KR20210036632A - Microorganism with increased 3-hydroxypropionic acid production and method for producing 3-hydroxypropionic acid using the same - Google Patents

Abstract

The present invention relates to microorganism having improved production of 3-hydroxypropionic acid (3-HP) and to a production method of 3-hydroxypropionic acid using the same.

Description

Microorganism with increased 3-hydroxypropionic acid production and method for producing 3-hydroxypropionic acid using the same}

It relates to a microorganism having improved production of 3-hydroxypropionic acid (3-HP) and a method for producing 3-HP using the same.

3-Hydroxypropionic acid (3-HP) is an isomer of lactic acid (2-hydroxypropionic acid) and is used as a crosslinking agent for polymer coatings, metal lubricants, and anti-static agents for fibers. Acrylic acid, 1,3-propanediol, methyl acrylate , Ethyl 3-hydroxypropionic acid, malonic acid, propionactone, acrylonitrile, or acrylamide.

3-HP can be produced through a chemical process using ethylene cyanohydrin, beta-idopropionic acid, beta-bromopropionic acid, beta-chloropropionic acid, beta-propiolactone, acrylic acid, etc. as intermediates. It can also be produced through biological processes. However, most of these chemicals are toxic and carcinogenic, consume a large amount of energy under conditions of high temperature and pressure, and discharge a large amount of pollutants.

3-HP can also be produced through microbial fermentation. Until now, a 3-HP production process using E. coli or Krebsiella pneumoniae has been studied, but the commercial level has not yet been reached in terms of productivity, yield, and economical efficiency of the medium.

Therefore, there is a need to develop a technology for increasing the production of 3-HP from microorganisms.

Domestic patent registration 10-1048485 (2011.07.05)

One example provides a microorganism that produces 3-hydroxypropionic acid (3-HP), comprising a gene encoding NADH oxidase and a gene encoding a glycerol uptake facilitator.

Other examples include (i) a gene encoding NADH oxidase and a gene encoding a glycerol uptake facilitator, and (ii) a gene encoding glycerol dehydratase. , 3-hydroxyl comprising at least one gene selected from the group consisting of a gene encoding an aldehyde dehydrogenase, and a gene encoding a glycerol dehydratase reactivase Microorganisms that produce propionic acid (3-HP) are provided.

Other examples include (i) a gene encoding NADH oxidase and a gene encoding a glycerol uptake facilitator, and (ii) a gene encoding glycerol dehydratase. , A gene encoding aldehyde dehydrogenase, and a gene encoding glycerol dehydratase reactivase, and (iii) The gene encoding lactate dehydrogenase, the gene encoding acetate kinase A, the gene encoding phosphotransacetylase, and alcohol dehydrogenase 3-hydroxypropionic acid in which at least one selected from the group consisting of a gene encoding a gene, a gene encoding a glycerol kinase, and a gene encoding a glycerol dehydrogenase is deleted or inactivated Microorganisms that produce (3-HP) are provided.

Another example provides a method for producing 3-hydroxypropionic acid (3-HP), comprising culturing the microorganism in a medium containing glucose or glycerol.

According to one aspect of the present invention, a microorganism producing 3-hydroxypropionic acid (3-HP) comprising a gene encoding NADH oxidase and a gene encoding a glycerol uptake facilitator Is provided.

The term "NADH oxidase" refers to a polypeptide having an enzyme activity of oxidizing NADH to NAD+ while reducing _{oxygen to hydrogen peroxide (H 2} O _{2 ).} The 3-HP oxidation reaction requires NAD+, a coenzyme, so NADH accumulates in the cells as the reaction occurs.In this application, the NAD+ pool is regenerated by introducing the NADH oxidase-encoding gene into the microorganism, thereby depleting NAD+ and accumulating NADH. And balance the coenzyme, eventually increasing 3-HP production. Regardless of its origin, the enzyme is included in the scope of the present application as long as it has NADH oxidase activity, and noxE may be exemplified as a gene encoding it. In one embodiment of the present application, the noxE gene derived from Lactococcus lactis was used, and the sequence information can be found in GenBank registration number NC_002662.1. However, this only corresponds to the exemplary embodiment of the present application, but the present invention is not limited thereto.

