order to further increase 3-HP production.

Accordingly, in a preferred embodiment, the strain of the present application is a gene encoding glycerol dehydratase, a gene encoding aldehyde dehydrogenase, and glycerol dehydratase reactivase (glycerol). dehydratase reactivase) may further include one or more selected from the group consisting of genes encoding.

The term "glycerol dehydratase" refers to a polypeptide having an enzymatic activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA). Glycerol dehydratase may be coenzyme B12 dependent or independent. The enzyme is, but is not limited to, Klebsiella pneumoniae, Citrobacter freundii, Clostridium pasteurianum, Salmonella typhimurium ), Klebsiella oxytoca, or Clostridium butyricum, etc. may be derived. The enzyme, regardless of its origin, is included in the scope of the present application as long as it has an enzyme activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA), and a gene encoding it is exemplified by dhaB can do.

The term "aldehyde dehydrogenase" is an enzyme that converts an aldehyde to a carboxylic acid, herein 3-hydroxypropionaldehyde (3-HPA) to 3-hydroxypropionic acid (3-HP) refers to a polypeptide having an enzymatic activity that catalyzes the conversion of Aldehyde dehydrogenase, regardless of its origin, is within the scope of the present application as long as it has an enzyme activity that catalyzes the conversion of 3-hydroxypropionaldehyde (3-HPA) to 3-hydroxypropionic acid (3-HP). included, and the gene encoding it may be exemplified by aldH, puuC, and the like.

As used herein, the term "glycerol dehydratase reactivase" refers to an enzyme that maintains catalytic activity by reactivating an irreversibly inactivated glycerol dehydratase during its action. As the glycerol dehydratase reactivase, any generally known may be used, for example, Klebsiella sp., Citrobacter sp., Lactobacillus sp. ), Salmonella genus (Salmonella sp.), but may be derived from a strain, but is not limited thereto. Glycerol dehydratase reactivase may be DhaFG, GdrAB, DdrAB, or the like, and the gene encoding it may be exemplified by dhaFG, gdrAB, ddrAB, or the like.

Introduction into a strain means that a target gene is introduced into a host cell so that the nucleic acid becomes replicable as an extrachromosomal factor or by chromosomal integrity completion. Herein, the genes may be cloned into a vector and introduced into a cell. Herein, the vector refers to a genetic construct including essential regulatory elements operably linked so that a gene insert encoding a target protein is expressed in cells of an individual, and various forms such as plasmids, viral vectors, bacteriophage vectors, and cozmid vectors You can use a vector of

The vector is, but is not limited to, a vector in which the gene transferred and inserted into the vector is irreversibly fused into the genome of the host cell so that the gene expression in the cell is stably maintained for a long period of time is preferred. Such vectors contain transcriptional and translational expression control sequences that allow the gene of interest to be expressed in the host of choice. Expression control sequences may include a promoter for effecting transcription, an optional operator sequence for regulating such transcription, and/or sequences regulating the termination of transcription and translation. The start codon and stop codon are generally considered part of the nucleic acid sequence encoding the protein of interest, and must be functional in the subject when the genetic construct is administered and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible. Also, in the case of an expression vector capable of replication, the origin of replication may be included. In addition, an enhancer, an untranslated region at the 3' end of the gene of interest, a selection marker (eg, an antibiotic resistance marker), or a replication-competent unit may be included as appropriate. Vectors may be self-replicating or integrated into host genomic DNA.

Each element in the vector must be operably linked to each other, and ligation of these element sequences can be performed by ligation (ligation) at convenient restriction enzyme sites, and when such sites do not exist, conventional methods are used. It may be performed using a synthetic oligonucleotide adapter or linker according to the present invention.

Examples of useful expression control sequences include the early and late promoters of adenovirus, simian virus 40 (SV40), the mouse mammary tumor virus (MMTV) promoter, the long terminal repeat (LTR) promoter of HIV, Moloney virus, cytomegalo. Viral (CMV) promoter, Epstein virus (EBV) promoter, Loose Sacoma virus (RSV) promoter, RNA polymerase ± promoter, T3 and T7 promoters, major operator and promoter regions of phage lambda, and regulates the expression of genes other sequences of construction and derivation known to do so, and various combinations thereof.

