KR102008998B1 - Hexanoic acid-producing recombinant microorganism and method of producing hexanoic acid using the same - Google Patents

Abstract

The present invention relates to a recombinant microorganism producing hexanoic acid and a method for producing hexanoic acid using the same. More specifically, the present invention relates to a recombinant microorganism for hexanoic acid production having improved productivity of hexanoic acid by controlling atoB expression, and a method for producing hexanoic acid using the same. The recombinant microorganism for hexanoic acid production according to the present invention has precisely regulated the expression level of the atoB gene, which is a homologous gene, through 5′ UTR redesign. As a result, it is possible to optimally redistribute precursors in hexanoic acid metabolic pathways and to significantly increase hexanoic acid production, and thus the recombinant microorganism can be widely applied in various industrial fields in which hexanoic acid is utilized.

Description

HEXANOIC ACID-PRODUCING RECOMBINANT MICROORGANISM AND METHOD OF PRODUCING HEXANOIC ACID USING THE SAME

The present invention relates to a recombinant microorganism producing hexanoic acid and a method for producing hexanoic acid using the same, more specifically, a recombinant microorganism for hexanoic acid production which improves the productivity of hexanoic acid by controlling atoB expression, and the same It relates to a method for producing hexanoic acid used.

Hexanoic acid is a saturated carboxylic acid with six carbons and has high economic potential as a platform chemical. Hexanoate acid production using microbial fermentation has focused on separating and engineering by the anaerobic bacteria such as Clostridium genus (Clostridium sp.) And Mega Spa in Riviera (Megasphaera sp.). However, it is not easy to develop an economical production process due to slow growth rate, demand for anaerobic conditions, limited genetic tools and the like.

In the hexanoic acid metabolic pathway, the final step is catalyzed by homologous or heterologous thioesterase in E. coli to hydrolyze the acyl-CoA intermediate. The choice of enzyme used in this step has a significant impact on the titer, productivity and yield of the carboxylic acid. For example, knockout of different homologous thioesterase genes from recombinant E. coli strains substantially alters the proportion of carboxylic acid products having various chain lengths (Kim et al., 2015; Volker et al. ., 2014). In another study in mice, E. coli (Mus musculus ) -derived acyl-CoA hydrolase was expressed to produce hexanoic acid, which is due to the property that the enzyme favors longer acyl-CoA intermediates (Machado et al., 2012). These results collectively indicate that the use of appropriate enzymes to catalyze the final step can improve hexanoic acid production in E. coli.

Fine tuning of the expression level of the enzyme is also essential for hexanoic acid production. 3-ketohexanoyl-CoA, a C6 substrate of hexanoic acid metabolic pathway, is synthesized by condensation of acetyl-CoA (C2) and butyryl-CoA (C4) in the same molar ratio, so a balanced supply of the two precursors is essential. However, because butyryl-CoA is synthesized from acetyl-CoA, simple overexpression of the enzyme causes severe imbalance between the precursors. Therefore, it is necessary to control the expression level of each catalyst that mediates metabolic pathways.

AtoB , on the other hand, catalyzes the first stage of the hexanoic acid production pathway and determines the proportion of precursors in the hexanoic acid metabolic pathway. In previous studies, atoB was simply overexpressed to amplify the metabolic pathway from acetyl-CoA to butyryl-CoA (Lim et al., 2013a, 2013b; Shen et al., 2011), but such overexpression of atoB is acetyl-CoA And intracellular imbalances of butyryl-CoA to inhibit hexanoic acid productivity. In addition, overexpression of atoB amplifies the metabolic pathway to butyryl-CoA up to the limit of the activity of the enzymes that catalyze downstream metabolic pathways ( hbd , crt and ter ), while imbalances downstream pathway activity results in the Accumulation and atoB 's strong acetoacetyl-CoA cleavage preferences result in hydrolysis of acetoacetyl-CoA to acetyl-CoA.

Accordingly, the present inventors confirmed that the expression level of atoB at the acetyl-CoA node of the hexanoic acid metabolic pathway significantly influences the production of hexanoic acid, thereby redistributing the metabolic flow through precise expression control of the atoB gene. The present invention was completed by preparing a recombinant microorganism having improved hexanoic acid production by metabolic flux rebalancing.

It is an object of the present invention to provide a first recombinant vector comprising atoB gene encoding a synthetic 5 'UTR (untranslated region) and acetyl-CoA acetyltransferase.

Another object of the present invention is to provide a recombinant microorganism for producing hexanoic acid into which the first recombinant vector is introduced.

In addition, another object of the present invention is to introduce the first recombinant vector; It is to provide a method for producing a recombinant microorganism for hexanoic acid production comprising a.

In addition, another object of the present invention is the step of culturing the recombinant microorganism; To provide a method for producing hexanoic acid comprising a.

In order to achieve the above object, the present invention provides a first recombinant vector comprising atoB gene encoding a synthetic 5 'UTR (untranslated region) and acetyl-CoA acetyltransferase (acetyl-CoA).

The present invention also provides a recombinant microorganism for producing hexanoic acid into which the first recombinant vector is introduced.

In addition, the present invention comprises the steps of introducing the first recombinant vector; It provides a method for producing a recombinant microorganism for hexanoic acid production comprising a.

In addition, the present invention comprises the steps of culturing the recombinant microorganism; It provides a method for producing hexanoic acid comprising a.

The recombinant microorganism for hexanoic acid production according to the present invention is a 5 'UTR redesign to precisely control the expression level of the atoB gene, which is a homologous gene, thereby optimizing the redistribution of precursors in the hexanoic acid metabolic pathway and hexa As the production of noic acid can be increased significantly, it can be widely applied in various industries where hexanoic acid is utilized.

1 is a schematic diagram showing a precursor balancing process by adjusting atoB expression, (a) is a diagram showing a precursor balancing method according to atoB expression control to increase the hexanoic acid production, (b) is 5 ' a diagram showing a result of measuring the atoB, hbd, crt, and ter activity of each strain one atoB control the expression level in each of different intensity (SGK104, SGK105, SGK106 and SGK107) through UTR redesign.
2 is a diagram showing the amount of the carboxylic acid concentration (titer) and the intracellular CoA intermediates of each strain (SGK104, SGK105, SGK106 and SGK107) was adjusted to different atoB expression level through the 5 'UTR redesign each century. Specifically, (a)-(c) is a diagram showing the results of measuring the carboxylic acid concentration from the recombinant strain in which the redesigned atoB 5 'UTR was introduced for 36 hours in TB medium. (d)-(f) is a diagram showing the results of measuring the amount of acetyl-CoA, butyryl-CoA and hexanoyl-CoA in the cells in the above strains.

Hereinafter, the present invention will be described in detail.

Terms not defined otherwise in this specification are intended to have the meanings commonly used in the art.

In the present invention, "gene" should be considered in the broadest sense and may encode structural or regulatory proteins. At this time, the regulatory protein includes a transcription factor, a heat shock protein or a protein involved in DNA / RNA replication, transcription and / or translation. In the present invention, the target gene to be suppressed expression may exist as an extrachromosomal component.

In the present invention, "recombinant vector" means a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. The recombinant vector may preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, which corresponds to all genes that can distinguish transformed cells from non-transformed cells. Examples include, but are not limited to, antibiotic resistance genes such as ampicilin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, but are not limited thereto. It can select suitably.

