KR102231332B1 - Microorganisms for producing cadaverine overexpressed with dr1558 and cadA genes and methods for producing cadaverine using the same - Google Patents

Abstract

The present invention relates to a method for producing high concentration of cadaverine (1,5-Diaminopentane) by introducing dr1558 genes derived from Deinococcus radiodurance, and cadA genes derived from Escherichia coli to Corynebacterium glutamicum, and thus by using the same, it is possible to lower the production cost of bio-based nylon used in various industrial fields.

Description

Microorganisms for producing cadaverine overexpressed with dr1558 and cadA genes and methods for producing cadaverine using the same}

The present invention relates to a microorganism for producing cadaverine (cadaverine, 1,5-Diaminopentane) overexpressing dr1558 and cadA genes, and a cadaverine production method using the same, and in more detail, in Deinococcus Radiodurans gene encoding the derived one DR1558 protein and E. coli cadaverine production method using (Escherichia coli) the Corynebacterium Com (Corynebacterium glutamicum) transformed with a recombinant vector comprising a gene encoding a CadA protein derived from and this It is about.

Recently, as a solution to problems caused by environmental problems caused by the use of chemical fuels, climate change, and depletion of chemical fuels, studies for the conversion from chemical fuel-based processes to bio-based processes have been actively conducted. The bio-based process is a process that can produce polymers, fuels, and chemicals that were produced based on conventional chemical fuels using renewable biomass.

Among the platform chemicals produced by bio-based processes, bio-based nylon (nyolon 56, nylon 510, nylon 512) is a polyamide polymer and is widely used in the textile and automobile industries. Cadaverine is a promising material that becomes a precursor of such bio-based nylon, and is a material produced from microorganisms by the reaction of lysine decarboxylase.

Lysine decarboxylase is known to be an inducible enzyme, CadA, and a structural enzyme, Ldc. CadA exhibits activity at pH 5.7, but since it is more active than Ldc, most of cadaverine (1,5-Diaminopentane) production proceeds using recombinant strains overexpressing CadA enzyme.

Oh, YH. et al., (2015). "Construction of Synthetic Promoter-Based Expression Cassettes for the Production of Cadaverine in Recombinant Corynebacterium glutamicum." Applied biochemistry and biotechnology. 176: 2065-2075. Kim, S. 　 et al. (2017) "Enhancement of Lysine Production in Recombinant Corynebacterium glutamicum through Expression of Deinococcus radiodurans pprM and dr1558 Genes." Microbiology and Biotechnology Letters. 45(3), pp. 271-275.

Accordingly, the present inventors have transformed Corynebacterium into a recombinant vector containing a gene encoding the DR1558 protein derived from Deinococcus Radiodurans and a gene encoding the CadA protein derived from Escherichia coli. It was confirmed that the production efficiency of cadaverine (1,5-Diaminopentane) of Corynebacterium glutamicum was remarkably excellent.

Accordingly, an object of the present invention is to provide a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli.

Another object of the present invention is to provide a microorganism for producing cadaverine transformed with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli. .

Another object of the present invention is a transformation step of transforming a microorganism with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli. It is to provide a method for producing a microorganism for producing cadaverine.

Another object of the present invention is to provide a method for producing cadaverine comprising:

A transformation step of transforming a microorganism with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli; And

A culture step of culturing the transformed microorganism in a medium.

Another object of the present invention relates to the use of a microorganism transformed with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli to produce cadaverine. will be.

The invention Deinococcus radiodurans (Deinococcus radiodurance) derived dr1558 gene and E. coli (Escherichia coli) four Corey the origin cadA gene tumefaciens glue Tommy Com cadaverine high concentration by introducing the (Corynebacterium glutamicum) (cadaverine, 1 , It relates to a method of producing 5-Diaminopentane), and by using it, the production cost of bio-based nylon used in various industrial fields can be lowered.

