KR102013741B1 - An engineered cell having improved methionine biosynthetic ability - Google Patents

Abstract

The present invention relates to mutant cells having improved methionine biosynthesis, and more particularly, to a gene having a tetrahydrofolate C1 metabolic circuit, a gene encoding an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate. And / or the expression of a gene encoding an enzyme converting methenyl tetrahydrofolate to methylene tetrahydrofolate and / or a gene encoding an enzyme converting glycine to serine is inhibited or reduced, thereby improving methionine biosynthesis. In the case of culturing the mutant cells, methionine can be easily produced on a large scale, and recovered from the medium after culturing, and can be used for various industrial uses including animal feed, pharmaceuticals, food additives, cosmetics, and diet supplements. In addition, since the reaction can increase the production of S-adenosylmethionine (S-adenosylmethionine (SAM)), it can be used as a methyl group donor to induce a methylation reaction of various (live) compounds by anti-cancer effect There is an advantage to improve.

Description

An engineered cell having improved methionine biosynthetic ability

The present invention relates to mutant cells having improved methionine biosynthesis, and more particularly, to a gene having a tetrahydrofolate C1 metabolic circuit, a gene encoding an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate. And / or the expression of a gene encoding an enzyme converting methenyl tetrahydrofolate to methylene tetrahydrofolate and / or a gene encoding an enzyme converting glycine to serine is inhibited or reduced, thereby improving methionine biosynthesis. It is about a cell.

As demand for petroleum dependence and greenhouse gas reduction increases worldwide, the demand for development of C1 gas-based transportation fuel and basic chemical material production technology is increasing rapidly. C1 gas is methane (CH ₄ ) gas with one carbon (C) derived from natural gas such as syngas, biogas and shale gas, and carbon monoxide (CO) or carbon dioxide (CO ₂ ) with one carbon (C) It is a concept that includes both a gas such as, and formic acid derived therefrom (HCOOH), in recent years, countries around the world, including major countries such as the United States, Europe, China, etc., to convert C1 gas derived from shale gas into useful compounds, A huge budget is being invested in researching chemical methods.

Developing the source technology of C1 gas refinery to recycle greenhouse gases and by-product gases can be beneficial in securing global price competitiveness of basic chemical materials and creating growth engines for the chemical industry. As such, the C1 metabolic circuit of the organism can be used as a useful means for recycling the C1 gas, and most living organisms use the tetrahydrofolate circuit for one carbon metabolism. Tetrahydro folate C1 metabolism is linked to the serine cycle, nucleic acid methylation, methionine cycle, etc., and the metabolic circuit plays an important role in C1 migration, such as inducing methylation of metabolites in vivo. Known. That is, since the C1 metabolic cycle and the methionine cycle connected with the metabolic circuit are linked to central metabolism for biosynthesis of useful compounds such as acetylcoa and pyruvic acid, the useful compounds can be synthesized with high efficiency when appropriately utilized. However, as yet, techniques for efficiently producing useful compounds using such metabolic circuits have not been developed, and thus, there is an urgent need in the art for useful compound synthesis techniques using the metabolic circuits.

Meanwhile, one of the causes of cancer, methyl sink is known to occur due to the problem of methylation of hundreds of metabolites such as DNA, RNA, protein and fat from S-adenosylmethionineme (SAM). These problems are expected to be solved through the smooth synthesis of methionine through the tetrahydrofolate metabolic cycle and their conversion to SAM.

Therefore, the inventors of the present invention utilize the C1 metabolic circuit to develop a technique for smoothly supplying (1) a variant capable of producing useful compounds or a precursor of (2) S-adenosylmethionin. As a result of our efforts to control metabolic circuits, we have been able to improve methionine production in the C1 metabolic circuits, particularly by knocking down genes encoding enzymes that convert (form) formyl tetrahydrofolate to methenyl tetrahydrofolate, (Ii) knocking down the gene encoding the enzyme converting methenyl tetrahydrofolate to methylene tetrahydrofolate, or (iii) knocking down the gene encoding the enzyme involved in converting glycine to serine, or Iii) Significantly increases the production of methionine in the C1 metabolism of organisms knocked down by combining these three genes It was confirmed and completed the invention. In addition, the present invention was completed by confirming that the introduction of siRNAs of the genes in order to smoothly supply the precursor of S-adenosylmethionin can enhance the cancer treatment efficiency.

It is an object of the present invention to provide mutant cells with increased biosynthesis of methionine.

Another object of the present invention is to provide a method for producing methionine using the mutant cells.

Another object of the present invention is to provide a novel anticancer composition.

In order to achieve the above object, the present invention provides a gene encoding an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate, methenyl tetrahydrofolate, in a cell having a tetrahydrofolate C1 metabolic circuit. To provide a mutant cell in which a gene selected from the group consisting of a gene encoding an enzyme converting methylene tetrahydrofolate and a gene encoding an enzyme converting glycine to serine is deleted or the expression of the gene is suppressed or reduced. do.

The present invention also comprises culturing the mutant cells to biosynthesize methionine; And recovering the biosynthesized methionine.

The invention also relates to genes encoding enzymes involved in the conversion of formyl tetrahydrofolate to methenyl tetrahydrofolate, genes encoding enzymes involved in the conversion of methylene tetrahydrofolate from methenyl tetrahydrofolate, and An inhibitor for a gene selected from the group consisting of genes encoding enzymes involved in the conversion of serine from glycine, wherein the inhibitor is a vector comprising siRNA, antisense-oligonucleotide, shRNA, miRNA or one of these It provides an anticancer composition characterized in.

The present invention also relates to genes encoding enzymes for converting formyl tetrahydrofolate to methenyl tetrahydrofolate, genes encoding enzymes for converting methenyl tetrahydrofolate to methylene tetrahydrofolate and glycine to serine. A substance that inhibits the expression of a gene selected from the group consisting of genes encoding the enzymes to convert; Specific for an enzyme selected from the group consisting of an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate, an enzyme for converting methenyl tetrahydrofolate to methylene tetrahydrofolate, and an enzyme for converting glycine to serine It provides an anticancer composition comprising an inhibitor that binds to the active ingredient.