The term "glycerol uptake facilitator" is a transporter of glycerol that crosses the cytoplasmic membrane, and refers to a protein with limited permeability to water and small uncharged molecules such as polyols. Herein, a gene encoding a glycerol influx promoter may be introduced to increase the influx of glycerol into cells. The protein, regardless of its origin, is included in the scope of the present application as long as it has a glycerol influx promoter activity, and glpF may be exemplified as a gene encoding it. In one embodiment of the present application, the glpF gene derived from E. coli was used, and the sequence information can be found in GenBank registration number NC_000913.3. However, this only corresponds to the exemplary embodiment of the present application, but the present invention is not limited thereto.

In order to produce 3-HP, the microorganism of the present application may include a pathway for biosynthesizing 3-HP. Several pathways are known as pathways for biosynthesizing 3-HP from a carbon substrate such as glycerol, but representative examples are as follows: First, 3-hydroxypropion, an intermediate in which glycerol is dehydrated by glycerol dehydratase. It is converted to aldehyde (3-Hydroxypropionaldehyde: 3-HPA), and 3-hydroxypropionaldehyde (3-HPA) is oxidized to 3-HP by aldehyde dehydrogenase (ALDH). Therefore, in order to increase the production of 3-HP, the microorganisms of the present disclosure include genes of enzymes involved in the pathway for biosynthesizing 3-HP, for example, genes encoding glycerol dehydratase and/or aldehyde dehydrogena. A gene encoding the agent may be further introduced. In addition, the microorganism of the present application may further include a gene encoding a glycerol dehydratase reactibase for reactivating glycerol dehydratase in order to further increase 3-HP production.

Thus, in a preferred embodiment, the microorganism of the present application is a gene encoding glycerol dehydratase, a gene encoding aldehyde dehydrogenase, and a glycerol dehydratase reactibase (glycerol dehydratase). dehydratase reactivase) may further include one or more selected from the group consisting of genes encoding.

The term “glycerol dehydratase” refers to a polypeptide having enzymatic activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA). Glycerol dehydratase may be coenzyme B12 dependent or independent. The enzymes are, but are not limited to, Klebsiella pneumoniae, Citrobacter freundii, Clostridium pasteurianum, Salmonella typhimurium ), Klebsiella oxytoca, or Clostridium butyricum. The enzyme, regardless of its origin, is included in the scope of the present application as long as it has an enzymatic activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA), and dhaB is exemplified as a gene encoding it. can do. In one embodiment of the present application, the dhaB gene derived from Krebsiella pneumoniae was used, and the sequence information can be confirmed in GenBank registration number U30903.1 (consisting of subunits of dhaB1, dhaB2 and dhaB3). However, this only corresponds to the exemplary embodiment of the present application, but the present invention is not limited thereto.

The term "aldehyde dehydrogenase" is an enzyme that converts aldehydes to carboxylic acids, and herein, from 3-hydroxypropionaldehyde (3-HPA) to 3-hydroxypropionic acid (3-HP). It refers to a polypeptide having an enzymatic activity that catalyzes the conversion of. Aldehyde dehydrogenase, regardless of its origin, falls within the scope of the present application if it is an enzyme that has an enzymatic activity that catalyzes the conversion of 3-hydroxypropionaldehyde (3-HPA) to 3-hydroxypropionic acid (3-HP). Included, and genes encoding them may be exemplified by aldH, puuC, and the like. In one embodiment of the present application, the aldH gene derived from E. coli was used, and the sequence information can be found in GenBank registration number NC_000913.3. However, this only corresponds to the exemplary embodiment of the present application, but the present invention is not limited thereto.

The term "glycerol dehydratase reactivase" is an enzyme that functions to maintain catalytic activity by reactivating irreversibly inactivation of glycerol dehydratase during the action. Any commonly known glycerol dehydratase reactive agent may be used, for example, Klebsiella sp., Citrobacter sp., Lactobacillus sp. ), Salmonella sp. may be derived from strains, etc., but is not limited thereto. Glycerol dehydratase reactibase may be DhaFG, GdrAB, DdrAB, and the like, and genes encoding this may be exemplified by dhaFG, gdrAB, ddrAB, and the like. In one embodiment of the present application, the gdrAB gene derived from Krebsiella pneumoniae was used, and the sequence information can be confirmed in GenBank registration number U30903.1 (consisting of subunits of gdrA (dhaB4) and gdrB (orf 2b)) have. However, this only corresponds to the exemplary embodiment of the present application, but the present invention is not limited thereto.