The present inventors produced a high concentration of cadaverine even under a low pH condition of 5.7 by expressing DR1558, which confers resistance to abiotic stress together with CadA, an inducible L-lysine decarboxylating enzyme. .

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli.

The term "vector" means a means for expressing a gene of interest in a host cell. For example, plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors, and viral vectors such as adeno-associated virus vectors. Vectors that can be used as recombinant vectors include plasmids often used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, and pUC19, etc.), phage (e.g., λgt4λB, λ-Charon, λΔz1 and M13, etc.) or virus (e.g., SV40, etc.), but is not limited thereto. .

The recombinant vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be a conventional one used in the art to express foreign proteins in plants, animals, or microorganisms. The recombinant vector can be constructed through various methods known in the art.

The recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 Promoter, etc.), a ribosome binding site for initiation of translation, and a transcription/translation termination sequence are generally included.

In the case of eukaryotic cells as a host, the origin of replication operating in eukaryotic cells included in the vector includes the f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adeno origin of replication, AAV origin of replication, BBV origin of replication, etc. It is not limited. In addition, a promoter derived from the genome of a mammalian cell (e.g., metallotionine promoter) or a promoter derived from mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, The cytomegalovirus promoter and the tk promoter of HSV) can be used and generally have a polyadenylation sequence as the transcription termination sequence.

In an example of the present invention, a transformant may be created by inserting a recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into an appropriate host cell.

The host cell is a cell capable of stably and continuously cloning or expressing the expression vector, and any host cell known in the art may be used.

Host cells used in the present invention may include E. coli, yeast, animal cells, plant cells, insect cells, and the like, and prokaryotic cells include, for example, E. coli JM109, E. coli BL21, E. strains of the genus Bacillus such as coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringensis, and Salmonella typhimurium, Serratia marsessons, and There are enterobacteriaceae strains such as various Pseudomonas species, and when transforming into eukaryotic cells, as host cells, yeast ( Saccharomyce cerevisiae ), insect cells, plant cells and animal cells, such as Sp2/0, CHO (Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc. may be used, but are not limited thereto.

Transport (introduction) of the polynucleotide or a recombinant vector containing the same into a host cell may use a transport method well known in the art. For example, when the host cell is a prokaryotic cell, a CaCl ₂ method or an electroporation method may be used, and when the host cell is a eukaryotic cell, a microinjection method, a calcium phosphate precipitation method, an electroporation method, Liposome-mediated transfection method and gene bombardment may be used, but are not limited thereto.

The method of selecting the transformed host cell can be easily carried out according to a method well known in the art using a phenotype expressed by a selection label. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

Another aspect of the present invention is a microorganism for producing cadaverine transformed with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli.

The microorganism may be Corynebacterium glutamicum or E. coli, but is not limited thereto.

Another aspect of the present invention comprises a transformation step of transforming a microorganism with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli. This is a method for producing microorganisms for cadaverine production.

The microorganism may be Corynebacterium glutamicum or E. coli, but is not limited thereto.

Another aspect of the present invention is a method for producing cadaverine comprising:

A transformation step of transforming a microorganism with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus radiodurans and a gene encoding a CadA protein derived from E. coli; And

A culture step of culturing the transformed microorganism in a medium.

The microorganism may be Corynebacterium glutamicum or E. coli, but is not limited thereto.

The culturing step may be performed under conditions of pH 4.0 to 8.0, pH 4.0 to 7.0, pH 4.0 to 6.0, pH 5.0 to 8.0, pH 5.0 to 7.0, or pH 5.0 to 6.0, for example, in the condition of pH 5.7. It may be performed, but is not limited thereto. Depending on the active conditions of CadA, the cultivation step is most preferably carried out at a pH of 5.7 conditions.

The culturing step may be performed at a temperature of 20 to 40°C, 20 to 36°C, 20 to 32°C, 24 to 40°C, 24 to 36°C or 24 to 32°C, for example, 30°C, but limited thereto It does not become. When it is carried out at a temperature of 30℃, the growth of microorganisms and the production concentration of cadaverine are the highest.