The present invention is to provide mutant cells with increased biosynthesis of methionine by controlling the expression amount of a specific gene encoding an enzyme involved in the C1 metabolic circuit. When culturing the mutant cells, methionine can be easily produced on a large scale. After cultivation, it can be recovered from the medium and used in various industrial applications, including animal feed, pharmaceuticals, food additives, cosmetics and diet supplements. In addition, since the reaction can increase the production of S-adenosylmethionine (S-adenosylmethionine (SAM)), it can be used as a methyl group donor to induce a methylation reaction of various (live) compounds by anti-cancer effect There is an advantage to improve.

FIG. 1 shows a pathway in which tetrahydrofolate C1 metabolic circuits block or inhibit the expression of enzymes involved in the conversion of formyl tetrahydrofolate to methenyl tetrahydrofolate.
Figure 2 shows the pathway in which the expression of the enzymes involved in the conversion of methylene tetrahydrofolate from methenyl tetrahydrofolate is inhibited or reduced in the tetrahydro folate C1 metabolic cycle.
Figure 3 shows a pathway in which the expression of the enzymes involved in the conversion of glycine from serine is inhibited or reduced in the tetrahydro folate C1 metabolic cycle.
Figure 4 shows a one-carbon (C1) delivery route using tetrahydro folate metabolic circuit.
Figure 5 shows the cancer-causing mechanism through the methyl sink in the tetrahydro folate metabolic circuit.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In the present invention, the tetrahydro folate C1 metabolic circuit is a circulating metabolic circuit for one-carbon (C1) delivery, in which one molecule of formic acid meets tetrahydro folate and formyl-tetrahydro folate (Formyl-THF), and meth. Homocysteine is metabolized by tetrahydrofolate via methyl-tetrahydrofolate (Methenyl-THF), methylene-tetrahydrofolate (Methylen-THF) and methyl-tetrahydrofolate (Methyl-THF) And formic acid metabolism which converts glycine to serine.

We control the expression of genes encoding enzymes involved in the conversion of formyl tetrahydrofolate to methenyl tetrahydrofolate in cells with the tetrahydrofolate C1 metabolic circuit, or the methenyl tetrahydrofolate To regulate the expression of the gene encoding the enzyme involved in the conversion of methylene tetrahydrofolate from or to the expression of the gene encoding the enzyme involved in the conversion of serine from glycine, the aspect of methionine biosynthesis is changed, in particular Inhibiting or reducing the expression of any one or more of the three enzymes was confirmed to increase methionine biosynthesis.

Therefore, in one aspect, the present invention provides a gene encoding an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate, and methylene to methenyl tetrahydrofolate in a cell having a tetrahydrofolate C1 metabolic circuit. The present invention relates to a mutant cell in which a gene selected from the group consisting of a gene encoding an enzyme converting tetrahydrofolate and a gene encoding an enzyme converting glycine to serine is deleted or the expression of the gene is suppressed or reduced.

In the present invention, the enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate is formomi-tetrahydrofolate cyclodiaminase, and for methylene tetrahydrofolate, methylene tetrahydro The enzyme that converts to folate is formyl-tetrahydrofolate cyclohydrolacese / methylene-tetrahydrofolate dihydrogenase, which converts glycine to serine The encoding gene may be a serine hydroxymethyltransferase, but is not limited thereto.

In the present invention, the gene encoding the formiddo-tetrahydrofolate cyclodiaminase (formimido-THF cyclodeaminase) is ftcd represented by the nucleotide sequence of SEQ ID NO: 1, and the formyl-tetrahydrofolate cyclohydrolase / The gene encoding methylylene -tetrahydrofolate dihydrogenase (formyl-THF cyclohydrolase / methylene-THF dehydrogenase) is folD represented by the nucleotide sequence of SEQ ID NO: 5, and the serine hydroxymethyltransferase (serine hydroxymethyltransferase) The gene encoding may be glyA represented by the nucleotide sequence of SEQ ID NO: 9, but is not limited thereto.

In the present invention, the mutant cells may be characterized in that the biosynthesis of methionine is increased.

Cells having the tetrahydro folate C1 metabolic circuit in the present invention may be any one selected from the group consisting of human cells, bacteria, yeast, fungi, plant cells, animal cells, algae and microalgae.

The cell having the tetrahydro folate C1 metabolic circuit may preferably be a bacterium, and the bacterium may be methane-producing bacteria, methane magnetization bacteria, acetojeon, Escherichia coli, corynebacterium, crab ciella, yeast, claw. Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, Clostridium perfringens, Clostridium tetani, Clostridium difficile, Clostridium butyricum, Clostridium butylicum , Clostridium kluyveri, Clostridium tyrobutylicum and Clostridium Tyrobutyricum (Clostridium tyrobutyricum) may be any one selected from the group consisting of, and most preferably may be Clostridium acetobutylicum (Clostridium acetobutylicum), but is not limited thereto.

In the present invention, the reduction or inhibition of gene expression may be induced by the introduction of antisense oligonucleotides into the gene, but is not limited thereto, and is well known in the art, which may reduce or inhibit the expression of a gene. The technology can all be utilized.

In the present invention, the antisense for the gene encoding the enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate is represented by SEQ ID NO: 2, and the enzyme for converting methenyl tetrahydrofolate to methylene tetrahydrofolate. The antisense for the gene encoding the is represented by SEQ ID NO: 6, the antisense for the gene encoding the enzyme for converting glycine to serine may be characterized in that represented by SEQ ID NO: 10.