In the present invention, the "5 'untranslated region" is an untranslated region located at the 5' and 3 'ends of the mRNA, and is generally a 5' untranslated region (5 'UTR). Performs several functions in the gene expression process, the most important of which is involved in the regulation of mRNA translation efficiency. The base sequence of the 5 'UTR in the immediate upper portion of the translation initiation codon has been reported to affect the efficiency of the translation step. The length of the 5' UTR is either back base or more nucleotides. UTRs are made up of several kilobases longer. Also, a sequence belonging to 5 'UTR, which is not a predetermined position such as a Shine-Dalgarno sequence, which is known as a ribosome binding site sequence located at 5' UTR in prokaryotes, is a ribosome binding site sequence, which is also called a ribosome binding site sequence in eukaryotes. The results of these studies have been reported.

The present invention provides a first recombinant vector comprising atoB gene encoding a synthetic 5 ′ untranslated region (UTR) and acetyl-CoA acetyltransferase.

In the present invention, the "acetyl-CoA acetyltransferase" refers to an enzyme that generates acetoacetyl-CoA from two acetyl-CoA by transferring an acetyl group to acetyl CoA (Acetylcoenzyme A).

In the present invention, the synthetic 5 'UTR may be a synthetic 5' UTR designed such that the predicted expression amount (au) of the atoB gene is 1,100 or more and 300,000 or less. In one embodiment of the present invention, the predicted expression of the atoB gene of the synthetic 5 'UTR is 332085.81 au (overexpression, atoB-C, SEQ ID NO: 1) and 1085.74 au (low expression, atoB-DR3, SEQ ID NO: 4) The imbalance of the amount of intermediate (acetyl-CoA, butyryl-CoA) was confirmed. It was also confirmed that hexanoic acid production increased as the amount of intermediate was adjusted. Therefore, the synthetic 5 'UTR is preferably designed to maximize the hexanoic acid production amount so that the predicted expression amount of the atoB gene is at least 1,100 or more and 300,000 or less.

More specifically, the synthetic 5 'UTR may be characterized by consisting of a nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3, which is intended to illustrate the present invention is limited to the contents of the present invention to the sequence It is not. In addition, it will be apparent to those skilled in the art that the synthetic 5 ′ UTR may be included without limitation as long as it is designed to display a specific predicted expression amount (a.u.).

In the present invention, the first recombinant vector may further comprise a bktB gene encoding beta-ketothiolase (β-ketothiolase).

In the present invention, the "beta-ketothiolase" refers to an enzyme that polymerizes (condensation) a CoA compound having C2 to produce a compound such as C4 or C6. In the present invention, beta-ketothiolase refers to an enzyme that produces 3-ketohexanoyl-CoA (C6) by adding acetyl-CoA to butyryl-CoA, an intermediate metabolite of metabolism.

In addition, in the present invention, the bktB gene may be derived from Cupriavidus necator .

The present invention also provides a recombinant microorganism for producing hexanoic acid into which the first recombinant vector of the present invention is introduced.

In the present invention, the recombinant microorganism refers to the transformed. In the present invention, "transformation" means introducing a promoter or a vector containing a gene encoding a target protein into a host cell, and includes overexpression or deletion of the gene. In addition, the gene encoding the transformed target protein may be inserted into the chromosome of the host cell or located outside the chromosome as long as it can be expressed in the host cell.

Not all vectors function equally in expressing the DNA sequences of the present invention, and likewise not all hosts function equally for the same expression system. However, those skilled in the art can make appropriate choices among various vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden. For example, in selecting a vector, the host must be considered, since the vector must be replicated in it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

In the present invention, the recombinant microorganism may further comprise a second recombinant vector comprising a mhact gene encoding acetyl-CoA transferase (ACT) derived from Megasphaera sp. MH in addition to the first recombinant vector . It may be characterized as introduced.

In the present invention, the second recombinant vector is crotonate tyrosinase crt genes, 3-hydroxy-butyryl -CoA dehydrogenase (3-hydroxybutyryl-CoA dehydrogenase) and the coding hbd gene encoding the trans (Crotonase) It may be characterized in that it further comprises a ter gene encoding a trans- enoyl-CoA reductase ( trans -enoyl-CoA reductase).

In the present invention, the "crotonase" refers to an enzyme that binds a water molecule to an enoyl-CoA compound by another expression, enoyl-CoA hydratase, and reversibly represents a hydroxy group. It is an enzyme that also mediates the action of decomposing water molecules in the CoA compound to produce inoyl-coA compounds. In addition, the "3-hydroxybutyryl-CoA dehydrogenase" mediates the action of leaving hydrogen in 3-hydroxybutyryl-CoA, which can be interpreted as a kind of oxidation reaction. However, it is also possible to mediate a kind of reductive action to produce 3-hydroxybutyryl-CoA by attaching hydrogen to acetoacetyl-CoA to become a reversible reaction. In addition, the term " trans -inoyl-CoA reductase" refers to an enzyme that reduces hydrogen by attaching hydrogen to trans -inoyl-CoA.

Sequences of the enzymes can be obtained from known databases, but are not limited thereto. Preferably, the nucleotide sequence encoding the atoB, bktB, mhact, crt, hbd or ter of the present invention is represented by the respective SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 It may be composed of the base sequence. In addition, a variant of the nucleotide sequence may also be included within the scope of the present invention, and specifically, the variant may be 70% or more, preferably 80% or more, more preferably 90% or more, and more particularly, SEQ ID NOS: 24 to 29, respectively. Preferably at least 95%, even more preferably at least 98%, most preferably at least 99% may include a base sequence having sequence homology. Wherein the “% sequence homology” to the polynucleotide is identified by comparing the two optimally arranged sequences with the comparison region, wherein a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (additional Or does not include deletion) or addition or deletion (gap).

In the present invention, the crt gene and hbd gene may be a Clostridium acetonitrile unit Tilikum and (Clostridium acetobutylicum) origin, Ter gene TRE Four nematic den Tycho ulreo (Treponema denticola) origin.

In the present invention, the microorganism is Escherichia sp . ) May be microorganisms, preferably E. coli.

In the present invention, the micro-organisms is based on the E. coli, the activity of the atoB weakened compared with the endogenous activity, bktB, mhact, crt, hbd and ter activity of the gene combination can be enhanced.

In addition, the present invention comprises the steps of introducing a first recombinant vector of the present invention; It provides a method for producing a recombinant microorganism for hexanoic acid production comprising a.

In the present invention, the microorganism introduction of the target gene is preferably made through the substitution of the genetic information of the microorganism chromosome, which can be performed using any method known in the art without limitation. In an embodiment of the present invention, the red recombination system is used, but is not limited thereto.

In addition, the microorganism of the target gene may be introduced through the introduction of a recombinant vector, the recombinant vector may be composed of one or a plurality of vectors, the one or a plurality of vectors may be introduced into each microorganism, It is not limited.

In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. In addition, the recombinant plasmid vector may preferably use pACYCDuet, pCDFDuet and the like, but is not limited thereto.

Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication, including several to hundreds of plasmid vectors per host cell, and (b) host cells transformed with plasmid vectors. It has a structure that includes an antibiotic resistance gene that allows it to be used and a restriction enzyme cleavage site (c) into which foreign DNA fragments can be inserted. Although no suitable restriction enzyme cleavage site is present, synthetic oligonucleotide adapters or linkers according to conventional methods can be used to facilitate ligation of the vector and foreign DNA. After ligation, the vector should be transformed into the appropriate host cell. Transformation can be easily accomplished using calcium chloride method or electroporation or the like.