Herein, the genes may be cloned into a vector and introduced into a cell. Here, the vector refers to a gene construct containing essential regulatory elements operably linked to express a gene insert encoding a protein of interest in the cells of an individual, and various forms such as plasmids, viral vectors, bacteriophage vectors, cozmid vectors, etc. Vectors of can be used.

A vector is preferred in which the gene inserted into the vector and transferred is irreversibly fused into the genome of the host cell so that the gene expression in the cell is stably maintained for a long period of time. Such vectors contain transcriptional and translational expression control sequences that allow the gene of interest to be expressed in a selected host. The expression control sequence may include a promoter for carrying out transcription, any operator sequence for regulating such transcription, and/or a sequence that controls termination of transcription and translation. The start and stop codons are generally considered to be part of the nucleic acid sequence encoding the protein of interest, and should exhibit an action in the subject when the genetic construct is administered and must be in frame with the coding sequence. The promoter of the vector can be constitutive or inducible. In addition, in the case of a replicable expression vector, the origin of replication may be included. In addition, an enhancer, an untranslated region at the 3'end of the gene of interest, a selection marker (eg, an antibiotic resistance marker), or a replicable unit may be appropriately included. Vectors can either self-replicate or integrate into the host genomic DNA.

Each element in the vector must be operably linked to each other, and the ligation of these element sequences can be performed by ligation (linkage) at a convenient restriction enzyme site, and if such a site does not exist, it can be carried out in a conventional manner. It may be performed using a synthetic oligonucleotide adapter or a linker according to the following.

Examples of useful expression control sequences include early and late promoters of adenovirus, monkey virus 40 (SV40), mouse mammary tumor virus (MMTV) promoter, long terminal repeat (LTR) promoter of HIV, Moloney virus, cytomegalo Viral (CMV) promoter, Epstein virus (EBV) promoter, Loews Sacoma virus (RSV) promoter, RNA polymerase ± promoter, T3 and T7 promoters, major operator and promoter regions of phage lambda, and prokaryotic or eukaryotic cells Or other sequences of constructs and inductions known to regulate the expression of their viral genes, and various combinations thereof.

Introduction into a strain means that the target gene is introduced into a host cell so that the nucleic acid becomes capable of replication as an extrachromosomal factor or by completion of chromosomal integration. For example, a vector containing a gene related to organic acid synthesis can be introduced into a host organism. As another example, an integrating vector including a gene related to organic acid synthesis may be introduced into the strain, thereby being inserted into the genome of the strain. The tissue-specificity of the insertion can be modulated, for example by the route of vector administration. As another example, a non-integrating vector containing a gene related to organic acid synthesis may be introduced into the host organism by introducing it into the host organism.

This strain may be a prokaryotic strain, such as E. coli (e.g., E.coli DH5a, E.coli JM101, E.coli K12, E.coli W3110, E.coli X1776, E.coli B, and E. coli XL1-Blue). However, it is not limited thereto, and genus Pseudomonas, Bacillus, Streptomyces, Erwinia, Serratia, Providencia, Corynebacterium, Leptospira, Salmonella, Brevibacteria, Hypomonas It can be applied to various strains such as genus, Chromobacterium genus, and Nocadia genus. Once introduced into the appropriate strain, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself.

Introducing the gene into the strain is a standard technique suitable as known in the art, for example, electroporation, electroinjection, microinjection, calcium phosphate co-precipitation. co-precipitation), calcium chloride/rubidium chloride method, retroviral infection, DEAE-dextran, cationic liposome method, polyethylene glycol-mediated uptake, A gene gun or the like may be used, but is not limited thereto. At this time, the circular vector can be cut with an appropriate restriction enzyme and introduced in the form of a linear vector.

In another preferred embodiment, the microorganism uses lactate dehydrogenase to inhibit the production of lactic acid and acetic acid, which are organic acids mainly produced during culture, or to use glycerol only for the production of 3-HP. Coding gene, acetate kinase A (acetate kinase A) coding gene, phosphotransacetylase (phosphotransacetylase) coding gene, alcohol dehydrogenase (alcohol dehydrogenase) coding gene, glycerol kinase (glycerol kinase) One or more selected from the group consisting of a gene encoding a gene and a gene encoding a glycerol dehydrogenase may be deleted or inactivated.