The antisense represented by SEQ ID NO: 2 inhibits or reduces the expression of ftcd represented by the nucleotide sequence of SEQ ID NO: 1, which is a gene encoding formiddo-tetrahydrofolate cyclodiaminase (formimido-THF cyclodeaminase) The antisense represented by the number 6 is the base of SEQ ID NO: 5, which is a gene encoding formyl-tetrahydrofolate cyclohydrolacese / methylene-tetrahydrofolate dihydrogenase (formyl-THF cyclohydrolase / methylene-THF dehydrogenase) Suppresses or reduces the expression of folD represented by the sequence, and the antisense represented by SEQ ID NO: 10 reduces the expression of glyA represented by the nucleotide sequence of SEQ ID NO: 9, which is a gene encoding serine hydroxymethyltransferase. It may be characterized by suppressing or reducing.

In the present invention, the antisense may be introduced in the form of plasmid, but is not limited thereto.

In the present invention, "regulation" of a gene includes all of the genes induced by expression of genes such as deletion, inhibition of expression, expression enhancement, knockdown, promoter replacement, introduction of regulatory mechanisms, and the like. The concept encompasses the evolution or mutation of one or more of the enzymes present.

In the present invention, "knock-down", unlike "knock-out" which completely blocks the expression of a gene, means that the amount of the gene is significantly reduced to reduce the function of the gene. It may be regulated at the transcript level of the gene or may be regulated at the protein level. However, the present invention relates to a gene encoding an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate and / or a methylene tetrahydrofolate in a cell having a tetrahydrofolate C1 metabolic circuit. The expression of the gene encoding the enzyme converting to hydrofolate and / or the gene encoding the enzyme converting glycine to serine is of significance in inhibiting or decreasing, so that either "knockdown" or "knock-out" can be used to It is also possible to achieve the desired purpose.

By "vector" is meant a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication, including several to hundreds of plasmid vectors per host cell, and (b) host cells transformed with plasmid vectors. It has a structure that includes an antibiotic resistance gene that allows it to be used and a restriction enzyme cleavage site (c) into which foreign DNA fragments can be inserted. Although no suitable restriction enzyme cleavage site is present, synthetic oligonucleotide adapters or linkers according to conventional methods can be used to facilitate ligation of the vector and foreign DNA. After ligation, the vector should be transformed into the appropriate host cell. Transformation can be readily accomplished using calcium chloride methods or electroporation (Neumann, et al., EMBO J., 1: 841, 1982) and the like. The vector of the present invention is characterized in that a transcription start signal and a promoter are included so that antisense of a gene to be knocked down can be generated.

The promoter of the vector may be constitutive or inducible and may be further modified for the effect of the present invention. In one embodiment of the present invention, a thiolase promoter is used. The expression vector also includes a selectable marker for selecting a host cell containing the vector, and in the case of a replicable expression vector, includes an origin of replication (Ori). Vectors can self replicate or integrate into host genomic DNA. Preferably, the gene inserted into the vector and delivered is irreversibly fused into the genome of the host cell so that gene expression in the cell can be stably maintained for a long time.

Specifically, the vector used in the present invention can be used in place of a pTHL1-Cm vector or a vector such as pIMP1, pMTL21E, or pIM13, which are commonly used to suppress gene expression in the art.

Sequences are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s). For example, DNA for a pre-sequence or secretion leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.

As is well known in the art, to raise the expression level of a transgene in a host cell, the gene must be operably linked to a transcriptional and / or translational expression control sequence that functions in the chosen expression host. Preferably, the expression control sequences and / or genes of interest are included in one recombinant vector containing a bacterial selection marker and a replication origin. If the host cell is a eukaryotic cell, the recombinant vector must further comprise an expression marker useful in the eukaryotic expression host.

Host cells transformed with the recombinant vectors described above constitute another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host so that the DNA is replicable as an extrachromosomal factor or by chromosomal integration.

Of course, it should be understood that not all vectors function equally well to express the DNA sequences of the present invention. Likewise not all hosts function equally for the same expression system. However, those skilled in the art can make appropriate choices among various vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden. For example, in selecting a vector, the host must be considered, since the vector must be replicated in it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

In addition, the gene introduced in the present invention may be introduced into the genome of the host cell and present as a chromosome factor. It will be apparent to those skilled in the art that the present invention may have the same effect as when the recombinant vector is introduced into the host cell even when the gene is inserted into the genomic chromosome of the host cell.

In the present invention, the metabolic circuit is not limited to the pathway of synthesizing the target compound from the carbon provided through the C1 metabolic cycle or glycolysis, and encompasses the pathway of synthesis of the target compound from specific metabolites in cells.

In another aspect, the present invention (a) culturing the mutant cells to biosynthesize methionine; And (b) relates to a method for producing methionine, comprising the step of recovering the biosynthetic methionine.

Methionine can be produced on a large scale by the manufacturing method, and may be recovered from the medium after culturing and used for various industrial purposes, including, but not limited to, animal feed, pharmaceuticals, food additives, cosmetics, and diet supplements.

The formic acid metabolism circuit, on the other hand, supports DNA synthesis and repair pathways through the generation of nucleic acid building blocks, which are deoxythymidine from deoxyuridine monophosphate (dUMP) through the addition of methyl groups by the enzyme thymidylate synthase. De novo synthesis of monophosphate (dTMP, 5-CH2-dUMP) was followed by deoxynucleotide triphosphate synthesis. Thymidine triphosphate (dTTP) is one of the four DNAs essential for DNA synthesis and repair. DNA synthesis is limited by the level of intracellular dTTP.

In the tetrahydrofolate C1 metabolic circuit of the present invention, homocysteine is converted to methionine by the action of 5-methyl-THF-homocysteine S-methyltransferase (EC 2.1.1.13). Some of the methionine produced then produces S-adenosyl methionine (SAM or SAdoMet), phosphate and diphosphate with ATP by methionine adenosyl transferase. S-adenosyl methionine is a key substrate of methyl transferases and participates in over 100 methylation reactions of biological molecules such as lipids and peptides. Methylation of DNA is an important epigenetic modification that uses S-adenosyl methionine as a methyl donor. Folate levels and metabolism are used to synthesize and repair DNA in normal and malignant cells through DNA methylation. very important.