As is well known in the art, to raise the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host. Preferably, the expression control sequence and the gene of interest will be included in one recombinant vector containing the bacterial selection marker and the replication start point together.

In addition, in the present invention, the method comprises the steps of introducing a second recombinant vector comprising a mhact gene encoding an acetyl-CoA transferase (ACT) derived from Megasphaera sp. It may be characterized in that it further comprises.

In addition, the present invention comprises the steps of culturing the recombinant microorganism of the present invention; It provides a method for producing hexanoic acid comprising a.

The medium and other culture conditions used for the cultivation of the microorganism of the present invention may be any medium used for the cultivation of the microorganisms of the genus Escherichia, but the requirements of the microorganism of the present invention should be appropriately satisfied. Preferably, the microorganism of the present invention is cultured under aerobic conditions in a conventional medium containing a suitable carbon source, nitrogen source, amino acids, vitamins and the like while controlling the temperature, pH and the like.

The medium may include, as personnel, monopotassium phosphate, dipotassium phosphate and corresponding sodium-containing salts. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used, and other amino acids, vitamins, and appropriate precursors may be included. These media or precursors may be added batchwise or continuously to the culture. During the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture.

In addition, during the culture, antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection to maintain anaerobic and aerobic conditions. The temperature of the culture can usually be set at 27 ℃ to 37 ℃, preferably 30 ℃ to 35 ℃. The incubation period can continue until the desired amount of useful substance is obtained, preferably for 10 to 100 hours.

The hexanoic acid produced in the culturing step of the present invention may further comprise the step of purifying or recovering, the method for recovering the target protein from the microorganism or the culture is known in the art, such as centrifugation, filtration, Anion exchange chromatography, crystallization, HPLC and the like can be used, but are not limited to these examples. The recovery step may include a purification process, and those skilled in the art may select and utilize as needed from a variety of known purification processes.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the present invention is not limited to the contents of the present invention.

Material example

E. coli strains and plasmids used in the present invention are as shown in Table 1, oligonucleotides used in the present invention were synthesized in Macrogen (Daejeon, Korea), Cosmogenetech (Daejeon, Korea), Cosmogenetech (Daejeon, Korea) It is shown in Table 2 below. All genetic information used in the present invention is shown in Table 3 below.

Related property Strain Mach-T1 ^R F ^- φ80 ( lac Z) ΔM15 Δ lac X74 hsd R (r _K ^- m _K ⁺ ) Δ rec A1398 end A1 ton A W3110 F ^- λ ^- rph-1 IN ( rrnD , rrnE ) 1 JHL58 W3110 Δ atoDA Δ adhE Δ ldhA Δ paaFGH Δ frdABCD Δ pta P _atoB :: BBa_J23100 JHL26 JHL58 / pBASP SGK101 JHL58 / pBASP / pCDF-bktB SGK102 JHL58 / pACYC-crt-hbd-ter-mhact / pCDF-bktB SGK103 W3110ΔΔ atoDA Δ adhE Δ ldhA Δ paaFGH Δ frdABCD Δ pta Δ atoB SGK104 SGK103 / pACYC-crt-hbd-ter-mhact / pCDF-bktB-atoB-C SGK105 SGK103 / pACYC-crt-hbd-ter-mhact / pCDF-bktB-atoB-DR1 SGK106 SGK103 / pACYC-crt-hbd-ter-mhact / pCDF-bktB-atoB-DR2 SGK107 SGK103 / pACYC-crt-hbd-ter-mhact / pCDF-bktB-atoB-DR3 Plasmid pKD46 Red recombinase expression vector, Amp ^R pACYCDuet Expression vector, Cm ^R , p15A ori pCDFDuet Expression vector, Sm ^R , cloDF13 ori pACYC-SP _{pACYCDuet-P J23100 :: crt -P J23100} :: hbd -P J23100 :: ter pBASP _{pACYCDuet-P J23100 :: crt -P J23100} :: hbd -P J23100 :: ter -P J23100 :: tesB pACYC-crt-hbd-ter-mhact _{pACYCDuet-P J23100 :: crt -P J23100} :: hbd -P J23100 :: ter -P J23100 :: mhact pCDF-bktB pCDFDuet-P _J23100 :: bktB pCDF-bktB-atoB-C pCDFDuet-P _J23100 :: bktB -P _J23108 :: atoB -C pCDF-bktB-atoB-DR1 pCDFDuet-P _J23100 :: bktB -P _J23108 :: atoB -DR1 pCDF-bktB-atoB-DR2 pCDFDuet-P _J23100 :: bktB -P _J23108 :: atoB -DR2 pCDF-bktB-atoB-DR3 pCDFDuet-P _J23100 :: bktB -P _J23108 :: atoB -DR3

designation order (5′-3 ') ^{a, b, c, d} SEQ ID NO: atoB-del-F atcccttcatattcaattagttaaataactaaatccaataatctcattct ctagtgctggagcgaactgc 5 atoB-del-R cctgaccgccgccaatgcacagtgttgccagccccagcgttttatcgcgt ggagtactcgcggttgactg 6 ACT-F1 CTAGGTACAGTGCTAGCtttgcgtaactaaggagggtcacct atgtataaactgtcgcaaatcgctga 7 ACT-F2 gaatGAGCTC TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCtttgcgtaactaagg 8 ACT-R gccatcCATATGtttagtattccgtttttgaggttttcgt 9 bktB-F1 CTAGGTACAGTGCTAGCactgtaataagaaggaggggtgat atgacgcgtgaagtggtag 10 bktB-F2 gaatGCGGCCGC TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCactgtaataagaaggagggg 11 bktB-R gccatcCATATGtcagatacgctcgaagatgg 12 atoB-down-regulation-F1 gccatcCTCGAG CTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCccctcgggttaaaggtgcatagact atgaaaaattgtgtcatcgtcagtgcggta 13 atoB-down-regulation-F2 gccatcCTCGAG CTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCccctcgggttaaaggtgcatcgacg atgaaaaattgtgtcatcgtcagtgcggta 14 atoB-down-regulation-F3 gccatcCTCGAG CTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCccctcgggttaaaggtgcatagacg atgaaaaattgtgtcatcgtcagtgcggta 15 atoB-down-regulation-R gatggcTTAATTAAttaattcaaccgttcaatcaccatcgcaattcc 16 atoB-control-F gccatcCTCGAG CTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCcggcacccctacaaacagaaggaatataaa 17 atoB-genome-check-F gaacccgcactgctttaatgctgg 18 atoB-genome-check-R ggttaccttcgccgtcgatgttc 19 ACT-check-F cgtgagggtctgtactctgttaccatc 20 pACYC-check-F atctcgacgctctcccttatgcgact 21 pACYC-check-R ggttatgctagttattgctcagcggtggca 22 atoB-plasmid-check-F gccgccatcttcgagcgtatctgac 23 a: Italics indicate homologous recombination parts.
b: Lowercase, underlined indicates the redesigned 5 'UTR sequence.
c: Underlined uppercase letters indicate the promoter sequence.
d: Uppercase letters indicate restriction enzyme recognition sequences.

