KR101921678B1 - An engineered cell having improved serine biosynthesis ability - Google Patents

Abstract

The present invention relates to a method for producing an enzyme involved in the production of methyltetrahydrofolate from a gene encoding an enzyme involved in methionine production from homocysteine and / or an enzyme involved in the production of methyltetrahydrofolate from methylene tetrahydrofolate in a cell having a tetrahydrofolate C1 metabolic circuit The present invention relates to a mutant cell in which the expression of a gene is inhibited or reduced. When the mutant cell is cultured, the biosynthesis of intracellular serine is increased and the production of acetyl-CoA and pyruvic acid mediated thereon can be increased. It is possible to synthesize various high value-added compounds as a product.

Description

An engineered cell having improved serine biosynthesis ability

TECHNICAL FIELD The present invention relates to a mutant cell having improved serine biosynthesis ability, and more particularly, to a mutant cell in which a gene encoding an enzyme involved in methionine production from homocysteine and / or methylene tetrahydrofolate The expression of a gene coding for an enzyme involved in the production of methyltetrahydrofolate is suppressed or decreased and the serine biosynthesis ability is improved.

As demand for petroleum dependency and greenhouse gas reduction increases worldwide, demand for the development of technologies for the production of transport fuels and basic chemical materials based on C1 gas is increasing rapidly. C1 gas is a carbon (C) the number of first individual methane (CH ₄₎ gas and other carbon (C) the number of first individual carbon monoxide (CO) or carbon dioxide (CO ₂₎ derived from the synthesis gas, biogas and shale gas, such as natural gas (HCOOH). In recent years, countries including USA, Europe, China, and other countries have been studying biological, chemical, and biological activities to convert C1 gas derived from shale gas into useful compounds. We are investing vast budgets to study chemical methods.

The development of the original gas refinery technology for the recycling of greenhouse gas and by-product gas can be advantageous in securing global price competitiveness of basic chemical materials and creating a growth engine for the chemical industry. As such, a C1 metabolism circuit of a living organism can be utilized as a useful means for recycling the C1 gas. Most organisms use a tetrahydrofolate circuit for one carbon metabolism. Metabolism of tetrahydrofolate C1 is linked to serine cycle, nucleic acid methylation, methionine cycle and the like, and the metabolic circuit plays an important role in C1 migration, such as induction of methylation of the metabolite in living body through the metabolic circuit It is known. That is, since the C1 metabolism circuit and the serine cycle connected to the metabolism circuit are connected to the central metabolism for biosynthesis of useful compounds such as acetylcoe and pyruvic acid, useful compounds can be synthesized with high efficiency when the metabolism circuit is appropriately utilized. However, techniques for efficiently producing useful compounds by using such metabolic circuits have not yet been developed. Therefore, in the art, there is a desperate need for a technique for synthesizing useful compounds using the metabolic circuits.

Accordingly, the inventors of the present invention have been able to improve the serine production ability in the C1 metabolism circuit as a result of studying the C1 metabolic regulation research in order to develop a mutant capable of producing a useful compound with high efficiency using the C1 metabolism circuit. Specifically, 1) Knocking down a gene encoding an enzyme involved in methionine production, 2) knocking down a gene encoding an enzyme involved in methyltetrahydrofolate production from methylene tetrahydrofolate, or 3) knocking down both genes The inventors confirmed that the production of serine in the C1 metabolism of the knockdown microorganism was markedly increased and completed the invention.

It is an object of the present invention to provide a mutant cell having increased serine biosynthesis.

It is another object of the present invention to provide a method for increasing serine synthesis in a cell having a tetrahydrofolate C1 metabolic circuit.

It is yet another object of the present invention to provide a method for producing a serine-mediated useful substance in a cell having a tetrahydrofolate C1 metabolism circuit.

In order to achieve the above object, the present invention provides a method for producing methyltetrahydrofolate from a gene encoding an enzyme involved in methionine production from homocysteine and / or a gene encoding methyltetrahydrofolate from methylene tetrahydrofolate in a cell having a tetrahydrofolate C1 metabolic circuit Wherein the expression of the gene encoding the enzyme involved in the expression of the gene is suppressed or reduced.

The present invention also provides a method for synthesizing serine, comprising culturing said mutated cells.

(A) culturing the mutant cell to produce a serine-mediated useful substance; And (b) recovering the resultant useful substance. The present invention also provides a method for producing a useful substance mediated by serine.

The present invention provides a mutant cell in which serine biosynthesis is increased by regulating the expression level of a specific gene encoding an enzyme involved in the C1 metabolic pathway. When the mutant cell is cultured, the biosynthesis of intracellular serine is increased, It is possible to increase the production of acetyl-CoA and pyruvic acid mediated by it, and it is possible to synthesize various high-value-added compounds as intermediate products thereof.