We convert genes encoding enzymes that convert formyl tetrahydrofolate to methenyl tetrahydrofolate, genes encoding enzymes that convert methenyl tetrahydrofolate to methylene tetrahydrofolate, and glycine to serine When the expression of the gene selected from the group consisting of the gene encoding the enzyme is suppressed or reduced it was confirmed that the occurrence and metastasis of cancer is reduced.

Accordingly, the present invention provides in another aspect a gene encoding an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate, a gene encoding an enzyme for converting methenyl tetrahydrofolate to methylene tetrahydrofolate, and A substance that inhibits the expression of a gene selected from the group consisting of genes encoding enzymes that convert glycine to serine; Specific for an enzyme selected from the group consisting of an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate, an enzyme for converting methenyl tetrahydrofolate to methylene tetrahydrofolate, and an enzyme for converting glycine to serine It relates to an anticancer composition comprising an inhibitor that binds to an active ingredient.

In the present invention, the substance that inhibits the expression of the gene may be characterized in that the siRNA, antisense-oligonucleotide, shRNA, miRNA or a vector comprising one of them, but is not limited thereto.

In the present invention, the inhibitor may be an antibody or an aptamer, but is not limited thereto.

The anticancer composition according to the present invention may be a pharmaceutical composition and includes a case containing an pharmaceutically acceptable carrier together with the inhibitor as an active ingredient. The pharmaceutically acceptable carrier includes all carriers commonly used in the art, and may be, for example, one or more selected from the group consisting of water, saline, phosphate buffered saline, dextrin, glycerol, ethanol, and the like. It doesn't happen.

Patients to be administered the pharmaceutical compositions of the present invention may be mammals, preferably humans, monkeys, rodents (mouses, rats), and especially have a disease or condition associated with the expression of methionine or require increased methionine expression All may be mammals, such as humans.

Cancer that can be treated by the pharmaceutical composition according to the present invention is lung cancer, liver cancer, colon cancer, pancreatic cancer, gastric cancer, breast cancer, ovarian cancer, kidney cancer, thyroid cancer, esophageal cancer, prostate cancer, etc. solid and osteosarcoma, soft tissue sarcoma, nerve It may be one or more selected from the group consisting of glioma.

The pharmaceutical composition according to the present invention may be introduced into cells in vivo or ex vivo for the treatment of cancer. When the inhibitor of the present invention is introduced into a cell, the production of S-adenosyl methionine, which is a target protein, is increased, thereby killing cancer cells and treating cancer.

The pharmaceutical compositions of the present invention may be formulated for topical, oral or parenteral administration. Specifically, topical administration including intramucosal, vaginal, or anal administration, or parenterals such as lungs, bronchial, nasal, cortical, endothelial, intravenous, arterial, subcutaneous, abdominal, muscle, and cranial (meninges or ventricles). Oral administration or oral administration. For topical administration, the pharmaceutical compositions can be formulated in the form of patches and ointments, lotions, creams, gels, drops, suppositories, sprays, solutions, powders and the like. For parenteral administration, dura mater or intraventricular administration, the pharmaceutical composition may comprise a sterile aqueous solution containing suitable additives such as buffers, diluents, penetration enhancers, and other commonly used pharmaceutically acceptable carriers or excipients.

In addition, the pharmaceutical composition of the present invention is mixed with the composition for injection to generate a tumor

Administration to the site in the form of injection, or mixed with a gel composition or adhesive composition for transdermal absorption, it is preferable to implement to be administered by the transdermal route by applying directly to or attached to the affected area. The injectable composition is not particularly limited but is preferably in the form of an isotonic aqueous solution or suspension, and is preferably sterilized, and / or adjuvants (eg, preservatives, stabilizers, wetting or emulsifier solution accelerators, salts for controlling osmotic pressure, buffers). And / or liposome preparations). The gel composition contains a conventional gel preparation, such as carboxymethyl cellulose, methyl cellulose, acrylic acid polymer, carbopol, and a pharmaceutically acceptable carrier and / or liposome preparation, wherein the adhesive composition for transdermal absorption is an active ingredient. The layer may include an adhesive layer, an adsorption layer for sebum absorption, and a therapeutic drug layer, and the therapeutic drug layer may include, but is not limited to, a pharmaceutically acceptable carrier and / or liposome agent.

An effective amount of the inhibitor according to the present invention means an amount required for administration to obtain cancer cell growth inhibition and cancer therapeutic effect. Thus, the type of disease, the extent of symptoms, the type of inhibitor administered, the type of dosage form, the age, body weight, general health, sex and diet, time of administration, route of administration and duration of treatment, chemical anticancer agents used simultaneously, etc. It may be appropriately adjusted according to various factors including the drug. For example, the daily dose may be 0.001 mg / kg to 100 mg / kg, and the dose may be administered all at once or in several portions.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only to illustrate the invention, it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as limited by these examples.

In particular, the following examples exemplify specific Clostridium acetobutylicum only as organisms for gene knockdown according to the present invention, although formyl tetrahydrofolate may be converted to methenyl tetrahydrofolate even if other organisms are used. To a host microorganism having a gene encoding a converting enzyme and / or a gene encoding an enzyme converting methenyl tetrahydrofolate to methylene tetrahydrofolate and / or a gene encoding an enzyme converting glycine to serine It will also be apparent to those of ordinary skill in the art to control the same gene and use it to have a C1 metabolic circuit with improved methionine biosynthesis.

Example  One: Formyl Tetrahydrofolate Methenyl With tetrahydrofolate  Construction of a Plasmid for Knockdown of Genes Encoding Converting Enzymes

CAC2310 antisense to knock down the CAC2310 gene (SEQ ID NO: 1), a gene encoding the enzyme converting formyl tetrahydrofolate to methenyl tetrahydrofolate in the host microorganism Clostridium acetobutylicum. ) (SEQ ID NO: 2) was prepared as follows.