Gene (enzyme) origin SEQ ID NO: atoB (acetyl-CoA acetyltransferase) Esherichia coli W3110 24 bktB (β-ketothiolase) Cupriavidus necator 25 mhact (acetyl-CoA transferase) Megasphaera sp. MH 26 crt (Crotonase) Clostridium acetobutylicum 27 hbd (3-hydroxybutyryl-CoA dehydrogenase) Clostridium acetobutylicum 28 ter (trans-enoyl-CoA reductase) Treponema denticola 29 tesB (thioesterase) Esherichia coli W3110 30

Phusion DNA polmerase, Quick ligation and restriction enzymes were purchased from New England Biolabs (Beverly, MA, USA), and the amplified plasmids were collected using AccuPrep Nano-Plus Plasmid Mini Extraction kit (Bioneer, Daejeon, Korea). The amplified DNA fragments were purified using GeneAll Expin Gel SV kit (GeneAll Biotechnology, Seoul, Korea). Materials for all cultures were prepared by BD Biosciences (Sparks, MD, USA), and other chemicals such as acetic acid, butyric acid, hexanoic acid and reagents for atoB activity analysis were all used by Sigma-Aldrich (St. Louis, MO, USA).

In the present invention, the gene was introduced using pACYC-SP, pCDFDuet or pCDF-bktB plasmid, and genetic manipulation for gene overexpression and deletion on chromosome was performed using Red recombination system using pKD46 plasmid ( Datsenko & Wanner, 2000), wherein the overexpression was accomplished by replacing the promoter with a strong constitutive promoter (BBa_J23100) and using a redesigned 5'-UTR to maximize translation in E. coli.

Example

The present inventors produced a recombinant E. coli strain producing hexanoic acid with high efficiency by adjusting the hexanoic acid metabolic pathway as in Example 1.

Escherichia coli for the production of hexanoic acid coli ) strain W3110 (ATCC27325) was used, and the expression vectors prepared in Example 1 were introduced into E. coli and transformed, and then cultured in the same manner as follows.

Recombinant Escherichia coli contains TB (Terrific Broth) medium with glucose and antibiotics (12 g tryptone per liter, 24 g yeast extract, 4 mL glycerol, 2.31 g KH ₂ PO ₄ , 12.54 g K ₂ HPO ₄ , 20 g glucose, 40 mg streptomycin, 27 mg The culture was performed at 37 ° C. using a rotary shaker (250 rpm) using chloramphenicol). First, single colonies were inoculated into the medium and incubated overnight, and then the saturated medium was replaced with sterile medium. When the OD ₆₀₀ of the fresh medium reached 1.0, it was inoculated into a 300 mL flask (final OD ₆₀₀ 0.5) with 25 mL of sterile medium and 10 hours of 10M NaOH for 3 hours for the first 12 hours to calibrate the culture to 7.0. Every 6 hours after that. All experiments were repeated three times.

Absorbance was measured at 600 nm with a UV-1700 spectrophotometer to measure cell growth rate. In addition, in order to analyze the amount of carbon sources and metabolites present in the medium was measured by high-performance liquid chromatography (HPLC) method using UltiMate 3000 analytical HPLC systems (Dionex, Sunnyvale, CA, USA), where 5mM H ₂ SO ₄ was used as the mobile phase, the flow rate was set to 0.6 ml / min and the temperature of the oven to 14 ° C. Signals of carbon sources and metabolites were measured using a UV-VIS diode array detector (at 210 nm) and a RI-101 detector (Shodex, Klokkerfaldet, Denmark).

Example  One. Hexanoic acid  Preparation of Recombinant Vectors for Production

1-1. Hexanoic acid  In metabolic pathways to regulate production target  Genetic Identification

Butyryl-CoA is synthesized through a series of enzymatic actions catalyzed by the following enzymes: acetyl-CoA acetyltransferase ( atoB ), 3-hydroxybutyryl-CoA dehydrogenase (3-hydroxybutyryl-CoA dehydrogenase, hbd), crotonate tyrosinase (Crotonase, crt) and the trans-Ino one -CoA reductase (trans-enoyl-CoA reductase, ter). Butyric acid is synthesized by thioesterase ( tesB ). Given that all of the enzymes in the butyric acid biosynthetic pathway have activity on the C6 substrate, the only deficiency step in hexanoic acid synthesis is C2 and C4 to supply 3-ketohexanoyl-CoA, the C6 acyl-CoA intermediate. It will be called condensation process of acyl CoA precursor.

Cupriavidus necator ) -derived bktB is capable of producing C6 intermediates in Escherichia coli (Dekishima et al., 2011), and the SGK101 strain was produced by introducing the bktB gene derived from cupriavidus nekatore into JHL26 , a butyl acid producing strain. It was. Specifically, bktB gene was expressed using a strong promoter (BBa_J23100), and through UTR Designer (http://sbi.postech.ac.kr/utr_designer) to maximize expression at transcription and translation levels. A redesigned 5 'UTR (Untranslated region, 5'-ACTGTAATAAGAAGGAGGGGTGAT-3') was used.

As a result, the SGK101 strain was confirmed to produce 41.3 mg / L hexanoic acid in 36 hours. At the same time, however, the strain also produced 6.2 g / L of butyric acid. This means that C4 precursors, which could have been used for hexanoic acid production, were used for the production of butyl acid.

Next, SGK102 strain was prepared by further engineering SGK101 strain to replace the enzyme acting in the last step of the hexanoic acid metabolic pathway. Specifically, E. coli- derived tesB gene or Megasphaera sp. Catalyzes the last step of the pathway. Hexanoic acid production was measured by expressing MH- derived mhact gene. Mhact was Similarly, expressed in SGK102 strains were expressed in the tesB SGK101 strain was expressed by using the same redesigned 5 'UTR and the same promoter and tesB. When mhact was overexpressed in SGK102 strain, hexanoic acid production increased by 47% compared to SGK101, reaching up to 60.9 mg / L. Furthermore, butyric acid production was reduced by 79% in SGK102 compared to SGK101. The results confirm that the enzyme used in the final step plays an important role in determining the ratio and yield of the carboxylic acid product.

1-2. Hexanoic acid  Carbon flow redistribution for production control

Following identification of target genes in metabolic pathways for hexanoic acid production regulation, sophisticated redistribution of carbon flow was performed to maximize hexanoic acid synthesis. Specifically, acetyl-CoA and butyryl-CoA are combined equimolar to form 3-ketohexanoyl-CoA (C6), butyryl-CoA precursors acetyl-CoA Focusing on the synthesis, the route for redistribution in acetyl-CoA was designed to optimally distribute the precursor feed amount, which is shown in FIG.

As a result of the fermentation to verify the carboxylic acid production ability of the SGK102 strain prepared in Example 1-1, the carboxylic acid concentration (titer) of the SGK102 strain was 7.09g / L acetic acid and 1.27g / L butyl acid This indicates an imbalance resulting from excessive atoB overexpression. At this time, it was confirmed that ter activity is significantly lower than other enzymes. Thus, rather than inducing ter overexpression of hexanoic acid metabolic pathways, low expression of atoB could provide a balanced supply of precursors (acetyl-CoA and butyryl-CoA) and ultimately increase hexanoic acid production. It was thought.

1-3. Hexanoic acid  Biosynthetic Gene Expression System

The red recombinant system (Datsenko and Wanner, 2000) using the pkD46 vector knocked out atoB on the JHL58 strain chromosome to produce SGK103 strain, and the atoB-del- to target the atoB site of the chromosome in the JHL58 strain. DNA fragments comprising FRT - Kan ^R - FRT were amplified with F and atoB-del-R primer pairs and the amplified DNA fragments were recombined with the target site using the pkD46 vector.