Figure 1 shows the pathway in which inhibition or reduction of the expression of enzymes involved in the production of methyltetrahydrofolate from methylene tetrahydrofolate is blocked in the tetrahydrofolate C1 metabolism circuit.
Figure 2 shows the pathway in which the expression of enzymes involved in the production of methionine from homocysteine is inhibited or reduced and blocked in the tetrahydrofolate C1 metabolic circuit.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The present inventors have found that when the expression of a gene encoding an enzyme involved in methionine production from homocysteine is regulated or the expression of a gene encoding an enzyme involved in methyltetrahydrofolate production from methylene tetrahydrofolate is controlled, It was confirmed that the serine biosynthesis pattern was changed in the C1 metabolism circuit and serine biosynthesis was increased particularly when the expression of any one of the two enzymes was suppressed or decreased.

In the present invention, the tetrahydrofolate C1 metabolism circuit is a circulation type metabolic circuit as shown in FIG. 1 or FIG. 2, in which a formulated molecule meets with tetrahydrofolate to formyl-tetrahydrofolate (Formyl-THF) In a pathway that metabolizes tetrahydrofolate via methyl-tetrahydrophthalate (Methylen-THF), methylene-tetrahydrofolate (Methylen-THF) and methyl- tetrahydrofolate, homocysteine is converted to methionine , And glycine (Glycine) to serine (serine).

Therefore, the present invention relates to a method for producing methyltetrahydrofolate from a gene encoding an enzyme involved in methionine production from homocysteine and / or from methylene tetrahydrofolate in a cell having a tetrahydrofolate C1 metabolic circuit in one aspect The expression of the gene encoding the enzyme is inhibited or reduced.

In the present invention, the enzyme involved in methionine production from homocysteine is methionine synthase, and the enzyme involved in methyltetrahydrofolate production from methylene tetrahydrofolate is methylene-tetrahydrofolate-reductase methylene-THF reductase, but are not limited thereto.

In the present invention, the gene coding for methionine synthase is metH represented by the nucleotide sequence of SEQ ID NO: 5, and the gene coding for methylene-tetrahydrofolate-methylene-THF reductase May be metF , which is represented by the nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.

In the present invention, the mutant cell may be characterized in that serine biosynthesis is increased.

In the present invention, the cell having the tetrahydrofolate C1 metabolic circuit may be derived from any one selected from the group consisting of bacteria, yeast, fungi, plant cells, animal cells, algae and microalgae.

The cell having the tetrahydrofolate C1 metabolic circuit may preferably be a bacterium and the bacterium is selected from the group consisting of a methanogenic bacterium, a methanogenic bacterium, an acetone, an Escherichia coli, a Corynebacterium, a crab cilia, a yeast, But are not limited to, Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, But are not limited to, Clostridium perfringens, Clostridium tetani, Clostridium difficile, Clostridium butyricum, Clostridium butylicum, , Clostridium kluyveri, Clostridium tyrobutylicum, and Clostridium tyrobutylicum. The tie be butynyl rikum (Clostridium tyrobutyricum) at least one selected from the group consisting of, and may most preferably Clostridium acetonitrile unit Tilikum (Clostridium acetobutylicum), but are not limited to this.

In the present invention, the decrease or suppression of gene expression can be induced by antisense introduction to the gene, but the present invention is not limited thereto and a technique known in the art capable of reducing or suppressing the expression of a gene All can be utilized.

In the present invention, the antisense to the gene coding for the enzyme involved in the methionine production from homocysteine is represented by SEQ ID NO: 6, and the antisense to the gene encoding the enzyme involved in methyltetrahydrofolate production from methylene tetrahydrofolate SEQ ID NO: 8. The antisense represented by SEQ ID NO: 6 inhibits or reduces the expression of metH represented by the nucleotide sequence of SEQ ID NO: 5, which is a gene encoding methionine synthase, and the antisense represented by SEQ ID NO: 8 is methylene The expression of metF expressed by the nucleotide sequence of SEQ ID NO: 7, which is a gene encoding methylene-THF reductase, can be suppressed or reduced.

In the present invention, the antisense may be introduced in a plasmid form, but is not limited thereto.

In the present invention, " regulation " of a gene includes all the steps of inducing gene expression by techniques such as deletion, expression inhibition, expression enhancement, knockdown, It is a concept encompassing the evolution or mutation of one or more of the existing enzymes.

In the present invention, " knockdown " means that the function of the gene is reduced by significantly reducing the expression amount of the gene, unlike the " knock-out " It can be regulated at the transcript level or at the protein level of the gene. However, the present invention relates to a method for producing methyltetrahydrofolate from a gene encoding an enzyme involved in methionine production from homocysteine and / or an enzyme involved in methyltetrahydrofolate production from methylene tetrahydrofolate in a cell having a tetrahydrofolate C1 metabolic circuit Quot; knock-out " and " knock-out " can be achieved, since the expression of the coding gene is likely to inhibit or reduce the expression of the gene.