Deletion or inactivation of a gene can be performed according to techniques conventional in the art. For example, deletion or inactivation of a gene is performed by deleting (removing) all or part of the gene site on the microbial genome, or by using techniques such as homologous recombination, site-specific recombination, or transposon-mediated gene introduction. This can be done by modifying the protein sequence by inserting a specific gene sequence. In addition, inactivation of the gene is performed by reducing the expression of the protein by modifying the nucleotide sequence of the promoter region and the 5'-UTR region of the gene, or by introducing a mutation into the ORF region of the gene to weaken the activity of the protein. Can be.

According to another aspect of the present invention, there is provided a method for producing 3-hydroxypropionic acid (3-HP), comprising culturing the microorganism in a medium containing glucose or glycerol.

The medium used for cultivation of the strain must adequately satisfy the requirements of the specific strain. The medium may contain various carbon sources, nitrogen sources, personnel, and trace element components. As a specific type of medium, a medium such as LB (Luria Bertani) broth, SD (Sabouraud Dextrose) broth, or YM (Yeast medium) broth may be used, but is not limited thereto.

The carbon source in the medium may include glucose or glycerol. In addition, monosaccharides, oligosaccharides, polysaccharides, mono-carbon substrates, or mixtures thereof can be exemplified. Monosaccharides such as fructose, for example; Oligosaccharides such as sucrose, maltose or lactose; Polysaccharides such as starch or cellulose; A single carbon substrate such as methanol, formaldehyde or formate can be exemplified. Further, lower alcohols such as ethanol, propanol, and butanol; Polyhydric alcohols such as glycerol; Organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid, and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, and dodecanoic acid may be exemplified, but are not limited thereto. These materials can be used individually or as a mixture.

Examples of nitrogen sources in the medium include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, It is not limited thereto. The nitrogen source can also be used individually or as a mixture.

As the number of persons in the medium, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt may be exemplified, but is not limited thereto. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth, or may contain essential growth materials such as amino acids and vitamins, but is not limited thereto. The above-described raw materials may be added batchwise or continuously to the culture during the cultivation process by a suitable method.

Further, if necessary, a basic compound such as sodium hydroxide, potassium hydroxide, ammonia or an acid compound such as phosphoric acid or sulfuric acid may be used in an appropriate manner to adjust the pH of the culture. In addition, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester.

Cultivation (fermentation) can be carried out in batch, fed-batch, or continuous mode depending on the recombinant microorganism. Fermentation conditions may be cultured under aerobic, micro-aerobic, and anaerobic conditions, and preferably, may be performed in batch mode under micro-anaerobic conditions. Incubation temperature and incubation time can be appropriately selected and performed in consideration of the characteristics of the host cell to be used. For example, oxygen or oxygen-containing gas (eg, air) may be injected into the culture to maintain an aerobic state, and the temperature of the culture is usually 20°C to 45°C, preferably 25°C to 40°C. I can. The cultivation can be continued until the maximum yield of glycerol or 3-HP is obtained.

Methods for recovering 3-HP from fermentation medium are known in the art. For example, 3-HP can be obtained from cell media by performing centrifugation, chromatography, extraction, filtration, precipitation, or a combination thereof.

By preventing the imbalance of the coenzyme that occurs during the production of 3-HP and increasing the rate of glycerol metabolism, the production of 3-hydroxypropionic acid (3-HP) can eventually be increased.

Hereinafter, the present invention will be described in more detail by the following examples. However, these are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Confirmation of the effect of increasing 3-HP production by introduction of noxE gene

1-1. Preparation of plasmid

The promoter portion of the pCDFDuet-1 vector was replaced with the J23101 and J23100 promoters, and the dhaB (about 2.7 kb; dhaB1, dhaB2, dhaB3) and gdrAB genes (about 2.2 kb; gdrA, gdrB) were shown below in the Krebsiella pneumoniae chromosome. It was amplified using the conditions provided by NEB using primers of and NEB Q5 DNA polymerase:

-dhaB-gdrA-F primer: GAATTCATGAAAAGATCAAAACGATTTGCAGTCCT (SEQ ID NO: 1)