The culturing step may be performed in a medium containing a carbon source, and the carbon source may be glucose or fructose, but when glucose is used, the growth efficiency is best. The glucose may be at a concentration of 10 to 120 g/L, 20 to 120 g/L, 50 to 120 g/L, or 80 to 120 g/L, for example, 100 to 120 g/L, but limited thereto. It does not become.

The culturing step may be performed for 24 to 48 hours using a batch fermentation method in an aerobic condition, but is not limited thereto.

Incubation stage is RG medium (per liter: 10 g glucose, 40 g Brain Heart Infusion, 10 g Beef Extract, 30 g D-sorbitol) or CG medium (per liter 100 g glucose, 30 g yeast extract, 30 g (NH ₄ ) ₂ SO ₄ 7H ₂ O, 30 g CaCO ₃ , 0.5 g KH ₂ PO ₄ , 0.5 g MgSO ₄ 7H ₂ O, 0.01 g MnSO ₄ H ₂ O, 0.01 g FeSO ₄ 7H ₂ O, 0.5 mg biotin, 0.3 mg thiamine-HCl), but is not limited thereto.

The method may be to further include a recovery step of recovering cadaverine from the medium.

The invention Deinococcus radiodurans (Deinococcus radiodurance) derived dr1558 gene and E. coli (Escherichia coli) four Corey the origin cadA gene tumefaciens glue Tommy Com cadaverine high concentration by introducing the (Corynebacterium glutamicum) (cadaverine, 1 , It relates to a method of producing 5-Diaminopentane), and by using it, the production cost of a precursor of bio-based nylon used in various industrial fields can be lowered.

1 is a schematic diagram showing a pCES208H30cadA_dr1558 vector map including both the dr1558 gene derived from Deinococcus radiodurance and the cadA gene derived from Escherichia coli.
Figure 2a is a cell growth rate, glucose consumption, cadaverine (cadaverine, 1,5-Diaminopentane) production amount and lysine concentration of the Corynebacterium glutamicum strain transformed with the pCES208H30cadA_dr1558 vector containing both dr1558 and cadA genes. It is a graph showing the batch culture results.
Figure 2b is a batch culture result graph showing the cell growth rate, glucose consumption, cadaverine production and lysine concentration of the Corynebacterium glutamicum strain transformed with the pCES208208H30cadA vector containing both dr1558 and cadA genes.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Throughout this specification, "%" used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol)%.

Example 1: dr1558 And cadA Construction of recombinant strains in which genes are simultaneously expressed

The pCES208 vector including E. coli-derived cadA was a recombinant vector (pCES208H30cadA) constructed in a previous study (see Oh, YH et al., Applied biochemistry and biotechnology . 176: 2065-2075). The dr1558 gene derived from Deinococcus radiodurance is The previously constructed pCES208H30dr1558 vector (see Kim SM. et al., Microbiology and Biotechnology Letters , 45(3): 271-275) was digested with Bam HI restriction enzyme and obtained as a DNA fragment of 678 bp in size.

The sequences of the dr1558 and cadA genes used are shown in Table 1 below.