Synthetic promoters (BBa_J23100,http://partsregistry.org) And a 5 'Untranslated region (UTR) redesigned through UTR Designer (Seo et al., Http://sbi.postech.ac.kr/utr_designer).Megasphaera sp.MH originmhact The gene was amplified using the ACT-F1 / ACT-F2 / ACT-R primers, and a second recombinant vector was prepared by inserting it into the pACYC-SP vector using SacI and NdeI. backboneClostridium acetobutylicum origincrt,hbd AndTreponema denticola originter Vector with genes).bktB Genes were amplified using bktB-F1 / bktB-F2 / bktB-R primers, and the amplified DNA fragments were inserted into pCDFDuet vectors using NotI and NdeI.

expression level of control of the synthetic promoter is atoB (BBa_J23108) and redesigned 5 'UTR was done by using, for 5 atoB to low expression' UTR variant are atoB-down-regulation-F ( 1-3) / atoB-down Genomic DNA of wild-type E. coli W3110 strain was PCR amplified using the -regulation-R primer set (atoB-DR1-3) and the atoB-control-F / atoB-down-regulation-R primer set (atoB-C). . The amplified DNA fragments were inserted into pCDF-bktB vector using XhoI and PacI to prepare a first recombinant vector. Specifically, 5 'UTR was redesigned using UTR Designer to low expression of atoB gene. First, it was named the 5 'UTR of overexpressing atoB to atoB-C. The sequence of atoB-C is identical to the 5 'UTR chromosome gene of atoB expressed in SGK102 strain (Lim et al., 2013b). Next, three 5 'UTRs that express the atoB gene with different intensities were named atoB-DR1, atoB-DR2 and atoB-DR3, respectively. E. coli strains were transformed with the prepared plasmids to produce different recombinant E. coli strains showing a specific level of atoB activity (SGK104: atoB overexpression; SGK 105, 106, 107: atoB low expression). The 5 'UTR sequences used are shown in Table 4 below.

gene synthesis 5'UTR  Sequence (5'-3 ') Expected Expression (a.u.) Actual enzyme activity
( μmol / Min / mg) SEQ ID NO: atoB-C cggcacccctacaaacagaaggaatataaa 332085.81 81.40 ±± 4.07 One atoB-DR1 ccctcgggttaaaggtgcatagact 6501.41 33.22 ±± 0.67 2 atoB-DR2 ccctcgggttaaaggtgcatcgacg 1248.68 14.68 ±± 1.02 3 atoB-DR3 ccctcgggttaaaggtgcatagacg 1085.74 3.39 ±± 0.86 4

Example  2. Analysis of enzyme activity of each strain

2-1. atoB  Activity analysis

Acetoacetyl-CoA cleavage was performed to measure atoB enzyme activity of each strain prepared in Examples 1-3 (Hartmanis and Gatenbeck, 1984; Stern, 1956; Shen et al., 2011). Cells in the mid-exponential phase were used and cells were disrupted using Bug Buster Master Mix (EMD Bioscience, San Diego, Calif., USA). Total protein concentration was measured by Bradford assay (Bio-Rad Protein Assay Dye; Bio-Rad, Hercules, CA, USA) using BSA (Bovine Serum Albumin) as a standard, and atoB enzyme activity was measured by UV-1700 spectrophotometer (Shimadzu). , Kyoto, Japan) was measured by analyzing the absorbance at 303 nm wavelength. The reaction mixture included 100 mM Tris-HCl (pH 8.0), 10 mM MgSO ₄ , 200 μM acetoacetyl-CoA, 200 μM CoA and cell lysate, and the reaction was started by adding cell lysate to the reaction mixture.

2-2. hbd , crt , ter  Activity analysis

Cell extracts for all enzyme activity assays were prepared in the same manner as cell extracts for atoB activity assays of Example 2-1. First, the absorbance at the wavelength of 340 nm was measured to measure the activity of hbd . The reaction mixture comprises 100 mM MOPS (pH 7.0), 200 μm acetoacetyl-CoA and cell extracts. Next, the absorbance at the wavelength of 263 nm was measured to measure the activity of crt . The reaction mixture comprises 100 mM Tris-HCl (pH 7.6), 100 μm crotonyl-CoA and cell extract. Finally, the absorbance at the wavelength of 340 nm was measured to determine the activity of ter . The reaction mixture comprises 100 mM potassium phosphate buffer (pH 6.2), 200 μm NADH, 200 μm crotonyl-CoA and cell extracts. The reaction was started by adding the extract.

Enzyme activity measurement results of each strain performed in Examples 2-1 and 2-2 are shown in Figure 1 (b). As shown in (b) of FIG. 1, it was confirmed that the atoB activity was the highest in SGK104 and the atoB activity was decreased toward SGK105, SGK106, and SGK107 by using the redesigned 5 'UTR. In addition, in all strains, ter activity was found to be significantly lower than other enzymes.

Example  3. Each strain Carboxylic acid  Production Profile Analysis

3-1. SGK104 , SGK105 , SGK106

The carboxylic acid production profile of each strain prepared in Examples 1-3 was analyzed and compared with the amount of intracellular CoA metabolites (hexatabolites) as hexanoic acid precursors.

Specifically, intracellular CoA metabolites were extracted by intracellular acetyl-CoA, butyryl-CoA, and hexanoyl-CoA using a fast filtration method, followed by LC / MS analysis. First, each strain was inoculated into the medium, and after 24 hours, 5 ml of the culture was collected. Cells were collected by vacuum filtration using a nylon membrane filter (0.20 μm pore size; Whatman; Piscataway, NJ, USA), which was washed at room temperature with 5 ml of distilled water. The cell adsorbed membrane filter was mixed with 5 ml of acetonitrile / water (mixed 1: 1, v / v) at -20 ° C to extract the metabolite. The mixture was quenched using liquid nitrogen to prevent further metabolite changes, and all of the above procedures were completed within 30 seconds. The cooled extract mixture was dissolved on ice, vortexed for 3 minutes, then centrifuged at 16,100 xg for 5 minutes at 4 ° C, and the supernatant was collected and vacuum dried.

The dried metabolite was then resuspended in 200 μl water, and the extracted CoA metabolite using a Q-Exactive mass spectrometer (Thermo Fisher Scientific) using Ultimate 3000 (Thermo SCIENTIFIC) UHPLC and HESI (Heated ElectroSpray Ionization) source. The analysis was performed. 10 μl of sample was injected and separated on an ACQUITY UPLC HSS T3 1.8 μm column (150 mm × 2.1 mm × 1.8 μm). The temperature of the column was 35 ° C., 10 mM tributylamine and 15 mM acetic acid were used as mobile phase A, and methanol was used as mobile phase B (flow rate 0.25 ml / min). Concentration gradients were analyzed by setting: 0 min, 97% A and 3% B and 15 min, 25% A and 75% B. The results are shown in FIG.

As shown in (a) to (b) of FIG. 2, acetic acid production decreased as atoB expression decreased, while butyl acid production increased. In addition, as shown in (d) and (e) of FIG. 2, the results were consistent with the amounts of intracellular precursors (acetyl-CoA and butyryl-CoA).

Furthermore, as shown in (c) of FIG. 2, when the atoB activity was excessively high, the hexanoic acid concentration (titer) was low (60 mg / L, SGK104), and when the atoB activity was decreased, it was significantly increased. (582 mg / L, SGK106). As shown in Figure 2 (f), the results were consistent with the amount of hexanoyl-CoA in the cell.