E. coli strains may be exemplified by, for example, E.coli DH5a, E.coli JM101 , E.coli K12, E.coli W3110, E.coli X1776, E.coli B or E.coli XL1-Blue. not limited Once introduced into a strain, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself.

Introduction of the gene into the strain can be accomplished by suitable standard techniques, as is known in the art, for example, electroporation, electroinjection, microinjection, calcium phosphate co-precipitation. co-precipitation), calcium chloride/rubidium chloride method, retroviral infection, DEAE-dextran, cationic liposome method, polyethylene glycol-mediated uptake, A gene gun or the like may be used, but is not limited thereto. At this time, the circular vector can be digested with an appropriate restriction enzyme and introduced in the form of a linear vector.

According to another aspect of the present invention, there is provided a method for producing 3-hydroxypropionic acid (3-HP), comprising the step of culturing the strain in a medium containing glucose or glycerol.

The medium used for culturing the strain should suitably satisfy the requirements of the specific strain. The medium may include various carbon sources, nitrogen sources, phosphorus and trace elements. Specific types of the medium may use a medium such as LB (Luria Bertani) broth, SD (Sabouraud Dextrose) broth or YM (Yeast medium) broth, but is not limited thereto.

The carbon source in the medium may include glucose or glycerol. In addition, monosaccharides, oligosaccharides, polysaccharides, single carbon substrates, or mixtures thereof may be exemplified. monosaccharides, for example fructose; oligosaccharides such as sucrose, maltose or lactose; polysaccharides such as starch or cellulose; Monocarbon substrates such as methanol, formaldehyde or formate can be exemplified. Moreover, lower alcohols, such as ethanol, a propanol, and a butanol; polyhydric alcohols such as glycerol; organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid, and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, and dodecanoic acid may be exemplified, but the present invention is not limited thereto. These substances may be used individually or as a mixture.

Nitrogen sources in the medium include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, However, the present invention is not limited thereto. The nitrogen sources can also be used individually or as a mixture.

As the phosphorus in the medium, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt may be exemplified, but not limited thereto. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth, or may contain essential growth materials such as amino acids and vitamins, but is not limited thereto. The above-mentioned raw materials may be added batchwise or continuously by a method suitable for the culture during the culturing process.

In addition, if necessary, a basic compound such as sodium hydroxide, potassium hydroxide, ammonia, or an acid compound such as phosphoric acid or sulfuric acid may be used in an appropriate manner to adjust the pH of the culture. In addition, an antifoaming agent such as a fatty acid polyglycol ester may be used to inhibit the formation of bubbles.

Cultivation (fermentation) may be performed in a batch, fed-batch, or continuous mode depending on the recombinant strain. Fermentation conditions can be cultured in aerobic, micro-aerobic, or anaerobic conditions, and preferably, it can be performed in a batch manner under micro-anaerobic conditions. The incubation temperature and incubation time may be appropriately selected in consideration of the characteristics of the host cell to be used. For example, oxygen or oxygen-containing gas (eg air) may be injected into the culture to maintain aerobic conditions, and the temperature of the culture is usually 20°C to 45°C, preferably 25°C to 40°C. can Cultivation can be continued until the desired production of glycerol or 3-HP is maximally obtained.

Culture pH is less than pH 7.0, for example, pH4.0 to less than pH 7.0, pH4.0 to pH6.0, pH4.0 to pH5.0, pH4.4 to pH6.0, pH4.4 to pH5.0, etc. can be exemplified, but is not limited thereto.

Methods for recovering 3-HP from fermentation medium are known in the art. For example, 3-HP can be obtained from a cell medium by performing centrifugation, chromatography, extraction, filtration, precipitation, or a combination thereof.

Ultimately, the production of 3-hydroxypropionic acid (3-HP) can be increased by using the strain of the present application.