Sequence number designation order One dr1558 gene TCAAGGACGCCTCCAGCGACACCCTGGCCGACGCCATCCACGCGGCGGCGCGCGGCGAAGTGCGGCTGCATCCCGAAGCGGCGCGGCGGCTGGTGCGCGATTTCCGGTCGCCGGAGATGCGCGAGAGCCTGACCCCCAAGGAAACCGCCGTGCTGCAACTGCTGGCGCGCGGGCAGAGCAACAAGGACATCGCCGCCGAACAGGGCGTGAGCGAGGCGACGGTCAAGACCCACGTGTCGCGGCTGCTGAGCAAGCTGGGGCTGGACAGCCGGACGCAGGCGGCGCTCTACGCCCTCAAATACGGGATTGCCAGTCTGGAGGGCGTGGAGTTGTGAGTGACTCTGCCTCAAGGAGAATCTATGACCACCCCCACTGTCCGTGTGCTGCTCGTTGACGACCACGCCGTCGTGCGCCAGGGTCTGCGCCTCTTTCTGGGGCTGGACGAAGGCATCGAAGTGGTGGGCGAGGCCGCCAACGGCGAAGAAGCCCTGCAAGAGGCCGAGCGCCTGCGCCCCGAAGTCGTCGTGATGGACCTGATGATGCCGGTGATGGATGGCATTACCGCCACCCGTGAGCTGCGCCGCCGCCTGCCCGACACCGAAGTCATCGCGCTGACCTCCACCCTGGAAGAAAACAAGGTGAACGGCGCGATTGAGGCCGGGGCCATCTCGTACATGC 2 cadA gene GATCCttattttttgctttcttctttcaataccttaacggtatagcggccatcagcctgacggtatgcaccgtgaatatcggtttcaaagcccggatagtgagcgccgatttcacacagcatctgcaggaactccagaaccggacggctttcttcggtgatcatttcacccggcattaccagaggaactcccggcgggtacggaaggatcatattggcgttaatacgacctaccatttcgtcgaggtaaacttcttcggtcataccgtgcagctctttctggaatgcagcatacggagtcattaccatcgtcggcagcacttcaaatgcgcgatacatcagatccggcagattgtggtgaacaatcagtttgtggatattctgagccagttcctgaatacgcatgttttcatagaattcaggatcttcacgatacagagacggcagcatgtttttcacacgcaggttcaggtcgaacgcacgtttaaagtcagtcagagcacgcagcaggctcagtgctttggtcttatcgataccgatgctgaacaggaacagcaggttatacggaccggttttctcaacaacgatgccatgttcgtcgaggtatttcgccacgatgctggccggaataccaaagtcgctcatggtgccgtctttttccatccccggagtcagcagggtgactttgatcgggtcaagatacatgtgctcgttatcgatgtttttgaagccgtgccaggtgctgtcagaacgcagcggccagcattcagtcgtatcgatatgatccggctgccatacatcaaagaaccagccatcagattccgttctcagacgtttgatctctttacggaatttgatcgcacgttcaatagaaccgttgatcagacgcttacctgcattgcctttcatcatcgccgcagcggtttcagtggacgccacgataccgtagtgcggagaagtggtggtgtgcatcatgtaggcttcgttaaaggtttcttcgt ttacgtcacctttaacgtggatcatggaagcctgagagaacgccgccagcagtttgtgagtggactgggtttcgtaaatcactttcccttctacacggccaccgctcataccgcatttaccttcgtaaatcggtgagaagttggtgtaaggcacccacgcggagtcaaagtggatggatttcacatccagtgttttcttgatgaagtcggtgttgtacagcagaccatcataggtagagttggtaattacagcatgtaccggccaggttgcgtttggtgtttctttcacgcgcttagcaatggtagcgtgctggaattcactctgtgggataccaccaagaataccgtaagcgttacgggtcgggcggaaatagattggcgtaacatcgctcatcatcatcaggtgggtcagcgatttgtggcagttacggtcaatcagaatggtgctgcctgctggagcagagtacataccaacaattttgttcgcagtggaagtaccgttggtcaccatgtagctgcggtctgcgttaaagacgcgagcgatatactgttctgcttctttgtgtggaccactgtgatccagcagagaacccagttcagatactgaaatggaaatatcagatttcatggtattcggaccaaagaaatcatagaacaggctacctaccgggcttttctggaatgcagtaccgcccatgtgaccaggagtacagaaagtatatttaccttcacgaacatatttaaacagtgctttagtcagcggaggcagaatagtgttgatatattcgtcagtggtctgcttgatcttattagcaatatcttcagcagcacccagcgcatattcaaagaagctaatctgtaaacgcaggtcattcaggcttacatcgagagtggaatacgtattagcgaacgcgtacaacggcaggttctcgttcattttgctaatttcttcgcacagctcgagattatatttatcccagtcaaaaataacgccgcacag acgcgcattgttttcgatcagttttaataagtcgtcacggtcgttcgggtaaacaatctggaagttcagacgttcaagcgcgcgatgaagttcacggatgggttcttctttaaaataaacccccatgtgattcaatattgcaataacgttcatGCggcc