In particular, the SGK106 strain produced 528 mg / L of hexanoic acid in 36 hours, which is an 8.7-fold increase compared to the concentration without atoB expression. In addition, the hexanoic acid production yield of SGK106 is significantly higher compared to previous studies (Kim et al., 2015; Machado et al., 2012; Volker et al., 2014) that performed fermentation using similar inoculum doses. 14.7 mg / L / H.

3-2. SGK107

It is thought that lower expression of atoB could increase the production of hexanoic acid even more. Thus, the same experiment was carried out using the recombinant strain SGK107 introduced with atoB-DR3, a 5 'UTR, which was redesigned to give the lowest expression of atoB. Was performed. The results are shown in FIG.

As shown in (a) to (f) of FIG. 2, the strain produced less acetic acid and increased butyric acid than the SGK106 strain. However, it was confirmed that hexanoic acid production was lower than SGK104 overexpressing atoB . The results indicate that atoB expression is lower than an appropriate level, so that an imbalance between acetyl-CoA and butyryl-CoA is caused when acetyl-CoA is supplied in a limited manner. All in all, that results from the atoB is possible to increase the acid yield hexanoate as the rate of acetyl -CoA and butyryl -CoA, and not simply to reduce the expression level of the atoB finely regulate the expression of atoB It was confirmed. Specifically, it was confirmed that the 5 'UTR should be designed such that the predicted expression amount (au) of the atoB gene is at least 1,100 or more and 300,000 or less.

Example a via, in the case of using the hexanoate acid production control method of the present invention according to the sophisticated atoB expression level control of a recombinant E. coli, hexanoate as a precursor redistribution in acid metabolic pathway can be markedly increased hexanoate acid production It was confirmed that there is.