As used herein, the term " vector " means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms " plasmid " and " vector " are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several to several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector, (C) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA. After ligation, the vector should be transformed into the appropriate host cell. Transformation can be readily accomplished using a calcium chloride method or electroporation (Neumann, et al., EMBO J., 1: 841, 1982). The vector of the present invention is characterized by including a transcription initiation signal and a promoter so that antisense of the gene to be knocked down can be generated.

The promoter of the vector may be constitutive or inducible and may be further modified for the purposes of the present invention. In one embodiment of the present invention, a thiolase promoter is used. The expression vector also includes a selectable marker for selecting a host cell containing the vector, and a replication origin (Ori) in the case of a replicable expression vector. The vector may be self-replicating or integrated into the host genomic DNA. Preferably, the gene is inserted into the vector so that the transferred gene is irreversibly fused into the genome of the host cell, so that the gene expression in the cell can be stably maintained for a long period of time.

Specifically, the vector used in the present invention may be replaced with a vector such as pTHL1-Cm vector, or a vector such as pIMP1, pMTL21E, or pIM13 that is commonly used in the art to suppress the expression of the gene.

A nucleotide sequence is " operably linked " when placed in a functional relationship with another nucleic acid sequence. This may be the gene and regulatory sequence (s) linked in such a way as to enable gene expression when a suitable molecule (e. G., Transcriptional activator protein) is attached to the regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a whole protein participating in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; Or a ribosome binding site is operably linked to a coding sequence if positioned to facilitate translation. Generally, " operably linked " means that the linked DNA sequences are in contact and, in the case of a secretory leader, are in contact and present in the reading frame. However, the enhancer need not be in contact. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction sites. If such a site does not exist, a synthetic oligonucleotide adapter or a linker according to a conventional method is used.

As is well known in the art, in order to increase the expression level of a transgene in a host cell, the gene must be operably linked to a transcriptional and / or detoxification regulatory sequence that functions in a selected expression host. Preferably, the expression control sequence and / or the gene is contained within a recombinant vector containing a bacterial selection marker and a replication origin. If the host cell is a eukaryotic cell, the recombinant vector should further comprise a useful expression marker in the eukaryotic expression host.

The host cells transformed with the recombinant vectors described above constitute another aspect of the present invention. As used herein, the term " transformation " means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration.

Of course, it should be understood that not all vectors function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

In addition, the gene introduced in the present invention may be introduced into the genome of a host cell to exist as a chromosomal factor. It will be apparent to those skilled in the art that the present invention has the same effect as that of introducing the recombinant vector into the host cell by inserting the gene into the genome of the host cell.

The term " metabolic pathway " in the present invention is a concept encompassing pathways in which a target compound is synthesized from a specific metabolite in a cell, not limited to a pathway in which a target compound is synthesized from carbon provided through a C1 metabolic circuit or a glycolysis process.

The present invention relates to a method for synthesizing a serine, comprising culturing the mutant cell from a different viewpoint.

In the present invention, the mutant cell can produce a variety of useful substances using acetyl-CoA and pyruvic acid as an intermediate product through an increase in serine biosynthesis. Therefore, the present invention provides a mutant cell comprising (a) To produce a useful material; And (b) recovering the resultant useful substance. The present invention also relates to a method for producing a useful substance mediated by serine.

Examples of the useful substance include alcohols, amino acids, organic acids, alkenes, and polymeric monomers. More specifically, the useful substances include linear or branched alcohols having 3 or more carbon atoms, isobutanol, propanol, hexanol, heptanol, octanol, Butanol, 1-pentanol, 2-pentanol, 3-pentanol, 2-methyl-1-butanol, 3-methyl- , Arginine, polynuclear aromatic hydrocarbons (PHA), polylactate, polylactate-co-glycolate, polyisobalate, polyhydroxybutyrate (PHB), 4-hydroxybutyrate, biodiesel, gasoline, olefin 3-aminopropionic acid, acrylic acid, 1,3-diaminopropane, caprolactam, threonine, valine, isoleucine, fumaric acid, , Malic acid, succinic acid, ceramide, astaxanthin, silicin, lycopene, lutein And retinol, but are not limited thereto. For example, it may include all substances that are produced by accelerating the assimilation circuit by serine produced by the mutant cells according to the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

In the following examples, only specific clostridium acetobuttilicum strains are exemplified as a microorganism for gene knockdown according to the present invention. However, even when other clostridium or other microorganisms are used, methionine is produced from homocysteine , A gene coding for an enzyme involved in the production of methyltetrahydrofolate from methylene tetrahydrofolate and a gene encoding a gene encoding an enzyme involved in the production of methyltetrahydrofolate, It will also be apparent to one of ordinary skill in the art to have a circuit.