[SEQ ID NO 1] CAC2310  gene

5'-atgttacaggatatatctatagaggaatttataaaagaacttgcatcggaaaaaccaactcctggcggcggtggagcggcagcactttcagcagcactttcagcagcgcttaattgtatggtgtttaactttaccgtaggaaaaaaagtttatgaaaattatgataaagaaactaaaaaattaatcaatagcagtctagaaaaatcagacaagcttaaggattatttcttatgtggtatagataaagatgcggaggctttctcaaaaataataaatagttacaaacttccccaaagtacagaagaagaaaaagcatataggcataaatgtatacaagaagcttcaaaatttgcagcaaaagtaccagaagatgtagccaataatgcacgtgaactttttgaattgatttggatttcagcaaagttaggaaataaaaatcttataacagatgctggggcagctgcaataatggctgaagcagctattgaaacatcaatattgaatataaagataaacataggatctatagaggataaggagttaaaagcaagacttgaaaaaacttgcagagatttacttttagatagtaaagaatggaaagataaaatattaagtgaagtatattcgaatatatag-3 '

[SEQ ID NO 2] CAC2310 Antisense

5'-tatctataccacataagaaataatccttaagcttgtctgatttttctagactgctattgattaattttttagtttctttatcataattttcataaactttttttcctacggtaaagttaaacaccatacaattaagcgctgctgaaagtgctgctgaaagtgctgccgctccaccgccgccaggagttggtttttccgatgcaagttcttttataaattcctctatagatatatcctgtaacataaattccctccaatagtttatagcatttctataattctttgcacttattagaaaactataatttttattttaacttatattttatcatgttttctaaataataaaagcataaattatgtatgagagcaagaatttaacctaagttcttgctctcatattaattatttcataacaagatgctttttttcagagtatggcatactccagtaatttctgtatatatgattttcaatatcctttggttcataatgtgctttagattctcctacttcgcctacaggtgttattgcaacaactgaatatttatctggtattctaagctcatctttcatacgtttctcat-3 '

First, a well-known pTHL1-Cm vector (Jang et al., Biotech. Prog. 29: 10831088, 2013) was used as a vector for CAC2310 antisense expression. The vector incorporates a thiolated promoter, which is known to be capable of continuously and stably expressing genes without being strongly influenced by the cell growth cycle (Tummala et al., Appl. Environ. Microbiol., 65: 3793-3799, 1999). For expression of CAC2310 antisense, genomic DNA of Clostridium acetobutylicum ATCC 824 strain was used as a template at the PstI and AvaI restriction enzymes of the pTHL1-Cm vector, and then amplified using SEQ ID NO: 3 and SEQ ID NO: DNA fragments were cloned.

[SEQ ID NO 3]: 5'-CTGCAGTGAGAAAGCCTCCGCATCTT-3 '

[SEQ ID NO 4]: 5'-CCCGGGCCTGCTGGATTGCTTCCTTTG-3 '

Example  2: Methenyl Tetrahydrofolate  Methylene With tetrahydrofolate  Construction of a Plasmid for Knockdown of Genes Encoding Converting Enzymes

CAC2083 antisense to knock down the CAC2083 gene (SEQ ID NO: 5), a gene encoding the enzyme converting methenyl tetrahydrofolate to methylene tetrahydrofolate in the host microorganism Clostridium acetobutylicum. ) (SEQ ID NO: 6) was prepared in the same manner as in Example 1.

[SEQ ID NO 5] CAC2083  gene

5'-atgggagatataattaatggaaaagcggaatctcaaaagtataaagataaaataattgaatttattaatgaaagaaagaaacaggggttagatattccatgcatagccagtataacagttggagatgatgggggctcattatactatgttaacaatcaaaaaaaagtatcagaaagtcttggaattgagtttaagagtatatttttagatgaaagtatacgagaggaagaactaataaagttaattgaaggtctaaacgtagataataaaattcatggaattatgcttcaattaccgctgcctaatcacattgatgcaaaactagtcacatctaaaatagatgctaataaagatatagatagtcttacagatataaatacaggaaaattttacaagggtgaaaaatcatttataccatgcacgccaagaagtattataaatcttataaagagtttaaatgtggatatttgtgggaaaaatgcagttgtaatagggagaagtaacattgtaggtaaacctacagcgcagcttttactaaatgaaaatgcaacggttacaatatgccactctagaacacaaaacttaaaagatatatgtaaaaaagctgatattattgtaagtgctattggaagaccaggttttataacagatgaatttgttaatgaaaaatctattgtaattgatgttggaactacagtagtagatggtaaacttcgtggagatgtggtttttgatgaggttataaaaaaggcagcttacgtaactccagttcctgggggagtaggggcgatgacaaccacaatgttaatattaaatgtttgtgaggcattgaaataa-3 '

[SEQ ID NO 6] CAC2083 Antisense

5'-ttcctctcgtatactttcatctaaaaatatactcttaaactcaattccaagactttctgatacttttttttgattgttaacatagtataatgagcccccatcatctccaactgttatactggctatgcatggaatatctaacccctgtttctttctttcattaataaattcaattattttatctttatacttttgagattccgcttttccattaattatatctcccatacacaactactctcctttaaattatcatttttcctcagaactatttattaaatttccaataactccattaacaaatgagaaagagttctcttcagcataactttttgcaagttcaacagcctcatttgcagaaaccttacaaggtatatccttttcgaagaatatttcatatgctgccatcctaagtatggtgatatttatcttggatattctgcttatcttccacttcttgg-3 '

That is, amplification using genomic DNA of Clostridium acetobutylicum ATCC 824 strain at the PstI and AvaI restriction enzyme sites of the pTHL1-Cm vector having a thiolase promoter as a template was performed using SEQ ID NO: 7 and SEQ ID NO: 8 below. One DNA fragment was cloned.