-dhaB-gdrA-R primer: AAGCTTGATCTCCCACTGACCAAAGCTGG (SEQ ID NO: 2)

-gdrB-F primer: AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG (SEQ ID NO: 3)

-gdrB-R primer: CTTAAGTCAGTTTCTCTCACTTAACGGC (SEQ ID NO: 4)

Since dhaB123 and gdrA genes are located side by side on the chromosome of Krebsiella pneumoniae, they were amplified together.Since gdrB is located in the opposite direction to dhaB123 and gdrA, only gdrB was amplified separately.At this time, NEB Q5 DNA polymerase was used. , The conditions provided by NEB were used. Thereafter, the dhaB123 and gdrA genes were cloned under the J23101 promoter using the restriction enzymes EcoRI and HindIII, and the gdrB gene was cloned using the restriction enzymes HindIII and AflII. aldH was cloned under the J23100 promoter, and amplified from E. coli K12 MG1655 chromosome, and at this time, the following primers and NEB Q5 DNA polymerase were used, and conditions provided by NEB were used.

-aldH-F primer: ggtaccatgaattttc atcatctggc (SEQ ID NO: 5)

-aldH-R primer: catatgtcaggcctccaggcttat (SEQ ID NO: 6)

aldH was cloned under the J23100 promoter using restriction enzymes KpnI and NdeI. Through the above cloning, the pCDFJ23-dhaB-gdrAB-aldH plasmid was produced.

Meanwhile, the pSTV28 vector was purchased from TaKaRa. The noxE gene derived from Lactococcus lactis was cloned into the MCS portion of pSTV28, and was cloned together with UTR with an expression level of 100,000. Amplification was performed using the conditions provided by NEB using the following primers and NEB Q5 polymerase.

-UTR Sequence: taacgattataaaggagcatctggt (SEQ ID NO: 7)

-noxE-F: aaaggagcatctggtatgaaaatcgtagttatc (SEQ ID NO: 8)

-utr10-noxE-F: acccggggatcctaacgattataaaggagcatctg (SEQ ID NO: 9)

-noxE-R: aagcttgcatgcttatttcgcattgagagctgc (SEQ ID NO: 10)

noxE was cloned using restriction enzymes BamHI and SphI. Through the above cloning, the pSTV28-noxE plasmid was produced.

1-2. Preparation and cultivation of transformed strains

Escherichia coli W3110 Δ (glpK, yqhD, ackA-pta, ldhA and gldA gene deletion strain, using Gene Bridges' Quick&easy e.coli gene deletion kit) strain pCDFJ23-dhaB-gdrAB-aldH plasmid and pSTV28-noxE plasmid, or The pCDFJ23-dhaB-gdrAB-aldH plasmid and pSTV28 plasmid were introduced. Specifically, Escherichia coli W3110 Δ (glpK, yqhD, ackA-pta, ldhA, gldA) was plated on an LB plate (including 10g tryptone, 5g yeast extract, 10g NaCl, 15g agar per 1 liter) and incubated overnight at 37°C. . The cultured single colonies were inoculated into 3-5ml LB liquid medium (the medium composition was the same as above, but did not contain agar), and cultured overnight at 37°C with stirring. The next morning, the culture solution was diluted 1:100 in 0.05 liters of LB liquid medium and incubated for 3-6 hours until OD~0.5 was reached. After cooling on ice for 10-15 minutes, the cells were collected by centrifuging for 10 minutes at 4000 rpm at 4°C. The cells were resuspended in 1 volume of ice-cooled sterile DI water, washed, and centrifuged again at 4°C at 4000 rpm for 10 minutes to collect the cells. The collected cells were resuspended in 0.5 volume of DI water, washed, and centrifuged at 4000 rpm at 4° C. for 10 minutes to collect the cells. The collected cells were resuspended in 1 ml of sterile 10% glycerol cooled on ice, and aliquots of cells were placed in individual pre-chilled microfuge tubes (90 ul per transformation in a 0.1 cm gap electroporation cuvette). After the salt-free DNA (1-5 ul) was added by pipetting, the mixture was transferred to a pre-chilled electroporation cuvette. After electroporation at 1.8 kV, 1 ml of room temperature LB liquid medium was added to the cells immediately after the pulse and incubated at 37° C. for 1 hour. The culture medium was spread on an LB plate containing streptomycin and chloramphenicol, and excess liquid was dried/absorbed into the plate. The plate was inverted and incubated at 37°C.