Example  1: a gene encoding an enzyme involved in the production of methionine from homocysteine For knockdown  Plasmid production

A vector expressing CAC0578 antisense was knocked down to knockdown the CAC0578 gene (SEQ ID NO: 5), which is a gene encoding an enzyme involved in the production of methionine from homocysteine, in the host microorganism Clostridium acetoobutylicum. Respectively.

[SEQ ID NO: 5] CAC0578  gene

cttaaagacagcgattataaagctctatctgattatatcgctccaaagggtattggcatcaaagattatataggtggttttattgtaactgctggaataggtgcaaaggaatattccgataaattaaagaaaaaatgcgacgattatggagctactatgcttaaacttatatgcgatagacttgcagaggccttttcagaacttcttcacctaagggtaagaaaagaatactggggatactctcaagatgaaaacttatccttagaaaaacttcttaaaggaagttacagagggataaaaccagctattggatatccttctattcccgatcactctgaaaaagcaaagttatttgatttacttttaggtaaaacttcaataggagtggaattgacggaaagttatatgatgaatccaacttcaagtgtatgcggtttgtattttgcaaatgaacgagcaaaatactttaatataaataaaataggaaaagatcaacttgaggactatgctgttcgaagtaataaagacattaatgaaataaaaaaattattagatactctgttataa-3 '

[SEQ ID NO: 6] CAC0578 Antisense

5'-cttcctttgcgagttttgcccccttaaaattaatatcatatattttatcttgcatattataatctttttgtgatatttcagtagcgttaaaagtgtttgtttctattatatctgcgccagcttcaaggtatctcttgtggatttcttttattatttctggcttggttaaatttaaaacatcattgtttcctttttgattggaatgacatgtacaagataaggaacctttaaagtcgccttcatctagattaaaggattgaatacatgttcccatagcaccatctaaaactaaaattttgttatttaacaaattctttagtgaagaattcataagttagcccccttaaaaaataggataaaataaaaagcccttggaaataacctcgggctttacattcgcgattattctcatctatcagcgtttgctgcaggatttagcaccacatatattaaaaaatatactggttgccgggtttcaaagggccagtccctccaccactcttgataagatt-3 '

First, the well-known pTHL1-Cm vector (Jang et al., Biotech. Prog. 29: 10831088, 2013) was used as a vector for expression of CAC0578 antisense. It has been known that a thialase promoter is introduced into the vector, and thyorase is capable of continuously and stably expressing the gene without being greatly affected by the cell growth cycle (Tummala et al., Appl. Environ. Microbiol., 65: 3793-3799, 1999). For CAS0578 antisense expression, the Pstl and AvaI restriction sites of the pTHL1-Cm vector were amplified using the genomic DNA of Clostridium acetobutylicum ATCC 824 as a template using SEQ ID NO: 1 and SEQ ID NO: 2 DNA fragments were cloned.

[SEQ ID NO: 1]: 5'-CTGCAGCTTCCTTTGCGAGTTTTGC-3 '

[SEQ ID NO: 2]: 5'-CCCGGGAATCTTATCAAGAGTGGTGGAG-3 '

Example  2: methylene From tetrahydrofolate Methyltetrahydro  A gene encoding an enzyme involved in producing folate For knockdown  Plasmid production

Expression of CAC0291 antisense to knockdown the CAC0291 gene (SEQ ID NO: 7), an enzyme involved in the production of methyltetrahydrofolate from methylene tetrahydrofolate, in the host microorganism Clostridium acetobutylicumum Was prepared in the same manner as in Example 1 above.

[SEQ ID NO: 7] CAC0291  gene

agctaaggtatgcaagcaaaataacatagatcttgtaaccattgcagattcaccaatgtcaaaagttagagtggattcagtaatgattgcatctaaaattaaaagagaactaggaatagaagttatgccgcatatatgttgtagagataagaatgtaaatgcaataaggtcaagtttacttgcagcacacatagaaggaataaggaatatacttgctataactggagatccagttacgggaattgataaggttaatactaaaagtgtttttaatttaaattcatataagcttatgaatcttataagtgaaatgaataaagaaacatttaaggaagataagataagtataggtggagcacttaatttgaatgtattgaataaggaagttgaagtaacaaggatgctaaagaaagtagaaaatggaggtacattttttctaactcaacctatatttaaagaagagactattgagttcttagctaagcttaagaaagatagaaatataaaaattataggaggagttctccctatagtaagttatagaaatattcagtttataaataacgagctcttcggagttgatatacctaaagaatatattgagagatttagtgtggatatgacaagacaagaggcagaagaagtgggagtaaatttagctagggaacttatagctaaaattaggaactatgtagatggtatatatattgttacaccatttaatagaatcggtatggtaatgaaaatactcgaaaatgttaggaagtga-3 '