[SEQ ID NO 7]: 5'-CTGCAGCTTCAATTAACTTTATTAGTTC-3 '

[SEQ ID NO 8]: 5'-CCCGGGTTCTAAAATTGAAGAAAGCT-3 '

Example  3: gene encoding an enzyme that converts glycine to serine For knockdown  Plasmid Construction

Expressing CAC2264 antisense (SEQ ID NO: 10) to knock down the CAC2264 gene (SEQ ID NO: 9), a gene encoding the enzyme converting glycine to serine in the host microorganism Clostridium acetobutylicum The vector was produced in the same manner as in Example 1.

[SEQ ID NO 9] CAC2264  gene

caaaaatactataccatttgagaaaaagagtccttttataacaagtggaataagaatgggtacaccttcagttacaactagaggatttaaggaagaggaaatgaaaaaagtagcgtatttcataaactatgttatagagcatagagatgaagatttaagtgaaataaggaaacaagtttcagaattatgtagtggatttcctatatataagtaa-3 ’

[SEQ ID NO 10] CAC2264 Antisense

5'-tttaaaaagtttttttgccctttcacgtgcaagctcttcaactttatcaactacgtaacatccaccataatatctttttcctggatatccttctgcatacttattagttaaatatgaacccatagcttccattacagctttgcttgtgaagttttcagatgcaataagttctatattattttcttgtctcgcattttcttcttctatgatagaatagacttcagaatcacttacttttatattttcaaaatccatatataatacactccctcatacattaatttgctaagttaaaaaattatcaattttatgtatgattatataccaaaatagcgtagaattcaaataaaagtttgtgttataataatttctggtcagtatatatgacgaattttaattaaactatactatatcttttgaaaggttttgttaccctatgtctacagaaaaaattataaatttagctgcttatgcaggaaagattttacttcaaagtggagctgaaatatacagagtagaagaaactatgaataaaatttgtacagcctttaatgttaa-3 '

That is, amplification using the genomic DNA of Clostridium acetobutylicum ATCC 824 strain as a template at the PstI and AvaI restriction enzyme sites of the pTHL1-Cm vector containing the thiolase promoter was carried out using SEQ ID NO: 11 and SEQ ID NO: 12 below. One DNA fragment was cloned.

[SEQ ID NO 11]: 5'-CTGCAGGGCTGTACATTAGCATGCTCTGC-3 '

[SEQ ID NO 12]: 5'-CCCGGGGGGTAACAAAGCTTTCTGCCTCC-3 '

Example  4: Clostridium of the plasmid To acetobutylicum  Transformation

In the Clostridium acetobutylicum it was intended to introduce the recombinant vectors prepared in Examples 1, 2 and 3. Prior to this, the methylation of the vectors was induced to be suitable for transformation with Clostridium, namely Bacillus subtilis Phage 3T I methyltransferase expression vector, pAN1 (Mermelstein et al. , Appl Environ Microbiol, 59:. .. 1077, 1993) an embodiment containing E. coli TOP 10 (Invitrogen Corporation, Carlsbad, Calif, USA) for example 1, example 2 and conducted by introducing the recombinant vector prepared in example 3 Methylation was induced. Two kinds of methylated vectors were isolated and purified from E. coli, and introduced into Clostridium acetobutylicum ATCC 824 strain, which is well known as a type strain, to prepare a recombinant mutant microorganism.

Competent cells for transformation were prepared as follows. First inoculated with Clostridium acetobutylicum ATCC 824 strain in 10 ml CGM medium (Table 1) and incubated until the OD value is 0.6. The cultured strains were inoculated at 60% in 60 ml of 2X YTG medium (16 g Bacto Tryptone 16 g, Yeast extract 10 g, NaCl 4 g, Glucose 5 g, per liter) and incubated for 4-5 hours. After washing twice with a transform buffer (EPB, 15 ml of 270 mM sucrose, 110 µl of 686 mM NaH ₂ PO ₄ , pH 7.4, the microbial cells were suspended in the same buffer of 2.4 ml. (compent cell) 600 μl and 25 μl of recombinant plasmid DNA were mixed in a cuvette with 4 mm electrodes and subjected to electric shock under conditions of 2.5 kV, 25 uF, immediately suspended in 1 ml of 2X YTG medium. After incubation at 37 ° C. for 3 hours, the transformants ATCC824CAC2310kd, ATCC824CAC2083kd, and ATCC824CAC2264kd were selected by smearing on 2 × YTG solid medium containing 40 μg / ml of erythromycin.

Composition of CGM Medium ingredient Content (g / l) Glucose 8 K ₂ HPO ₄ 3H ₂ O 0.982 KH ₂ PO ₄ 0.75 MgSO ₄ 0.348 MnSO ₄ H ₂ O 0.01 FeSO ₄ 7H ₂ O 0.01 (NH ₄ ) ₂ SO ₄ 2 NaCl One Asparagine 2 p-Aminobenzoic acid 0.004 Yeast extract 5

Example  5: Culture for C1 Metabolic Cycle Analysis of Mutant Strains

The C1 metabolic circuit was analyzed by culturing the wild type Clostridium acetobutylicum strain ATCC 824 and the recombinant variant strains ATCC824CAC2310kd, ATCC824CAC2083kd and ATCC824CAC2264kd. To this end, a 30 ml test tube containing 10 ml of CGM medium containing ¹³ C-Formate was sterilized, taken out at 80 ° C. or higher, filled with nitrogen gas, and cooled to room temperature in an anaerobic chamber. Then, 40 μg / ml of erythromycin was added, and the recombinant mutant microorganisms were inoculated and incubated for 16 hours under anaerobic conditions at 37 ° C.

Example  6: Analysis of methionine biosynthesis by C1 metabolic circuit of mutant strain

After the incubation was completed, the wild-type strains and recombinant mutant strains ATCC824CAC2310kd, ATCC824CAC2083kd and ATCC824CAC2264kd were recovered and analyzed for amino acids constituting the cells (Agilent 6890N, 5875 XL MS system, Agilent 7683 automatic injector, column (HP-5MS, 30 m). , ID 0.25, film thickness 0.25 m, Agilent Technologies).