For flask culture, a single colony was inoculated into 3 mL of LB (Luria Bertani; peptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L, pH 7.0) medium, and at 37°C, 250 rpm for 20 hours. It was pre-cultured (seed culture).

Then, 1% was inoculated into 4 mL of LB medium, and cultured overnight with 0.5% glucose, streptomycin, and chloramphenicol. The cultured cells were recovered, inoculated into 4 mL of M9 medium, and cultured for 4 days at 37° C. and 250 rpm with streptomycin, chloramphenicol, 0.5% glucose, 2% glycerol and 1 uM vitamin B12.

M9 medium contains 10X M9 salts (pH 7.4) composed of 60 g of _{Na 2} HPO _{4 , 30 g of KH 2} PO ₄ , 5 g of NaCl, and _{10 g of NH 4 Cl per 1 L and 1 M MgSO 4} , 1 M CaCl ₂ solution. Separately, it was prepared by sterilization, and at the time of the main culture, the composition was composed of 100 mL of 10X M9 salts, 2 mL of _{1 M MgSO 4 , and 0.1 mL of 1 M CaCl 2 per 1 L of the medium.}

1-3. 3-HP production analysis

The production amounts of 3-HP and 1,3-propanediol (1,3-PDO) in the culture medium were analyzed using High-Performance Liquid Chromatography (HPLC). _{For HPLP, 0.5 mM sulfuric acid (H 2} SO ₄ ) was flowed at a flow rate of 0.4 mL/min using an Aminex HPX-87H ion exclusion column (7.8 * 300 mm, 9㎛), and the temperature of the column was 35℃, The detector temperature was 35°C, the injection volume was 5 μL, and the UV detector was 210 nm.

As a result of performing a two-step culture to confirm the effect of NADH oxidase at the flask level, when comparing the 96-hour samples, 3-HP production increased more than three times in the case of the strain overexpressing NADH oxidase (Table 1).

vector 24hr 96hr 3HP(g/L) 1,3-PDO(g/L) 3HP(g/L) 1,3-PDO(g/L) pCDFJ23-dhaB-gdrAB-aldH pSTV28 0 0 0.95 0.37 pSTV28-noxE 0 0 3.07 0.41

Example 2. Confirmation of the effect of increasing 3-HP production by introducing the glpF gene

1-1. Preparation of plasmid

The promoter portion of the pCDFDuet-1 vector was replaced with the J23101 and J23100 promoters, and the dhaB (about 2.7 kb; dhaB1, dhaB2, dhaB3) and gdrAB genes (about 2.2 kb; gdrA, gdrB) were sequenced in the Krebsiella pneumoniae chromosome. Amplification was performed using the conditions provided by NEB using primers of numbers 1 to 4 and NEB Q5 DNA polymerase:

Since dhaB123 and gdrA genes are located side by side on the chromosome of Krebsiella pneumoniae, they were amplified together.Since gdrB is located in the opposite direction to dhaB123 and gdrA, only gdrB was amplified separately.At this time, NEB Q5 DNA polymerase was used. , The conditions provided by NEB were used. Thereafter, the dhaB123 and gdrA genes were cloned under the J23101 promoter using the restriction enzymes EcoRI and HindIII, and the gdrB gene was cloned using the restriction enzymes HindIII and AflII. aldH was cloned under the J23100 promoter, and amplified from E. coli K12 MG1655 chromosome, and at this time, primers of SEQ ID NOs: 5 and 6 and NEB Q5 DNA polymerase were used, and conditions provided by NEB were used.

aldH was cloned under the J23100 promoter using restriction enzymes KpnI and NdeI.

The noxE gene was amplified from E. coli K12 MG1655 chromosome and amplified using the following primers and NEB Q5 DNA polymerase, and the conditions provided by NEB were used.

-noxE-F primer: gtctaacatatgATGAAAATCGTAGTTATCGGTAC (SEQ ID NO: 11)

-noxE-R primer: ttgagatctcctgcaggTTATTTCGCATTGAGAG (SEQ ID NO: 12)

noxE was cloned after the aldH gene using restriction enzymes NdeI and BglII.

Through the above cloning, the pCDFJ23-dhaB-gdrAB-aldH-noxE plasmid was produced.