[SEQ ID NO: 8] CAC0291 Antisense

5'-ctgctgcctttctagctatcatataccctttagttattatattttctaattctgtcttcgatatatccatagttaaagtatttgctgaaaatgtatttgttctaataagtttagctcccgactttatatactctttatggatattaagtattacttctggattagttaaattagcaaattcacaaaaattattataatctccagtggttttagaataatatgttcccattgccccatccgtaactaaaacattattttttatatattcacgtatcactgtattcaccatccacacctataaattatattacttatattctaacatacagttcaatctttttatacttcattatattatttacataaaataaaagtggtttacatatacaacttatagaataagttatatatgtaaaccactttaaaaccatttatataattggaggcg-3 '

Namely, using the genomic DNA of Clostridium acetoButylicum ATCC 824 as a template as the template for the PstI and AvaI restriction sites of the pTHL1-Cm vector having the thiolase promoter, amplification was performed using SEQ ID NO: 3 and SEQ ID NO: 4 One DNA fragment was cloned.

[SEQ ID NO: 3]: 5'-CTGCAGCTGCTGCCTTTCTAGCTATC-3 '

[SEQ ID NO: 4]: 5'-CCCGGGCGCCTCCAATTATATAAATGG-3 '

Example  3: Clostridium of the plasmid Acetobutylicum  Transformation

The recombinant vectors prepared in Example 1 and Example 2 were introduced into clostridium acetobuttilicum. Prior to this, methylation of vectors was induced to be suitable for transformation into clostridium, that is, Bacillus subtilis Phage 3T I methyltransferase expression vector, pAN1 (Mermelstein et al. , Appl Environ Microbiol, 59:. .. 1077, 1993) for containing the E. coli TOP 10 (Invitrogen Corporation, Carlsbad, Calif, USA) examples 1 and 2 lead to methylation and introducing the produced recombinant vector in Respectively. Two methylated vectors were isolated and purified from Escherichia coli and introduced into Clostridium acetobutylicum ATCC 824 strain known as a type strain to prepare a recombinant mutant microorganism.

Competent cells for transformation were prepared as follows. First, Clostridium acetobutylicum ATCC 824 strain was inoculated into 10 ml CGM medium (Table 1) and cultured until the OD value reached 0.6. The cultured strains were inoculated in 60 ml of 2X YTG medium (16 g of Bacto Tryptone, 10 g of yeast extract, 4 g of NaCl, 5 g of glucose, per liter) at a concentration of 10% and cultured for 4-5 hours. The microbial cells were suspended in 2.4 ml of the same buffer after washing with the transformation buffer (EPB, 15 ml of 270 mM sucrose, 110 μl of 686 mM NaH ₂ PO ₄ , pH 7.4, twice, (compent cell) and 25 μl of recombinant plasmid DNA were mixed and charged into a cuvette having a 4 mm electrode, and then subjected to electric shock at 2.5 kV and 25 μF. Immediately, the cells were suspended in 1 ml of 2 × YTG medium And cultured at 37 ° C for 3 hours. Then, transformants ATCC824CAC0578kd and ATCC824CAC0291kd were selected by streaking on 2 × YTG solid medium containing 40 μg / ml erythromycin.

Composition of CGM medium ingredient Content (g / l) Glucose 8 K ₂ HPO ₄ 3H ₂ O 0.982 KH ₂ PO ₄ 0.75 MgSO ₄ 0.348 MnSO ₄ H ₂ O 0.01 FeSO ₄ 7H ₂ O 0.01 (NH _{4) 2} SO ₄ 2 NaCl One Asparagine 2 p-Aminobenzoic acid 0.004 Yeast extract 5

Example  4: Mutant C1  Culture for Metabolic Circuit Analysis

ATCC 824 strain, which is a wild type clostridium acetobuttilicum strain, and the recombinant mutant ATCC824CAC0578kd and ATCC824CAC0291kd were cultured to analyze the C1 metabolism circuit. To this end, a 30 ml test tube containing 10 ml of CGM medium containing ¹³ C-formate was sterilized, taken out at 80 ° C or higher, filled with nitrogen gas, and then cooled to room temperature in the anaerobic chamber. Then, 40 / / ml of erythromycin was added, and the recombinant mutant microorganisms were inoculated and incubated at 37 째 C for 16 hours with anaerobic digestion.