The previously constructed pCES208H30cadA was digested with a Bam HI restriction enzyme, and then the obtained dr1558 gene was ligase to prepare a pCES208H30cadA_dr1558 recombinant vector as shown in FIG. 1.

The introduction of the dr1558 gene was confirmed through DNA sequencing. The dr1558 gene and the cadA gene cloned recombinant vector (pCES208H30cadA_dr1558) were transformed into Corynebacterium glutamicum KCTC 1857 strain by electroporation and transformed into RG medium (per liter: 10 g glucose, 40 g Brain Heart) Infusion, 10 g Beef Extract, 30 g D-sorbitol) and 30 ug/ml kanamycin antibiotic were selected in solid medium.

Example 2: Production of cadaverine by recombinant strain

Culture for producing cadaverine (1,5-Diaminopentane) was performed using the transformed dr1558 gene and the recombinant Corynebacterium glutamicum overexpressing the cadA gene. As a culture medium, 30 ug/ml kanamycin was added to RG medium (per liter: 10 g/L glucose, 40 g/L Brain Heart Infusion, 10 g/L Beef Extract, 30 g/L D-sorbitol). Then, it was pre-incubated at 30° C. for 18 hours.

Recombinant Corynebacterium glutamicum, in which the pre-cultured dr1558 gene and the cadA gene were simultaneously overexpressed, was inoculated into a medium containing 20 ug/ml kanamycin antibiotic in 30 ml RG medium and cultured (30° C., 250 rpm, 10 hr. ).

To confirm the amount of cadaverine produced at a low pH, when the cell growth rate (0D600) of the strain reached about 50, the pH was adjusted from 7.1 to 5.7 and then fermentation was performed.

Specifically, batch fermentation was performed by inoculating the culture medium in 500 ml of CG-50 medium containing 20 ug/ml of kanamycin antibiotic in an incubator of a 2.5-L fermentor (jar fermentor, BioCNS, Daejeon, Republic of Korea). . The pH conditions of fermentation were adjusted using 14% (v/v) NH ₄ OH and 1 MH ₂ SO ₄ , and the formation of foam during cultivation was prevented using Antifoam 204 (Sigma-Aldrich, USA). .

During fermentation, a certain amount of cells were recovered and the cell growth rate (od), glucose consumption (glucose), cadaverine concentration (cadaverine), and lysine concentration were measured over time. The cell growth rate was confirmed by measuring the absorbance at 600 nm using a UV spectrophotometer. The amount of glucose consumed was analyzed by high performance liquid chromatography (HPLC), and the supernatant obtained by centrifugation after obtaining a certain amount of culture medium was filtered through a 0.22 um filter, and the filtered filtrate was analyzed using high performance liquid chromatography (HPLC).

The concentrations of cadaverine and lysine are determined by obtaining a certain amount of culture medium and centrifuging the supernatant obtained by diethyl ethoxymethylenemalonate (DEEMM) derivatization reaction, followed by high performance liquid chromatography (HPLC). ) Was used.

After 24h incubation od glucose lysine cadaverine dr1558 , cadA 157 0.00 2.20 6.40 cadA 108 0.10 0.55 3.60

As can be seen in Table 2, Figures 2a and 2b, after culturing for 24 hours, in the recombinant Corynebacterium glutamicum in which both dr1558 and cadA genes are overexpressed, compared to the recombinant Corynebacterium glutamicum control group in which only cadA is overexpressed. The cell growth rate increased more than 1.5 times and the glucose consumption rate also increased. In addition, it was confirmed that cadaverine production increased more than two times.