On the other hand, the glpF gene derived from E. coli K-12 MG1655 was cloned into the MCS portion of pSTV28, and was cloned together with UTR with an expression level of 70,000. Amplification was performed using the conditions provided by NEB using the following primers and NEB Q5 polymerase.

-UTR sequence: gacgatacccaaaggagcatcgtag (SEQ ID NO: 13)

-glpF-F: aaaggagcatcgtagatgagtcaaacatcaacc (SEQ ID NO: 14)

-utr7-glpF-F: acccggggatccgacgatacccaaaggagcatcgt (SEQ ID NO: 15)

-glpF-R: gcatgcttacagcgaagctttttgttc (SEQ ID NO: 16)

glpF was cloned using restriction enzymes BamHI and SphI. Through the above cloning, the pSTV28-glpF plasmid was produced.

1-2. Preparation and cultivation of transformed strains

Escherichia coli W3110 Δ (glpK, yqhD, ackA-pta, ldhA and gldA gene deletion strain, using Gene Bridges' Quick&easy e.coli gene deletion kit) strain pCDF J23-dhaB-gdrAB-aldH-noxE plasmid and pSTV28 plasmid, Alternatively, the pCDF J23-dhaB-gdrAB-aldH-noxE plasmid and pSTV28-glpF plasmid were introduced. Specifically, Escherichia coli W3110 Δ (glpK, yqhD, ackA-pta, ldhA, gldA) strain was plated on an LB plate (including 10g tryptone, 5g yeast extract, 10g NaCl, 15g agar per 1 liter) and cultured overnight at 37°C. I did. The cultured single colonies were inoculated into 3-5ml LB liquid medium (the medium composition was the same as above, but did not contain agar), and cultured overnight at 37°C with stirring. The next morning, the culture solution was diluted 1:100 in 0.05 liters of LB liquid medium and incubated for 3-6 hours until OD~0.5 was reached. After cooling on ice for 10-15 minutes, the cells were collected by centrifuging for 10 minutes at 4000 rpm at 4°C. The cells were resuspended in 1 volume of ice-cooled sterile DI water, washed, and centrifuged again at 4000 rpm at 4° C. for 10 minutes to collect the cells. The collected cells were resuspended in 0.5 volume of DI water, washed, and centrifuged at 4000 rpm at 4° C. for 10 minutes to collect the cells. The collected cells were resuspended in 1 ml of sterile 10% glycerol cooled on ice, and aliquots of cells were placed in individual pre-chilled microfuge tubes (90 ul per transformation in a 0.1 cm gap electroporation cuvette). After the salt-free DNA (1-5 ul) was added by pipetting, the mixture was transferred to a pre-chilled electroporation cuvette. After electroporation at 1.8 kV, 1 ml of room temperature LB liquid medium was added to the cells immediately after the pulse and incubated at 37° C. for 1 hour. The culture medium was spread on an LB plate containing streptomycin and chloramphenicol, and excess liquid was dried/absorbed into the plate. The plate was inverted and incubated at 37°C.

For flask culture, a single colony was inoculated into 3 mL of LB (Luria Bertani; peptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L, pH 7.0) medium, and at 37°C, 250 rpm for 20 hours. It was pre-cultured (seed culture).

Then, 1% was inoculated into 4 mL of LB medium, and cultured overnight with 0.5% glucose, streptomycin, and chloramphenicol. The cultured cells were recovered, inoculated into 4 mL of M9 medium, and cultured for 4 days at 37° C. and 250 rpm with streptomycin, chloramphenicol, 0.5% glucose, 2% glycerol and 1 uM vitamin B12.

M9 medium contains 10X M9 salts (pH 7.4) composed of 60 g of _{Na 2} HPO _{4 , 30 g of KH 2} PO ₄ , 5 g of NaCl, and _{10 g of NH 4 Cl per 1 L and 1 M MgSO 4} , 1 M CaCl ₂ solution. Separately, it was prepared by sterilization, and at the time of the main culture, the composition was composed of 100 mL of 10X M9 salts, 2 mL of _{1 M MgSO 4 , and 0.1 mL of 1 M CaCl 2 per 1 L of the medium.}

1-3. 3-HP production analysis

The production amounts of 3-HP and 1,3-propanediol (1,3-PDO) in the culture medium were analyzed using High-Performance Liquid Chromatography (HPLC). _{For HPLP, 0.5 mM sulfuric acid (H 2} SO ₄ ) was flowed at a flow rate of 0.4 mL/min using an Aminex HPX-87H ion exclusion column (7.8 * 300 mm, 9㎛), and the temperature of the column was 35℃, The detector temperature was 35℃, the injection volume was 5μL, and the UV detector was 210 nm.