Example  5: Mutation of the strain C1  Analysis of Serine Biosynthesis through Metabolic Circuits

After the culture was completed, the wild-type strain and the recombinant mutants ATCC824CAC0578kd and ATCC824CAC0291kd were recovered and the amino acids constituting the cells were analyzed (Agilent 6890N, 5875 XL MS system, Agilent 7683 automatic injector, column (HP-5MS, As a result, wild type strains showed a summed fractional labeling (SFL) of 8.5 for serine, while values of 11 and 16 were found for the recombinant strains ATCC824CAC0578kd and ATCC824CAC0291kd in the experimental groups, respectively From these results, it was found that the serine synthesis of the C1 metabolic pathway was improved in the two mutants compared to the wild type strain.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea Advanced Institute of Science and Technology          INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> An engineered cell having improved serine biosynthesis ability <130> P16-B335 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC0578 gene cloning <400> 1 ctgcagcttc ctttgcgagt tttgc 25 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC0578 gene cloning <400> 2 cccgggaatc ttatcaagag tggtggag 28 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC0291 gene cloning <400> 3 ctgcagctgc tgcctttcta gctatc 26 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC0291 gene cloning <400> 4 cccgggcgcc tccaattata taaatgg 27 <210> 5 <211> 3639 <212> DNA <213> Clostridium acetobutylicum <400> 5 atgaattctt cactaaagaa tttgttaaat aacaaaattt tagttttaga tggtgctatg 60 ggaacatgta ttcaatcctt taatctagat gaaggcgact ttaaaggttc cttatcttgt 120 acatgtcatt ccaatcaaaa aggaaacaat gatgttttaa atttaaccaa gccagaaata 180 ataaaagaaa tccacaagag ataccttgaa gctggcgcag atataataga aacaaacact 240 tttaacgcta ctgaaatatc acaaaaagat tataatatgc aagataaaat atatgatatt 300 aattttaagg gggcaaaact cgcaaaggaa gcttgtactt actacacaaa actaaatcct 360 aataagccta gatttgctgc tggttctatt gggcctacaa atagaactgc ttctctatct 420 ccagatgttg aaaatcctgg ttttagaaat gtaacctttg atgagctatg taatgcctat 480 aaacatcaaa tagaggctct aatagatgga ggtgtagacc ttcttttaat tgaaactata 540 tttgatactt taaacgctag agcagcaatc tttgcagcag aaacagtatt tgaaaataaa 600 aaaataaaac ttcctattat aatttcaggg acaatagctg ataaaagtgg aagaatatta 660 tccggtcaaa ctcttgacgc ttttgcagaa agtttaaaaa acgaaaatat aattgctata 720 gggcttaatt gttcctttgg tgctgaagaa cttatacctt ttataaaaag actctctgaa 780 acacaaaata gatatatatc ctttcatcca aacgcaggac ttccaaactc ccttggtgaa 840 tatgaagaac tgccagagga aactgctagc attgtaaaaa aattagcact tgaaggacat 900 ttaaatatag ttggaggctg ctgtggcact acaccagaac atataagagc aataagcagc 960 gtagttaaag gcatttctcc aagaaaagtt ccaaacttgg aacccaaaac aatttacagc 1020 ggactagaaa acataaaaat tgataagaac agtaacttca taaatatagg cgaaagaaca 1080 aatgtagcgg gctcaagaaa attcgcaagg cttatacgtg aaaaaaatta tgaggaggct 1140 ctaaccattg caagacatca ggttgaaaat ggtgcccaaa ttatagatat aaattttgat 1200 gatgcacttt tagatgctcg ctctgaaatg gaaacatttt taagacttat tgcaagtgaa 1260 cctgaaatat caaaagttcc agttatgata gactcctcta attttgaagt tttaaaagtt 1320 ggattaaagt ctattcaagg taaagccata gtaaattcca taagtcttaa ggttggagaa 1380 gaaaagttca ttgaagaggc aaaatttata aagaactttg gcgctggcgt agttgtaatg 1440 gcctttgacg aagaaggtca agcagctact tatgaaagaa aaattgaaat ctgcaagaga 1500 gcttatacta ttctcacaga aaaagttgag tttccacctg aaaatataat atttgatcca 1560 aatatactat ctatagcgac aggaattgaa gaacatgaca actatgcagt taattacata 1620 aaagctgtta aatggataaa agagaatcta ccatacgcta aagtcagcgg tggagttagc 1680 aacctctcct tttcttttag gggtaatgac gcaataagaa gagctatgca ttctgttttc 1740 ctttaccatg caataaacgc tggaatggat atgggtattg ttaatccagc aatgattgat 1800 ttatatgacg atatagataa ggatcttctc gaaaaggttg agaatgttgt actaaataaa 1860 tcatctaacg cttctgaatc attactagaa tttgctcaaa cgtataaaaa gacgactgaa 1920 accttagaaa agcacgagga tgaatggcga caaaaaagcc caagtgaaag gttgagttat 1980 gctttagtta aaggaaatgt tgaatttatt gaagaagata tagaagaagc aagaaaagag 2040 tatacaaatg cacttgaaat tatagaggtt cctttaatga atggaatgaa aaaagtgggt 2100 aaactttttg gagagggaaa aatgtttctt cctcaagtag taaaaagtgc tagagttatg 2160 aaaaaggctg ttgaatgtct tcttccctat ataaacgaag aaaagtctaa aaatcacaat 2220 aaaagtgctg gtaaggttgt atttgcaact gttaaaggcg atgttcatga cataggcaaa 2280 aatatcgtat ctgtagttct ttcctgcaac aattttgaag ttatagattt aggagtaatg 2340 gttccccctg aaaccatact tgaaacggca aaacgtgaaa atgcagatat cattgcttta 2400 agtggtttaa ttacaccttc tcttaatgaa atggcttatg tagctgaaga aatgaaaagg 2460 cttaattttg atataccact tatggtgggt ggtgctgcta cctcaaaaac tcacacagct 2520 ttaaaactag ctacgaaata taaatatgta gtacacagta ctgatgcttc agatgctgtt 2580 accgtagcca aaaatctaat gagtgaaaac aaatttactt tcttagaaaa attaaatgaa 2640 gagtattcta aaataagaga gaccttctct actaataaga