1 is a graph confirming the improvement of the growth ability of the E. coli strain prepared according to an embodiment of the present application.
Figure 2 is a graph confirming the improvement in 3-HP production capacity of the E. coli strain prepared according to an embodiment of the present application.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Confirmation of the effect of increasing 3-HP production according to the introduction of the cfa gene

1-1. Preparation of vectors

To overexpress the cfa gene, a plasmid containing cfa was prepared. The cfa gene (SEQ ID NO: 2) was amplified from the genome of E. coli W3110 strain (KCCM 40219) using a primer pair consisting of the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 4 (2 minutes predenaturation at 95 degrees; 30 repetitions of 1 min denaturation, 30 sec annealing at 55 °C, and 1 min elongation at 72 °C; 2 min final elongation at 72 °C; storage at 4 °C; final product size 1.2 kb):

- cfa-F primer: tactagcgcagcttaatgagttcatcgtgtatagaagaag (SEQ ID NO: 3)

- cfa-R primer: cagcagcctaggttaattagcgagccactcgaaggccg (SEQ ID NO: 4)

The prepared cfa gene was cloned into the pCDF-dhaB1,2,3-gdrA,b-aldH plasmid for 3HP production.

The pCDF-dhaB1,2,3-gdrA,b-aldH plasmid replaced the promoter portion of the pCDFDuet-1 vector with promoters J23101 and J23100, and dhaB (dhaB1, dhaB2, dhaB3) and gdrAB genes (gdrA) from Krebsiella pneumoniae (gdrA). , gdrB) and E. coli K12 MG1655-derived aldH gene cloned vector. Specifically, dhaB (about 2.7 kb; dhaB1, dhaB2, dhaB3) and gdrAB genes (about 2.2 kb; gdrA, gdrB) were synthesized from the chromosome of Krebsiella pneumoniae in NEB using the following primers and NEB Q5 DNA polymerase. Amplification was performed using the conditions provided:

-dhaB-gdrA-F primer: GAATTCATGAAAAGATCAAAACGATTGCAGTCCT (SEQ ID NO: 5)

-dhaB-gdrA-R primer: AAGCTTGATCTCCCACTGACCAAAGCTGG (SEQ ID NO: 6)

- gdrB-F primer: AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG (SEQ ID NO: 7)

- gdrB-R primer: CTTAAGTCAGTTTCTCTCACTTAACGGC (SEQ ID NO: 8)

Since the dhaB123 and gdrA genes were located side by side on the chromosome of Krebsiella pneumoniae, they were amplified together. Since gdrB was located in the opposite direction to dhaB123 and gdrA, only gdrB was amplified separately. At this time, NEB Q5 DNA polymerase was used. , the conditions provided by NEB were used. Thereafter, the dhaB123 and gdrA genes were cloned under the J23101 promoter using restriction enzymes EcoRI and HindIII, and the gdrB gene using restriction enzymes HindIII and AflII. aldH was amplified from the E. coli K12 MG1655 chromosome using the following promoter, and the following primers and NEB Q5 DNA polymerase were used, and the conditions provided by NEB were used.

- aldH-F primer: ggtaccatgaattttc atcatctggc (SEQ ID NO: 9)

- aldH-R primer: catatgtcaggcctccaggcttat (SEQ ID NO: 10)

aldH was cloned under the J23100 promoter using restriction enzymes KpnI and NdeI.

Cloning the prepared cfa gene into the thus-prepared pCDF-dhaB1,2,3-gdrA,b-aldH plasmid by In-Fusion reaction using PacI restriction enzyme, finally the recombinant vector pCDF-dhaB1,2, 3-gdrA,b-aldH-cfa was prepared.