Although the present invention has been described as the preferred embodiment mentioned above, it is possible to make various modifications or variations without departing from the spirit and scope of the invention. The appended claims also cover such modifications and variations as fall within the spirit of the invention.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION          IUCF-HYU (Industry-University Cooperation Foundation Hanyang University) <120> HEXANOIC ACID-PRODUCING RECOMBINANT MICROORGANISM AND METHOD OF          PRODUCING HEXANOIC ACID USING THE SAME <130> POSTECH1-54P <160> 30 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> atoB-C <400> 1 cggcacccct acaaacagaa ggaatataaa 30 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> atoB-DR1 <400> 2 ccctcgggtt aaaggtgcat agact 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> atoB-DR2 <400> 3 ccctcgggtt aaaggtgcat cgacg 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> atoB-DR3 <400> 4 ccctcgggtt aaaggtgcat agacg 25 <210> 5 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> atoB-del-F <400> 5 atcccttcat attcaattag ttaaataact aaatccaata atctcattct ctagtgctgg 60 agcgaactgc 70 <210> 6 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> atoB-del-R <400> 6 cctgaccgcc gccaatgcac agtgttgcca gccccagcgt tttatcgcgt ggagtactcg 60 cggttgactg 70 <210> 7 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> ACT-F1 <400> 7 ctaggtacag tgctagcttt gcgtaactaa ggagggtcac ctatgtataa actgtcgcaa 60 atcgctga 68 <210> 8 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> ACT-F2 <400> 8 gaatgagctc ttgacggcta gctcagtcct aggtacagtg ctagctttgc gtaactaagg 60                                                                           60 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> ACT-R <400> 9 gccatccata tgtttagtat tccgtttttg aggttttcgt 40 <210> 10 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> bktB-F1 <400> 10 ctaggtacag tgctagcact gtaataagaa ggaggggtga tatgacgcgt gaagtggtag 60                                                                           60 <210> 11 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> bktB-F2 <400> 11 gaatgcggcc gcttgacggc tagctcagtc ctaggtacag tgctagcact gtaataagaa 60 ggagggg 67 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> bktB-R <400> 12 gccatccata tgtcagatac gctcgaagat gg 32 <210> 13 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> atoB-down-regulation-F1 <400> 13 gccatcctcg agctgacagc tagctcagtc ctaggtataa tgctagcccc tcgggttaaa 60 ggtgcataga ctatgaaaaa ttgtgtcatc gtcagtgcgg ta 102 <210> 14 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> atoB-down-regulation-F2 <400> 14 gccatcctcg agctgacagc tagctcagtc ctaggtataa tgctagcccc tcgggttaaa 60 ggtgcatcga cgatgaaaaa ttgtgtcatc gtcagtgcgg ta 102 <210> 15 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> atoB-down-regulation-F3 <400> 15 gccatcctcg agctgacagc tagctcagtc ctaggtataa tgctagcccc tcgggttaaa 60 ggtgcataga cgatgaaaaa ttgtgtcatc gtcagtgcgg ta 102 <210> 16 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> atoB-down-regulation-R <400> 16 gatggcttaa ttaattaatt caaccgttca atcaccatcg caattcc 47 <210> 17 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> atoB-down-control-F <400> 17 gccatcctcg agctgacagc tagctcagtc ctaggtataa tgctagccgg cacccctaca 60 aacagaagga atataaa 77 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> atoB-genome-check-F <400> 18 gaacccgcac tgctttaatg ctgg 24 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> atoB-genome-check-R <400> 19 ggttaccttc gccgtcgatg ttc 23 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> 223 ACT-check-F <400> 20 cgtgagggtc tgtactctgt taccatc 27 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pACYC-check-F <400> 21 atctcgacgc tctcccttat gcgact 26 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pACYC-check-R <400> 22 ggttatgcta gttattgctc agcggtggca 30 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> atoB-plasmid-check-F <400> 23 gccgccatct tcgagcgtat ctgac 25 <210> 24 <211> 1185 <212> DNA <213> Artificial Sequence <220> <223> atoB <400> 24 atgaaaaatt gtgtcatcgt cagtgcggta cgtactgcta tcggtagttt taacggttca 60 ctcgcttcca ccagcgccat cgacctgggg gcgacagtaa ttaaagccgc cattgaacgt 120 gcaaaaatcg attcacaaca cgttgatgaa gtgattatgg gtaacgtgtt acaagccggg 180 ctggggcaaa atccggcgcg tcaggcactg ttaaaaagcg ggctggcaga aacggtgtgc 240 ggattcacgg tcaataaagt atgtggttcg ggtcttaaaa gtgtggcgct tgccgcccag 300 gccattcagg caggtcaggc gcagagcatt gtggcggggg gtatggaaaa tatgagttta 360 gccccctact tactcgatgc aaaagcacgc tctggttatc gtcttggaga cggacaggtt 420 tatgacgtaa tcctgcgcga tggcctgatg tgcgccaccc atggttatca tatggggatt 480 accgccgaaa acgtggctaa agagtacgga attacccgtg aaatgcagga tgaactggcg 540 ctacattcac agcgtaaagc ggcagccgca attgagtccg gtgcttttac agccgaaatc 600 gtcccggtaa atgttgtcac tcgaaagaaa accttcgtct tcagtcaaga cgaattcccg 660 aaagcgaatt caacggctga agcgttaggt gcattgcgcc cggccttcga taaagcagga 720 acagtcaccg ctgggaacgc gtctggtatt aacgacggtg ctgccgctct ggtgattatg 780 gaagaatctg cggcgctggc agcaggcctt acccccctgg ctcgcattaa aagttatgcc 840 agcggtggcg tgccccccgc attgatgggt atggggccag tacctgccac gcaaaaagcg 900 ttacaactgg cggggctgca actggcggat attgatctca ttgaggctaa tgaagcattt 960 gctgcacagt tccttgccgt tgggaaaaac ctgggctttg attctgagaa agtgaatgtc 1020 aacggcgggg ccatcgcgct cgggcatcct atcggtgcca gtggtgctcg tattctggtc 1080 acactattac atgccatgca ggcacgcgat aaaacgctgg ggctggcaac actgtgcatt 1140 ggcggcggtc agggaattgc gatggtgatt gaacggttga attaa 1185 <210> 25 <211> 1185 <212> DNA <213> Artificial Sequence <220> <223> bktB <400> 25 atgacgcgtg aagtggtagt ggtaagcggt gtccgtaccg cgatcgggac ctttggcggc 60 agcctgaagg atgtggcacc ggcggagctg ggcgcactgg tggtgcgcga ggcgctggcg 120 cgcgcgcagg tgtcgggcga cgatgtcggc cacgtggtat tcggcaacgt gatccagacc 180 gagccgcgcg acatgtatct gggccgcgtc gcggccgtca acggcggggt gacgatcaac 240 gcccccgcgc tgaccgtgaa ccgcctgtgc ggctcgggcc tgcaggccat tgtcagcgcc 300 gcgcagacca tcctgctggg cgataccgac gtcgccatcg gcggcggcgc ggaaagcatg 360 agccgcgcac cgtacctggc gccggcagcg cgctggggcg cacgcatggg cgacgccggc 420 ctggtcgaca tgatgctggg tgcgctgcac gatcccttcc atcgcatcca catgggcgtg 480 accgccgaga atgtcgccaa ggaatacgac atctcgcgcg cgcagcagga cgaggccgcg 540 ctggaatcgc accgccgcgc ttcggcagcg atcaaggccg gctacttcaa ggaccagatc 600 gtcccggtgg tgagcaaggg ccgcaagggc gacgtgacct tcgacaccga cgagcacgtg 660 cgccatgacg ccaccatcga cgacatgacc aagctcaggc cggtcttcgt caaggaaaac 720 ggcacggtca cggccggcaa tgcctcgggc ctgaacgacg ccgccgccgc ggtggtgatg 780 atggagcgcg ccgaagccga gcgccgcggc ctgaagccgc tggcccgcct ggtgtcgtac 840 ggccatgccg gcgtggaccc gaaggccatg ggcatcggcc cggtgccggc gacgaagatc 900 gcgctggagc gcgccggcct gcaggtgtcg gacctggacg tgatcgaagc caacgaagcc 960 tttgccgcac aggcgtgcgc cgtgaccaag gcgctcggtc tggacccggc caaggttaac 1020 ccgaacggct cgggcatctc gctgggccac ccgatcggcg ccaccggtgc cctgatcacg 1080 gtgaaggcgc tgcatgagct gaaccgcgtg cagggccgct acgcgctggt gacgatgtgc 1140 attggcggcg ggcagggcat tgccgccatc ttcgagcgta tctga 1185 <210> 26 <211> 1359 <212> DNA <213> Artificial Sequence <220> <223> Mhact <400> 26 atgtataaac tgtcgcaaat cgctgaagaa tatcagaaaa aactggttac gccgcaagaa 60 gctgccgctg tcgtgaaatc gggtgaccgt gttagctatg gcctgggttg ctcggcaccg 120 tacgatacgg acaaagcgct ggccgatcat attaacaaag atggcctgaa agacgtggaa 180 attatcgatg cgaccctgat ccaggaccac ccgtttttca cctatacgga aaccgaaagc 240 aatgatcaag tccgctttgt gtctggccat tttaacggtt tcgaccgtaa aatgaataaa 300 gccggtcgct gttggtttat gccgctgctg ttcaacgaac tgccgaaata ctggagccat 360 aagaaagtgg atgttgcaat ttttcaggtt cacccgatgg acaaatgggg caacttcaat 420 ctgggtccgc aagtcgcaga tctgcgtggc attctgaaaa gtgctgacaa agtcatcgtg 480 gaagttaacc agaaaatgcc gaaagcgctg ggctatgaaa ccgaactgaa tattgccgat 540 gtggacttta tcgttgaagg ttctaacccg gatatgccga ttgtgccgaa taaaccgagt 600 acgccggttg atgacaaaat tgcgtccttc gtggttccga tgatcaaaga tggctcaacc 660 ctgcaactgg gtattggcgg tatcccgtcg gcgatcggcc ataaactggc cgaaagcgat 720 gttaaagacc tgtctggtca cacggaaatg ctggtcgatc cgtatgtgga actgtacgaa 780 gcaggcaaaa ttaccggcaa gaaaaaccgt gatcgcggca aaatcatgta tacgtttgct 840 ggcggtaccc agcgtctgta cgactttatt gatgacaatc aaatcgtgtt caacgcgccg 900 gttaattatg tcaacaatat taacgtcgtg gccagcatcg ataatttcgt cagcattaac 960 tcttgcatca atctggacct gtatggtcaa gtgtgtgcgg aaagtgccgg ctaccgccac 1020 atttccggta ccggcggtgc gctggatttt gcacagggcg cttacctgag cgaaggcggt 1080 caaggtttca tttgcgttca ttctacccgt aaactgaaag atggcagtct ggaatccctg 1140 atccgtccga cgctgacgcc gggcagcgtg gtcaccacgc cgcgctcggc agttcactat 1200 attgtcacgg aatacggcgt ggctctgctg aaaggccagt ccacctggca acgtgcagaa 1260 gctctgatta atatcgccca tccggatttt cgcgaagaac tgattaaaga agcggaaaaa 1320 atgggcatct ggacgaaaac ctcaaaaacg gaatactaa 1359 <210> 27 <211> 786 <212> DNA <213> Artificial Sequence <220> <223> Crt <400> 27 atggaactaa acaatgtcat ccttgaaaag gaaggtaaag ttgctgtagt taccattaac 60 agacctaaag cattaaatgc gttaaatagt gatacactaa aagaaatgga ttatgttata 120 ggtgaaattg aaaatgatag cgaagtactt gcagtaattt taactggagc aggagaaaaa 180 tcatttgtag caggagcaga tatttctgag atgaaggaaa tgaataccat tgaaggtaga 240 aaattcggga tacttggaaa taaagtgttt agaagattag aacttcttga aaagcctgta 300 atagcagctg ttaatggttt tgctttagga ggcggatgcg aaatagctat gtcttgtgat 360 ataagaatag cttcaagcaa cgcaagattt ggtcaaccag aagtaggtct cggaataaca 420 cctggttttg gtggtacaca aagactttca agattagttg gaatgggcat ggcaaagcag 480 cttatattta ctgcacaaaa tataaaggca gatgaagcat taagaatcgg acttgtaaat 540 aaggtagtag aacctagtga attaatgaat acagcaaaag aaattgcaaa caaaattgtg 600 agcaatgctc cagtagctgt taagttaagc aaacaggcta ttaatagagg aatgcagtgt 660 gatattgata ctgctttagc atttgaatca gaagcatttg gagaatgctt ttcaacagag 720 gatcaaaagg atgcaatgac agctttcata gagaaaagaa aaattgaagg cttcaaaaat 780 agatag 786 <210> 28 <211> 849 <212> DNA <213> Artificial Sequence <220> <223> Hbd <400> 28 atgaaaaagg tatgtgttat aggtgcaggt actatgggtt caggaattgc tcaggcattt 60 gcagctaaag gatttgaagt agtattaaga gatattaaag atgaatttgt tgatagagga 120 ttagatttta tcaataaaaa tctttctaaa ttagttaaaa aaggaaagat agaagaagct 180 actaaagttg aaatcttaac tagaatttcc ggaacagttg accttaatat ggcagctgat 240 tgcgatttag ttatagaagc agctgttgaa agaatggata ttaaaaagca gatttttgct 300 gacttagaca atatatgcaa gccagaaaca attcttgcat caaatacatc atcactttca 360 ataacagaag tggcatcagc aactaaaaga cctgataagg ttataggtat gcatttcttt 420 aatccagctc ctgttatgaa gcttgtagag gtaataagag gaatagctac atcacaagaa 480 acttttgatg cagttaaaga gacatctata gcaataggaa aagatcctgt agaagtagca 540 gaagcaccag gatttgttgt aaatagaata ttaataccaa tgattaatga agcagttggt 600 atattagcag aaggaatagc ttcagtagaa gacatagata aagctatgaa acttggagct 660 aatcacccaa tgggaccatt agaattaggt gattttatag gtcttgatat atgtcttgct 720 ataatggatg ttttatactc agaaactgga gattctaagt atagaccaca tacattactt 780 aagaagtatg taagagcagg atggcttgga agaaaatcag gaaaaggttt ctacgattat 840 tcaaaataa 849 <210> 29 <211> 1194 <212> DNA <213> Artificial Sequence <220> <223> Ter <400> 29 atgatcgtca agccaatggt gcgcaataat atctgtctga acgctcaccc gcagggttgt 60 aaaaagggtg tagaagacca gattgaatac actaagaaac gcatcaccgc agaagttaaa 120 gcaggtgcca aagcaccgaa aaacgtcctg gtgctgggct gcagcaacgg ctacggtctg 180 gcaagccgca ttacggctgc attcggttac ggcgctgcta ctattggtgt tagcttcgaa 240 aaggcgggtt ctgaaaccaa atacggcact ccaggctggt acaacaacct ggcattcgac 300 gaagcagcga agcgtgaggg tctgtactct gttaccatcg acggtgacgc gttctctgac 360 gagatcaaag ctcaggttat cgaggaagct aaaaagaaag gtatcaaatt cgacctgatt 420 gtgtactccc tggcctctcc ggttcgtacc gacccggata ccggcatcat gcacaaaagc 480 gtactgaagc cgtttggcaa aaccttcact ggtaaaaccg ttgatccttt caccggcgag 540 ctgaaggaaa tctccgccga gccagctaac gatgaggagg ctgctgcgac cgttaaagtg 600 atgggtggcg aagactggga acgttggatc aaacaactgt ccaaggaagg tctgctggag 660 gagggctgta ttactctggc atattcttac atcggcccgg aggcgactca ggcactgtat 720 cgtaagggca ccatcggtaa agcgaaagaa catctggagg ccaccgctca ccgtctgaac 780 aaggaaaacc cgagcatccg tgctttcgtg tccgttaaca agggcctggt tacgcgcgct 840 tccgcagtaa ttccggtcat tccgctgtac ctggcttccc tgtttaaagt catgaaagaa 900 aaaggcaacc acgaaggttg tatcgaacaa attactcgcc tgtatgcgga gcgcctgtac 960 cgtaaggatg gcactatccc ggttgatgaa gagaaccgca tccgcattga cgattgggaa 1020 ctggaagagg atgtacagaa agcggtttcc gcgctgatgg aaaaagtgac gggcgaaaac 1080 gcggaatccc tgacggatct ggcaggttac cgtcacgact ttctggcgtc taatggtttc 1140 gacgttgagg gtattaacta cgaggcagaa gttgaacgtt tcgatcgtat ttaa 1194 <210> 30 <211> 861 <212> DNA <213> Artificial Sequence <220> <223> tesB <400> 30 atgagtcagg cgctaaaaaa tttactgaca ttgttaaatc tggaaaaaat tgaggaagga 60 ctctttcgcg gccagagtga agatttaggt ttacgccagg tgtttggcgg ccaggtcgtg 120 ggtcaggcct tgtatgctgc aaaagagacc gtccctgaag agcggctggt acattcgttt 180 cacagctact ttcttcgccc tggcgatagt aagaagccga ttatttatga tgtcgaaacg 240 ctgcgtgacg gtaacagctt cagcgcccgc cgggttgctg ctattcaaaa cggcaaaccg 300 attttttata tgactgcctc tttccaggca ccagaagcgg gtttcgaaca tcaaaaaaca 360 atgccgtccg cgccagcgcc tgatggcctc ccttcggaaa cgcaaatcgc ccaatcgctg 420 gcgcacctgc tgccgccagt gctgaaagat aaattcatct gcgatcgtcc gctggaagtc 480 cgtccggtgg agtttcataa cccactgaaa ggtcacgtcg cagaaccaca tcgtcaggtg 540 tggatccgcg caaatggtag cgtgccggat gacctgcgcg ttcatcagta tctgctcggt 600 tacgcttctg atcttaactt cctgccggta gctctacagc cgcacggcat cggttttctc 660 gaaccgggga ttcagattgc caccattgac cattccatgt ggttccatcg cccgtttaat 720 ttgaatgaat ggctgctgta tagcgtggag agcacctcgg cgtccagcgc acgtggcttt 780 gtgcgcggtg agttttatac ccaagacggc gtactggttg cctcgaccgt tcaggaaggg 840 gtgatgcgta atcacaatta a 861