ttgaacttat ctccattcaa 2700 aacgcaagaa aaaacagatt tactattgac tggaataaaa ctaaaataac tgaacctaaa 2760 tttgtcggta taaaaaaatt acaagctgta cctataaatg aattaagaaa gtatatagat 2820 tggactttct tctttacgtc ttgggatatg ggaatgaatt accccaaaat aatgaaagat 2880 cctaaatacg gagctgaagc tcaaaaactc tttaaggatg ccaatgaaat gcttgattta 2940 ttgcaaaaag aaaatttaat cacttgtaat ggagtttttg gaatattccc agctaattct 3000 gttaatgatg atatagaaat ctacactgat aaaggaactg taaccataaa tactcttcgt 3060 cagcagcaga tacttaaaga cagcgattat aaagctctat ctgattatat cgctccaaag 3120 ggtattggca tcaaagatta tataggtggt tttattgtaa ctgctggaat aggtgcaaag 3180 gaatattccg ataaattaaa gaaaaaatgc gacgattatg gagctactat gcttaaactt 3240 atatgcgata gacttgcaga ggccttttca gaacttcttc acctaagggt aagaaaagaa 3300 tactggggat actctcaaga tgaaaactta tccttagaaa aacttcttaa aggaagttac 3360 agagggataa aaccagctat tggatatcct tctattcccg atcactctga aaaagcaaag 3420 ttatttgatt tacttttagg taaaacttca ataggagtgg aattgacgga aagttatatg 3480 atgaatccaa cttcaagtgt atgcggtttg tattttgcaa atgaacgagc aaaatacttt 3540 aatataaata aaataggaaa agatcaactt gaggactatg ctgttcgaag taataaagac 3600 attaatgaaa taaaaaaatt attagatact ctgttataa 3639 <210> 6 <211> 512 <212> DNA <213> Artificial Sequence <220> <223> Antisense sequence for CAC0578 gene knockdown <400> 6 cttcctttgc gagttttgcc cccttaaaat taatatcata tattttatct tgcatattat 60 aatctttttg tgatatttca gtagcgttaa aagtgtttgt ttctattata tctgcgccag 120 cttcaaggta tctcttgtgg atttctttta ttatttctgg cttggttaaa tttaaaacat 180 cattgtttcc tttttgattg gaatgacatg tacaagataa ggaaccttta aagtcgcctt 240 catctagatt aaaggattga atacatgttc ccatagcacc atctaaaact aaaattttgt 300 tatttaacaa attctttagt gaagaattca taagttagcc cccttaaaaa ataggataaa 360 ataaaaagcc cttggaaata acctcgggct ttacattcgc gattattctc atctatcagc 420 gtttgctgca ggatttagca ccacatatat taaaaaatat actggttgcc gggtttcaaa 480 gggccagtcc ctccaccact cttgataaga tt 512 <210> 7 <211> 1791 <212> DNA <213> Clostridium acetobutylicum <400> 7 atggtgaata cagtgatacg tgaatatata aaaaataatg ttttagttac ggatggggca 60 atgggaacat attattctaa aaccactgga gattataata atttttgtga atttgctaat 120 ttaactaatc cagaagtaat acttaatatc cataaagagt atataaagtc gggagctaaa 180 cttattagaa caaatacatt ttcagcaaat actttaacta tggatatatc gaagacagaa 240 ttagaaaata taataactaa agggtatatg atagctagaa aggcagcaga aggtaaggag 300 atttttatag ctgcagatat aggacctatt aacaaatttg aaatagagaa accagtggag 360 tacataatag aagaatataa atttgtagta gatattttta tgaatttggg agcagatatt 420 tttgtatttg aaacattaag tagtatagat tgtttgaaag aggtttttca atatataaag 480 agaaagaaca agaatgcatt tatcttggct cagtttgcaa ttatgcaaga tggttttaca 540 agagagggta ttagtgtaaa tagtattgta aataagataa aagctattgg gagtatagat 600 gcatatggat ttaattgtgg atctgggcca gcacatttat ataatataat aaagggatta 660 gatatatatg gagatataat atcgacactt cctaatgcag gatatcctga aataattaat 720 gaacgcatgg tatatgtaga caatcctgat tattttgcag ataaaatgtc aatgattaaa 780 aacagaggag ttaaaatagt agggggatgc tgtggaacta caccaaaaca tatagaaaaa 840 atggtaagta atttaaaaga aaatctaatt aacatagaag aaatagaaat aaaaaaaaat 900 aagggtataa ataattataa aaagaagaat agttttactg aaaaattaga taaaggtgaa 960 tttcctatag ttgttgaatt agaccctcca tttgatacaa atatagataa gattatgtat 1020 gcagctaagg tatgcaagca aaataacata gatcttgtaa ccattgcaga ttcaccaatg 1080 tcaaaagtta gagtggattc agtaatgatt gcatctaaaa ttaaaagaga actaggaata 1140 gaagttatgc cgcatatatg ttgtagagat aagaatgtaa atgcaataag gtcaagttta 1200 cttgcagcac acatagaagg aataaggaat atacttgcta taactggaga tccagttacg 1260 ggaattgata aggttaatac taaaagtgtt tttaatttaa attcatataa gcttatgaat 1320 cttataagtg aaatgaataa agaaacattt aaggaagata agataagtat aggtggagca 1380 cttaatttga atgtattgaa taaggaagtt gaagtaacaa ggatgctaaa gaaagtagaa 1440 aatggaggta cattttttct aactcaacct atatttaaag aagagactat tgagttctta 1500 gctaagctta agaaagatag aaatataaaa attataggag gagttctccc tatagtaagt 1560 tatagaaata ttcagtttat aaataacgag ctcttcggag ttgatatacc taaagaatat 1620 attgagagat ttagtgtgga tatgacaaga caagaggcag aagaagtggg agtaaattta 1680 gctagggaac ttatagctaa aattaggaac tatgtagatg gtatatatat tgttacacca 1740 tttaatagaa tcggtatggt aatgaaaata ctcgaaaatg ttaggaagtg a 1791 <210> 8 <211> 448 <212> DNA <213> Artificial Sequence <220> <223> Antisense sequence for CAC0291 gene knockdown <400> 8 ctgctgcctt tctagctatc atataccctt tagttattat attttctaat tctgtcttcg 60 atatatccat agttaaagta tttgctgaaa atgtatttgt tctaataagt ttagctcccg 120 actttatata ctctttatgg atattaagta ttacttctgg attagttaaa ttagcaaatt 180 cacaaaaatt attataatct ccagtggttt tagaataata tgttcccatt gccccatccg 240 taactaaaac attatttttt atatattcac gtatcactgt attcaccatc cacacctata 300 aattatatta cttatattct aacatacagt tcaatctttt tatacttcat tatattattt 360 acataaaata aaagtggttt acatatacaa cttatagaat aagttatata tgtaaaccac 420 tttaaaacca tttatataat tggaggcg 448