Since it was confirmed that cadaverine was produced at a low pH condition from the recombinant Corynebacterium glutamicum strain overexpressing the dr1558 and cadA genes, it can be determined that it can be used as a useful strain in the bio-based nylon industry.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Microorganisms for producing cadaverine overexpressed with dr1558 and cadA genes and methods for producing cadaverine using the same <130> PN200103 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 678 <212> DNA <213> Unknown <220> <223> Deinococcus radiodurance <400> 1 tcaaggacgc ctccagcgac accctggccg acgccatcca cgcggcggcg cgcggcgaag 60 tgcggctgca tcccgaagcg gcgcggcggc tggtgcgcga tttccggtcg ccggagatgc 120 gcgagagcct gacccccaag gaaaccgccg tgctgcaact gctggcgcgc gggcagagca 180 acaaggacat cgccgccgaa cagggcgtga gcgaggcgac ggtcaagacc cacgtgtcgc 240 ggctgctgag caagctgggg ctggacagcc ggacgcaggc ggcgctctac gccctcaaat 300 acgggattgc cagtctggag ggcgtggagt tgtgagtgac tctgcctcaa ggagaatcta 360 tgaccacccc cactgtccgt gtgctgctcg ttgacgacca cgccgtcgtg cgccagggtc 420 tgcgcctctt tctggggctg gacgaaggca tcgaagtggt gggcgaggcc gccaacggcg 480 aagaagccct gcaagaggcc gagcgcctgc gccccgaagt cgtcgtgatg gacctgatga 540 tgccggtgat ggatggcatt accgccaccc gtgagctgcg ccgccgcctg cccgacaccg 600 aagtcatcgc gctgacctcc accctggaag aaaacaaggt gaacggcgcg attgaggccg 660 gggccatctc gtacatgc 678 <210> 2 <211> 2159 <212> DNA <213> Unknown <220> <223> Escherichia coli <400> 2 gatccttatt ttttgctttc ttctttcaat accttaacgg tatagcggcc atcagcctga 60 cggtatgcac cgtgaatatc ggtttcaaag cccggatagt gagcgccgat ttcacacagc 120 atctgcagga actccagaac cggacggctt tcttcggtga tcatttcacc cggcattacc 180 agaggaactc ccggcgggta cggaaggatc atattggcgt taatacgacc taccatttcg 240 tcgaggtaaa cttcttcggt cataccgtgc agctctttct ggaatgcagc atacggagtc 300 attaccatcg tcggcagcac ttcaaatgcg cgatacatca gatccggcag attgtggtga 360 acaatcagtt tgtggatatt ctgagccagt tcctgaatac gcatgttttc atagaattca 420 ggatcttcac gatacagaga cggcagcatg tttttcacac gcaggttcag gtcgaacgca 480 cgtttaaagt cagtcagagc acgcagcagg ctcagtgctt tggtcttatc gataccgatg 540 ctgaacagga acagcaggtt atacggaccg gttttctcaa caacgatgcc atgttcgtcg 600 aggtatttcg ccacgatgct ggccggaata ccaaagtcgc tcatggtgcc gtctttttcc 660 atccccggag tcagcagggt gactttgatc gggtcaagat acatgtgctc gttatcgatg 720 tttttgaagc cgtgccaggt gctgtcagaa cgcagcggcc agcattcagt cgtatcgata 780 tgatccggct gccatacatc aaagaaccag ccatcagatt ccgttctcag acgtttgatc 840 tctttacgga atttgatcgc acgttcaata gaaccgttga tcagacgctt acctgcattg 900 cctttcatca tcgccgcagc ggtttcagtg gacgccacga taccgtagtg cggagaagtg 960 gtggtgtgca tcatgtaggc ttcgttaaag gtttcttcgt ttacgtcacc tttaacgtgg 1020 atcatggaag cctgagagaa cgccgccagc agtttgtgag tggactgggt ttcgtaaatc 1080 actttccctt ctacacggcc accgctcata ccgcatttac cttcgtaaat cggtgagaag 1140 ttggtgtaag gcacccacgc ggagtcaaag tggatggatt tcacatccag tgttttcttg 1200 atgaagtcgg tgttgtacag cagaccatca taggtagagt tggtaattac agcatgtacc 1260 ggccaggttg cgtttggtgt ttctttcacg cgcttagcaa tggtagcgtg ctggaattca 1320 ctctgtggga taccaccaag aataccgtaa gcgttacggg tcgggcggaa atagattggc 1380 gtaacatcgc tcatcatcat caggtgggtc agcgatttgt ggcagttacg gtcaatcaga 1440 atggtgctgc ctgctggagc agagtacata ccaacaattt tgttcgcagt ggaagtaccg 1500 ttggtcacca tgtagctgcg gtctgcgtta aagacgcgag cgatatactg ttctgcttct 1560 ttgtgtggac cactgtgatc cagcagagaa cccagttcag atactgaaat ggaaatatca 1620 gatttcatgg tattcggacc aaagaaatca tagaacaggc tacctaccgg gcttttctgg 1680 aatgcagtac cgcccatgtg accaggagta cagaaagtat atttaccttc acgaacatat 1740 ttaaacagtg ctttagtcag cggaggcaga atagtgttga tatattcgtc agtggtctgc 1800 ttgatcttat tagcaatatc ttcagcagca cccagcgcat attcaaagaa gctaatctgt 1860 aaacgcaggt cattcaggct tacatcgaga gtggaatacg tattagcgaa cgcgtacaac 1920 ggcaggttct cgttcatttt gctaatttct tcgcacagct cgagattata tttatcccag 1980 tcaaaaataa cgccgcacag acgcgcattg ttttcgatca gttttaataa gtcgtcacgg 2040 tcgttcgggt aaacaatctg gaagttcaga cgttcaagcg cgcgatgaag ttcacggatg 2100 ggttcttctt taaaataaac ccccatgtga ttcaatattg caataacgtt catgcggcc 2159