Claims (11)

A synthetic 5 'UTR (untranslated region) consisting of the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 and an atoB gene encoding an acetyl-CoA acetyltransferase represented by SEQ ID NO: 24 1 recombinant vector.
The first recombinant vector according to claim 1, wherein the synthetic 5 'UTR is designed such that the predicted expression amount (au) of the atoB gene is 1,100 or more and 300,000 or less.
delete The first recombinant vector of claim 1, wherein the first recombinant vector further comprises a bktB gene encoding beta-ketothiolase.
A recombinant microorganism for producing hexanoic acid into which the first recombinant vector of any one of claims 1, 2 and 4 is introduced,
The microorganism is E. coli, characterized in that the recombinant microorganism for hexanoic acid production.
The method of claim 5, wherein the recombinant microorganism is a second recombinant vector containing a mhact gene encoding acetyl-CoA transferase (ACT) derived from Megasphaera sp. Characterized in that, a recombinant microorganism for hexanoic acid production.
The method of claim 6, wherein the second recombinant vector is crotonate tyrosinase crt gene, encoding a (Crotonase) 3- hydroxy-butyryl -CoA hbd gene encoding a dehydrogenase (3-hydroxybutyryl-CoA dehydrogenase) and trans- Recombinant microorganisms for hexanoic acid production, characterized in that it further comprises a ter gene encoding a trans- enoyl-CoA reductase.
delete Introducing a first recombinant vector of any one of claims 1, 2 and 4; As a method for producing a recombinant microorganism for hexanoic acid production, including
The microorganism is characterized in that E. coli, hexanoic acid production method for producing a recombinant microorganism.
The method of claim 9, wherein the method comprises: introducing a second recombinant vector comprising a mhact gene encoding an acetyl-CoA transferase (ACT) derived from Megasphaera sp. Method for producing a recombinant microorganism for hexanoic acid production, characterized in that it further comprises.
Culturing the recombinant microorganism of claim 5; Hexanoic acid production method comprising a.

Images