As a result, the control wild type strain showed a summed fractional labeling (SFL) of 10 for methionine, whereas the experimental strains of the recombinant strains ATCC824CAC2310kd, ATCC824CAC2083kd, and ATCC824CAC2264kd showed values of 11, 12, and 15, respectively. These results show that the methionine synthesis of the C1 metabolic cycle is improved in these three variants compared to the wild type strain.

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea Advanced Institute of Science and Technology          INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> An engineered cell having improved methionine biosynthetic          ability <130> P17-B020 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 636 <212> DNA <213> Clostridium acetobutylicum <400> 1 atgttacagg atatatctat agaggaattt ataaaagaac ttgcatcgga aaaaccaact 60 cctggcggcg gtggagcggc agcactttca gcagcacttt cagcagcgct taattgtatg 120 gtgtttaact ttaccgtagg aaaaaaagtt tatgaaaatt atgataaaga aactaaaaaa 180 ttaatcaata gcagtctaga aaaatcagac aagcttaagg attatttctt atgtggtata 240 gataaagatg cggaggcttt ctcaaaaata ataaatagtt acaaacttcc ccaaagtaca 300 gaagaagaaa aagcatatag gcataaatgt atacaagaag cttcaaaatt tgcagcaaaa 360 gtaccagaag atgtagccaa taatgcacgt gaactttttg aattgatttg gatttcagca 420 aagttaggaa ataaaaatct tataacagat gctggggcag ctgcaataat ggctgaagca 480 gctattgaaa catcaatatt gaatataaag ataaacatag gatctataga ggataaggag 540 ttaaaagcaa gacttgaaaa aacttgcaga gatttacttt tagatagtaa agaatggaaa 600 gataaaatat taagtgaagt atattcgaat atatag 636 <210> 2 <211> 587 <212> DNA <213> Artificial Sequence <220> <223> Antisense Sequence of CAC2310 gene <400> 2 tatctatacc acataagaaa taatccttaa gcttgtctga tttttctaga ctgctattga 60 ttaatttttt agtttcttta tcataatttt cataaacttt ttttcctacg gtaaagttaa 120 acaccataca attaagcgct gctgaaagtg ctgctgaaag tgctgccgct ccaccgccgc 180 caggagttgg tttttccgat gcaagttctt ttataaattc ctctatagat atatcctgta 240 acataaattc cctccaatag tttatagcat ttctataatt ctttgcactt attagaaaac 300 tataattttt attttaactt atattttatc atgttttcta aataataaaa gcataaatta 360 tgtatgagag caagaattta acctaagttc ttgctctcat attaattatt tcataacaag 420 atgctttttt tcagagtatg gcatactcca gtaatttctg tatatatgat tttcaatatc 480 ctttggttca taatgtgctt tagattctcc tacttcgcct acaggtgtta ttgcaacaac 540 tgaatattta tctggtattc taagctcatc tttcatacgt ttctcat 587 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC2310 antisense cloning <400> 3 ctgcagtgag aaagcctccg catctt 26 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC2310 antisense cloning <400> 4 cccgggcctg ctggattgct tcctttg 27 <210> 5 <211> 837 <212> DNA <213> Clostridium acetobutylicum <400> 5 atgggagata taattaatgg aaaagcggaa tctcaaaagt ataaagataa aataattgaa 60 tttattaatg aaagaaagaa acaggggtta gatattccat gcatagccag tataacagtt 120 ggagatgatg ggggctcatt atactatgtt aacaatcaaa aaaaagtatc agaaagtctt 180 ggaattgagt ttaagagtat atttttagat gaaagtatac gagaggaaga actaataaag 240 ttaattgaag gtctaaacgt agataataaa attcatggaa ttatgcttca attaccgctg 300 cctaatcaca ttgatgcaaa actagtcaca tctaaaatag atgctaataa agatatagat 360 agtcttacag atataaatac aggaaaattt tacaagggtg aaaaatcatt tataccatgc 420 acgccaagaa gtattataaa tcttataaag agtttaaatg tggatatttg tgggaaaaat 480 gcagttgtaa tagggagaag taacattgta ggtaaaccta cagcgcagct tttactaaat 540 gaaaatgcaa cggttacaat atgccactct agaacacaaa acttaaaaga tatatgtaaa 600 aaagctgata ttattgtaag tgctattgga agaccaggtt ttataacaga tgaatttgtt 660 aatgaaaaat ctattgtaat tgatgttgga actacagtag tagatggtaa acttcgtgga 720 gatgtggttt ttgatgaggt tataaaaaag gcagcttacg taactccagt tcctggggga 780 gtaggggcga tgacaaccac aatgttaata ttaaatgttt gtgaggcatt gaaataa 837 <210> 6 <211> 461 <212> DNA <213> Artificial Sequence <220> <223> Antisense Sequence of CAC2083 gene <400> 6 ttcctctcgt atactttcat ctaaaaatat actcttaaac tcaattccaa gactttctga 60 tacttttttt tgattgttaa catagtataa tgagccccca tcatctccaa ctgttatact 120 ggctatgcat ggaatatcta acccctgttt ctttctttca ttaataaatt caattatttt 180 atctttatac ttttgagatt ccgcttttcc attaattata tctcccatac acaactactc 240 tcctttaaat tatcattttt cctcagaact atttattaaa tttccaataa ctccattaac 300 aaatgagaaa gagttctctt cagcataact ttttgcaagt tcaacagcct catttgcaga 360 aaccttacaa ggtatatcct tttcgaagaa tatttcatat gctgccatcc taagtatggt 420 gatatttatc ttggatattc tgcttatctt ccacttcttg g 461 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC2083 antisense cloning <400> 7 ctgcagcttc aattaacttt attagttc 28 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC2083 antisense cloning <400> 8 cccgggttct aaaattgaag aaagct 26 <210> 9 <211> 1236 <212> DNA <213> Clostridium acetobutylicum <400> 9 atggattttg aaaatataaa agtaagtgat tctgaagtct attctatcat agaagaagaa 60 aatgcgagac aagaaaataa tatagaactt attgcatctg aaaacttcac aagcaaagct 120 gtaatggaag ctatgggttc atatttaact aataagtatg cagaaggata tccaggaaaa 180 agatattatg gtggatgtta cgtagttgat aaagttgaag agcttgcacg tgaaagggca 240 aaaaaacttt ttaaagcaga gcatgctaat gtacagccac attcaggttc acaagctaat 300 atggctgttt actttgcagt attgaagccg ggagacacta taatgggaat gaacctaaca 360 gatggaggtc atttaactca tggaagtcca gttaattttt caggaaaact ctttaatata 420 attgcctatg gtgtaagtga tgaaacagaa caaatagatt atgaagcgtt tagaaaaaaa 480 gccttggagt gtaagccaaa gatgatagta tctggtgcta gtgcatattc aagaattatt 540 gattttaaga aaataagaga aatatgcgat gaagtaggag catatatgat ggtagatatg 600 gctcatatag caggacttgt agcagcagga cttcatccgt caccaattcc atatgctgat 660 tttgtaacaa caactactca taagacttta aggggaccaa gaggcggagc aattttctgc 720 aaggaaaagt atgcaaagga cattgataaa tctgtattcc ctggaatgca ggggggacct 780 ttaatgcaca taattgcagg aaaagcagta tgctttggag aagctttaaa ggatgatttt 840 aaagattatg cacagcaaat agtaaataat gcaaaagtgt ttgcagatga acttacaaaa 900 tacggtttta gaatagtttc aggtggaact gataatcacc ttttattagt tgatttaacg 960 aacaaaaata taacaggaaa agatgcagaa catcttcttg attcagttgg aataactgca 1020 aacaaaaata ctataccatt tgagaaaaag agtcctttta taacaagtgg aataagaatg 1080 ggtacacctt cagttacaac tagaggattt aaggaagagg aaatgaaaaa agtagcgtat 1140 ttcataaact atgttataga gcatagagat gaagatttaa gtgaaataag gaaacaagtt 1200 tcagaattat gtagtggatt tcctatatat aagtaa 1236 <210> 10 <211> 558 <212> DNA <213> Artificial Sequence <220> <223> Antisense Sequence of CAC2264 gene <400> 10 tttaaaaagt ttttttgccc tttcacgtgc aagctcttca actttatcaa ctacgtaaca 60 tccaccataa tatctttttc ctggatatcc ttctgcatac ttattagtta aatatgaacc 120 catagcttcc attacagctt tgcttgtgaa gttttcagat gcaataagtt ctatattatt 180 ttcttgtctc gcattttctt cttctatgat agaatagact tcagaatcac ttacttttat 240 attttcaaaa tccatatata atacactccc tcatacatta atttgctaag ttaaaaaatt 300 atcaatttta tgtatgatta tataccaaaa tagcgtagaa ttcaaataaa agtttgtgtt 360 ataataattt ctggtcagta tatatgacga attttaatta aactatacta tatcttttga 420 aaggttttgt taccctatgt ctacagaaaa aattataaat ttagctgctt atgcaggaaa 480 gattttactt caaagtggag ctgaaatata cagagtagaa gaaactatga ataaaatttg 540 tacagccttt aatgttaa 558 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC2264 antisense cloning <400> 11 ctgcagggct gtacattagc atgctctgc 29 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC2264 antisense cloning <400> 12 cccggggggt aacaaagctt tctgcctcc 29