As a result of conducting a two-step culture to confirm the effect of NADH oxidase at the flask level, 3-HP was hardly produced in the strain that did not overexpress the glpF protein in the 24-hour sample, whereas 3-HP was produced in the strain that overexpressed the glpF protein. Was produced. In addition, when comparing the 96-hour samples, the 3-HP production amount was increased by 2.3 times in the case of the strain that overexpressed the glpF protein compared to the strain that did not over-express the glpF protein (Table 2).

vector 24hr 96hr 3HP(g/L) 1,3-PDO(g/L) 3HP(g/L) 1,3-PDO(g/L) pCDFJ23-dhaB-gdrAB-aldH-noxE pSTV28 0.03 0 1.75 1.26 pSTV28-glpF 0.43 0 3.94 1.64

From the above description, those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. Therefore, the embodiments described above are illustrative in all respects and should be understood as non-limiting. The scope of the present invention should be construed as including the meaning and scope of the claims to be described later rather than the above detailed description, and all changes or modifications derived from the equivalent concepts within the scope of the present invention.

<110> LG CHEM, LTD. <120> Microorganism with increased 3-hydroxypropionic acid production and method for producing 3-hydroxypropionic acid using the same <130> DPP20192144KR <160> 16 <170> KopatentIn 1.71 <210> 1 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> dhaB-gdrA-F primer <400> 1 gaattcatga aaagatcaaa acgatttgca gtcct 35 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> dhaB-gdrA-R primer <400> 2 aagcttgatc tcccactgac caaagctgg 29 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> gdrB-F primer <400> 3 aagcttagag ggggccgtca tgtcgctttc accgccag 38 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> gdrB-R primer <400> 4 cttaagtcag tttctctcac ttaacggc 28 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> aldH-F primer <400> 5 ggtaccatga attttcatca tctggc 26 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> aldH-R primer <400> 6 catatgtcag gcctccaggc ttat 24 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> UTR Sequence <400> 7 taacgattat aaaggagcat ctggt 25 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> noxE-F primer <400> 8 aaaggagcat ctggtatgaa aatcgtagtt atc 33 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> utr10-noxE-F primer <400> 9 acccggggat cctaacgatt ataaaggagc atctg 35 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> noxE-R primer <400> 10 aagcttgcat gcttatttcg cattgagagc tgc 33 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> noxE-F primer <400> 11 gtctaacata tgatgaaaat cgtagttatc ggtac 35 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> noxE-R primer <400> 12 ttgagatctc ctgcaggtta tttcgcattg agag 34 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> UTR sequence <400> 13 gacgataccc aaaggagcat cgtag 25 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> glpF-F primer <400> 14 aaaggagcat cgtagatgag tcaaacatca acc 33 <210> 15 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> utr7-glpF-F primer <400> 15 acccggggat ccgacgatac ccaaaggagc atcgt 35 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> glpF-R primer <400> 16 gcatgcttac agcgaagctt tttgttc 27

Claims (4)

Including a gene encoding NADH oxidase and a gene encoding glycerol uptake facilitator,
A microorganism that produces 3-hydroxypropionic acid (3-HP). The method of claim 1,
In the group consisting of a gene encoding glycerol dehydratase, a gene encoding aldehyde dehydrogenase, and a gene encoding glycerol dehydratase reactivase The microorganism further comprising at least one selected. The method of claim 1,
The gene encoding lactate dehydrogenase, the gene encoding acetate kinase A, the gene encoding phosphotransacetylase, and alcohol dehydrogenase At least one selected from the group consisting of a gene encoding a gene, a gene encoding a glycerol kinase, and a gene encoding a glycerol dehydrogenase is deleted or inactivated. Comprising the step of culturing the microorganism of any one of claims 1 to 3 in a medium containing glucose or glycerol,
Method for producing 3-hydroxypropionic acid (3-HP).