1-2. Preparation and culture of transformant strains

Escherichia coli W3110 Δ (glpK, yqhD, ackA-pta, ldhA and gldA gene deletion strains; Gene bridges' Quick&easy e. coli gene deletion kit was used) as the strain. The strain was plated on an LB plate (including 10 g tryptone, 5 g yeast extract, 10 g NaCl, 15 g agar per liter) and cultured overnight at 37°C. The cultured single colonies were inoculated in 3-5 mL LB liquid medium (the medium composition was the same as above, but not including agar) and incubated overnight at 37°C with stirring. The next morning, the culture medium was diluted 1:100 in 5 mL of LB broth and incubated for 3-6 hours until OD of ~0.5. After cooling on ice for 10-15 minutes, the cells were collected by centrifugation at 4° C. at 4000 rpm for 10 minutes. The cells were resuspended in 1 mL of ice-cold sterile DI water, washed, and again centrifuged at 4° C. at 4000 rpm for 10 minutes to collect the cells. The collected cells were again resuspended in 1 mL of DI water, washed, and again centrifuged at 4° C. at 4000 rpm for 10 minutes to collect the cells. The collected cells were resuspended in 0.3 mL of DI water, and aliquots were placed in individual pre-chilled microfuge tubes (90 ul per transformation in a 0.1 cm gap electroporation cuvette). After pipetting the prepared plasmid DNA (1-5 uL) was added, the mixture was transferred to a pre-chilled electroporation cuvette. After electroporation at 1.8 kV, 1 mL of LB broth at room temperature was added to the cells immediately after the pulse, and incubated at 37° C. for 1 hour. Cultures were spread on LB plates with streptomycin and excess liquid was allowed to dry/absorb into plates. The plate was inverted and incubated at 37°C. As a control, a strain containing the pCDF-dhaB1,2,3-gdrA,b-aldH vector into which cfa was not introduced was used.

Example 2. Growth rate analysis of strains

For the growth rate analysis, a single colony was first inoculated into 3 mL of liquid LB medium, and pre-cultured at 37°C and 250 rpm for 20 hours (seed culture). After that After inoculating at a concentration of 1% in 5 mL of M9 minimal medium adjusted to pH 4.4, pH 4.7, and pH 5.0 with hydrochloric acid, respectively, and culturing for 24 hours, the OD was measured, 3 times (pH4.4), 1.7 times compared to the control. (pH4.7) and 1.3 times (pH 5.0) showed improved growth rates (see FIG. 1 ).

M9 medium is prepared by separately sterilizing 10X M9 salts (pH 7.4) and 1 M MgSO4, 1 M CaCl2 solution composed of 60 g of Na2HPO4, 30 g of KH2PO4, 5 g of NaCl, and 10 g of NH4Cl per 1 L. Per 1 L of medium, 100 mL of 10X M9 salts, 2 mL of 1 M MgSO4, and 0.1 mL of 1 M CaCl2 were prepared.

Example 3. 3-HP Production Analysis

In a 250 mL Erlenmeyer flask, 100 mL of modified M9 medium containing 20 g/L of glycerol and 25 mg/L streptomycin (MgSO ₄ ㆍ7H ₂ O 0.6 g/L, NaCl 1.5 g/L, Na ₂ HPO ₄ ㆍ7H ₂ O 12.8 g/L, K ₂ HPO ₄ 17.4 g/L, NH ₄ Cl 2 g/L, yeast extract 0.5 g/L, KH ₂ PO ₄ 3 g/L and CaCl ₂ 0.11 g/L) was prepared. At this time, the pH was maintained at 6.0 using Ca(OH) ₂ . 1 mL of the prepared control and experimental group seed culture was inoculated in a flask, and cultured at 33° C., 250 rpm in a shaker incubator.

Using HPLC, 3-HP concentration was confirmed under the following analysis conditions. After centrifugation (4000 rpm, 1 minute) of 1 mL of the culture solution, the supernatant was prepared using a filter having a size of 0.45 μm. For HPLC, 0.5 mM sulfuric acid (H ₂ SO ₄ ) was flowed at a flow rate of 0.4 mL/min using an Aminex HPX-87H ion exclusion column (7.8 * 300 mm, 9 μm), and the temperature of the column was 50 ° C. fit

As a result, the final 3-HP concentration produced by the experimental strain was 4.6 g/L, whereas the final 3-HP concentration produced by the control strain was 3.8 g/L. This is a result of about 21% improvement in 3-HP production compared to the control strain, indicating the effect of cfa on 3-HP production (see Table 1 and FIG. 2).