Claims (10)

A gene encoding methionine synthase, an enzyme involved in the production of methionine from homocysteine, and a gene encoding methionine synthase in Clostridium acetobutylicum, which is a cell having a tetrahydrofolate C1 metabolic circuit, The gene encoding methylene-tetrahydrofolate-methylene-THF reductase, which is an enzyme involved in methyltetrahydrofolate production, is deleted or the expression of the two genes is suppressed or decreased, Mutant cells with improved serine biosynthesis compared to before.
delete The method according to claim 1, wherein the gene encoding methionine synthase is methH represented by the nucleotide sequence of SEQ ID NO: 5, and the methylene-tetrahydrofolate-methylene-THF reductase Wherein the coding gene is metF represented by the nucleotide sequence of SEQ ID NO: 7.
delete delete delete The mutant cell according to claim 1, wherein the inhibition or reduction of gene expression is induced by antisense introduction into the two genes.
8. The method according to claim 7, wherein the antisense to the gene coding for the enzyme involved in methionine production from homocysteine is represented by SEQ ID NO: 6, and is characterized in that the gene coding for an enzyme involved in methyltetrahydrofolate production from methylene tetrahydrofolate 8. The mutant cell according to any one of claims 1 to 8, wherein the antisense gene is represented by SEQ ID NO: 8.
8. The mutant cell of claim 7, wherein said antisense is introduced in the form of a plasmid.
9. A method for synthesizing a serine, comprising culturing the mutant cell of any one of claims 1, 3, 7 to 9.

Images