Claims (12)

In cells of the genus Clostridium that have a tetrahydrofolate C1 metabolic circuit, a gene encoding an enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate, methylene tetrahydrofolate A mutation in which a gene selected from the group consisting of a gene encoding an enzyme converting to hydrofolate and a gene encoding an enzyme converting glycine to serine is deleted or the expression of the gene is suppressed or reduced, thereby increasing the biosynthesis of methionine cell.

The method of claim 1,
The gene encoding the enzyme for converting formyl tetrahydrofolate to methenyl tetrahydrofolate is represented by SEQ ID NO: 1,
The gene encoding the enzyme for converting methenyl tetrahydrofolate to methylene tetrahydrofolate is represented by SEQ ID NO: 5,
The gene encoding the enzyme for converting glycine to serine is a mutant cell, characterized in that represented by SEQ ID NO: 9.
delete delete The method of claim 1, wherein the Clostridium genus cells are Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium sacchabutyllicum saccharobutylicum, Clostridium saccharoperbutylacetonicum, Clostridium perfringens, Clostridium tetani, Clostridium difficile, Clostridium difficile Clostridium butyricum, Clostridium butylicum, Clostridium kluyveri, Clostridium tyrobutylicum and Clostridium tyrobutyricum tyrobutyricum), characterized in that any one selected from the group consisting of mutant cells.

The mutant cell of claim 1, wherein the reduction or inhibition of gene expression is induced by the introduction of antisense into the gene.
The method of claim 6,
Antisense for the gene encoding the enzyme that converts formyl tetrahydrofolate to methenyl tetrahydrofolate is represented by SEQ ID NO: 2,
Antisense for the gene encoding the enzyme for converting methenyl tetrahydrofolate to methylene tetrahydrofolate is represented by SEQ ID NO: 6,
Antisense for a gene encoding an enzyme that converts glycine to serine is a mutant cell, characterized in that represented by SEQ ID NO: 10.
The mutant cell of claim 6, wherein the antisense is introduced in the form of a plasmid.
(A) biosynthesizing methionine by culturing the variant cells of any one of claims 1, 2, 5 to 8; And
(b) recovering the biosynthesized methionine.
delete delete delete

Images