3-HP (g/L) Control strain (-cfa) 3.8 cfa transformed strain (+cfa) 4.6

From the above description, those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be implemented in other specific forms without changing the technical spirit or essential characteristics thereof. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the following claims and their equivalents.

<110> LG CHEM, LTD. <120> E. coli strain with increased 3-hydroxypropionic acid production and method for producing 3-hydroxypropionic acid using the sames <130> DPP20203552KR <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 382 <212> PRT <213> Escherichia coli <400> 1 Met Ser Ser Ser Cys Ile Glu Glu Val Ser Val Pro Asp Asp Asn Trp 1 5 10 15 Tyr Arg Ile Ala Asn Glu Leu Leu Ser Arg Ala Gly Ile Ala Ile Asn 20 25 30 Gly Ser Ala Pro Ala Asp Ile Arg Val Lys Asn Pro Asp Phe Phe Lys 35 40 45 Arg Val Leu Gln Glu Gly Ser Leu Gly Leu Gly Glu Ser Tyr Met Asp 50 55 60 Gly Trp Trp Glu Cys Asp Arg Leu Asp Met Phe Phe Ser Lys Val Leu 65 70 75 80 Arg Ala Gly Leu Glu Asn Gln Leu Pro His His Phe Lys Asp Thr Leu 85 90 95 Arg Ile Ala Gly Ala Arg Leu Phe Asn Leu Gln Ser Lys Lys Arg Ala 100 105 110 Trp Ile Val Gly Lys Glu His Tyr Asp Leu Gly Asn Asp Leu Phe Ser 115 120 125 Arg Met Leu Asp Pro Phe Met Gln Tyr Ser Cys Ala Tyr Trp Lys Asp 130 135 140 Ala Asp Asn Leu Glu Ser Ala Gln Gln Ala Lys Leu Lys Met Ile Cys 145 150 155 160 Glu Lys Leu Gln Leu Lys Pro Gly Met Arg Val Leu Asp Ile Gly Cys 165 170 175 Gly Trp Gly Gly Leu Ala His Tyr Met Ala Ser Asn Tyr Asp Val Ser 180 185 190 Val Val Gly Val Thr Ile Ser Ala Glu Gln Gln Lys Met Ala Gln Glu 195 200 205 Arg Cys Glu Gly Leu Asp Val Thr Ile Leu Leu Gln Asp Tyr Arg Asp 210 215 220 Leu Asn Asp Gln Phe Asp Arg Ile Val Ser Val Gly Met Phe Glu His 225 230 235 240 Val Gly Pro Lys Asn Tyr Asp Thr Tyr Phe Ala Val Val Asp Arg Asn 245 250 255 Leu Lys Pro Glu Gly Ile Phe Leu Leu His Thr Ile Gly Ser Lys Lys 260 265 270 Thr Asp Leu Asn Val Asp Pro Trp Ile Asn Lys Tyr Ile Phe Pro Asn 275 280 285 Gly Cys Leu Pro Ser Val Arg Gln Ile Ala Gln Ser Ser Glu Pro His 290 295 300 Phe Val Met Glu Asp Trp His Asn Phe Gly Ala Asp Tyr Asp Thr Thr 305 310 315 320 Leu Met Ala Trp Tyr Glu Arg Phe Leu Ala Ala Trp Pro Glu Ile Ala 325 330 335 Asp Asn Tyr Ser Glu Arg Phe Lys Arg Met Phe Thr Tyr Tyr Leu Asn 340 345 350 Ala Cys Ala Gly Ala Phe Arg Ala Arg Asp Ile Gln Leu Trp Gln Val 355 360 365 Val Phe Ser Arg Gly Val Glu Asn Gly Leu Arg Val Ala Arg 370 375 380 <210> 2 <211> 1149 <212> DNA <213> Escherichia coli <400> 2 atgagttcat cgtgtataga agaagtcagt gtaccggatg acaactggta ccgtatcgcc 60 aacgaattac ttagccgtgc cggtatagcc attaacggtt ctgccccggc ggatattcgt 120 gtgaaaaacc ccgatttttt taaacgcgtt ctgcaagaag gctctttggg gttaggcgaa 180 agttatatgg atggctggtg ggaatgtgac cgactggata tgttttttag caaagtctta 240 cgcgcaggtc tcgagaacca actcccccat catttcaaag acacgctgcg tattgccggc 300 gctcgtctct tcaatctgca gagtaaaaaa cgtgcctgga tagtcggcaa agagcattac 360 