Claims (12)

Recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus Radiodurans and a gene encoding a CadA protein derived from Escherichia coli. Cadaverine transformed with a recombinant vector containing a gene encoding the DR1558 protein derived from Deinococcus Radiodurans and a gene encoding the CadA protein derived from Escherichia coli (cadaverine, 1, 5-Diaminopentane) production microorganisms. The microorganism for producing cadaverine according to claim 2, wherein the microorganism is Corynebacterium glutamicum. Including a transformation step of transforming a microorganism with a recombinant vector containing a gene encoding a DR1558 protein derived from Deinococcus Radiodurans and a gene encoding a CadA protein derived from Escherichia coli A method for producing a microorganism for producing cadaverine (cadaverine, 1,5-Diaminopentane). The method of claim 4, wherein the microorganism is Corynebacterium glutamicum . Cadaverine (1,5-Diaminopentane) production method comprising:
Transformation step of transforming a microorganism with a recombinant vector comprising a gene encoding a DR1558 protein derived from Deinococcus Radiodurans and a gene encoding a CadA protein derived from Escherichia coli; And
A culture step of culturing the transformed microorganism in a medium. The method of claim 6, wherein the microorganism is Corynebacterium glutamicum . The method of claim 6, wherein the culturing step is performed under conditions of pH 4.0 to 8.0. The method of claim 6, wherein the culturing step is performed at a temperature of 20 to 40°C. The method of claim 6, wherein the culturing step is performed in a medium containing a carbon source. The method of claim 10, wherein the carbon source is glucose. The method of claim 6, wherein the method further comprises a recovery step of recovering cadaverine from the medium.

Images