gatttgggta atgacttgtt cagccgcatg cttgatccct tcatgcaata ttcctgcgct 420 tactggaaag atgccgataa tctggaatct gcccagcagg cgaagctcaa aatgatttgt 480 gaaaaattgc agttaaaacc agggatgcgc gtactggata ttggctgcgg ctggggcgga 540 ctggcacact acatggcatc taattatgac gtaagcgtgg tgggcgtcac catttctgcc 600 gaacagcaaa aaatggctca ggaacgctgt gaaggcctgg atgtcaccat tttgctgcaa 660 gattatcgtg acctgaacga ccagtttgat cgtattgttt ctgtggggat gttcgagcac 720 gtcggaccga aaaattacga tacctatttt gcggtggtgg atcgtaattt gaaaccggaa 780 ggcatattcc tgctccatac tatcggttcg aaaaaaaccg atctgaatgt tgatccctgg 840 attaataaat atatttttcc gaacggttgc ctgccctctg tacgccagat tgctcagtcc 900 agcgaacccc actttgtgat ggaagactgg cataacttcg gtgctgatta cgatactacg 960 ttgatggcgt ggtatgaacg attcctcgcc gcatggccag aaattgcgga taactatagt 1020 gaacgcttta aacgaatgtt tacctattat ctgaatgcct gtgcaggtgc tttccgcgcc 1080 cgtgatattc agctctggca ggtcgtgttc tcacgcggtg ttgaaaacgg ccttcgagtg 1140 gctcgctaa 1149 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> cfa-F primer <400> 3 tactagcgca gcttaatgag ttcatcgtgt atagaagaag 40 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> cfa-R primer <400> 4 cagcagccta ggttaattag cgagccactc gaaggccg 38 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> dhaB-gdrA-F primer <400> 5 gaattcatga aaagatcaaa acgatttgca gtcct 35 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> dhaB-gdrA-R primer <400> 6 aagcttgatc tcccactgac caaagctgg 29 <210> 7 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> gdrB-F primer <400> 7 aagcttagag ggggccgtca tgtcgctttc accgccag 38 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> gdrB-R primer <400> 8 cttaagtcag tttctctcac ttaacggc 28 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> aldH-F primer <400> 9 ggtaccatga attttcatca tctggc 26 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> aldH-R primer <400> 10 catatgtcag gcctccaggc ttat 24

Claims (6)

E. coli strain with improved ability to produce 3-hydroxypropionic acid (3-HP) in which the activity of cyclopropane fatty acid synthetase is increased than intrinsic activity. According to claim 1,
The strain is an E. coli strain whose activity is increased by an increase in the expression level of the cfa gene encoding a cyclopropane fatty acid synthase. 3. The method of claim 2,
The increase in the expression level of the gene is made by introducing one or more copies of the cfa gene in addition to the endogenous gene of the Escherichia coli strain, Escherichia coli strain. 4. The method of claim 3,
The introduced gene is inserted into the E. coli chromosome, E. coli strain. According to claim 1,
From the group consisting of a gene encoding glycerol dehydratase, a gene encoding aldehyde dehydrogenase, and a gene encoding glycerol dehydratase reactivase E. coli strain comprising one or more selected. Claims 1 to 5 comprising the step of culturing any one of the strains,
A process for the production of 3-hydroxypropionic acid (3-HP).

Images