KR20180097816A - An engineered cell having improved methionine biosynthetic ability - Google Patents

Abstract

The present invention relates to mutant cells having improved methionine biosynthetic ability, and more specifically, to mutant cells having improved methionine biosynthetic ability, wherein the expression of a gene encoding an enzyme converting formyltetrahydrofolate to methenyltetrahydrofolate and/or a gene encoding an enzyme converting formyltetrahydrofolate to methylenetetrahydrofolate and/or a gene encoding an enzyme converting glycine to serine is inhibited or reduced in cells having tetrahydrofolate C1 metabolic pathway, thus improving methionine biosynthetic ability. The mutant cells of the present invention can be cultured to produce methionine in a large batch and can be retrieved from the culture media after the culture to be used for various industrial uses including animal feeds, drugs, food additives, cosmetics and diet supplements. In addition, the present invention can increase the production of S-adenosylmethionine (SAM) mediated by the above reaction, and further can induce methylation of various (biochemical) compounds to enhance anticancer effects thereof by using SAM as a methyl group donor.

Description

An engineered cell having improved methionine biosynthetic ability

TECHNICAL FIELD The present invention relates to a mutant cell having improved methionine biosynthesis ability, and more particularly, to a mutant cell having a methionine tyrosine kinase activity in a cell having a tetrahydrofolate C1 metabolism circuit, a gene encoding an enzyme that converts formyltetrahydrofolate to methenyltetrahydrofolate And / or a gene encoding an enzyme that converts methanetetrahydrofolate to methylene tetrahydrofolate and / or a gene encoding an enzyme that converts glycine to serine is inhibited or decreased, thereby enhancing methionine biosynthesis ability Lt; / RTI > cells.

As demand for petroleum dependency and greenhouse gas reduction increases worldwide, demand for the development of technologies for the production of transport fuels and basic chemical materials based on C1 gas is increasing rapidly. C1 gas is a carbon (C) the number of first individual methane (CH ₄₎ gas and other carbon (C) the number of first individual carbon monoxide (CO) or carbon dioxide (CO ₂₎ derived from the synthesis gas, biogas and shale gas, such as natural gas (HCOOH). In recent years, countries including USA, Europe, China, and other countries have been studying biological, chemical, and biological activities to convert C1 gas derived from shale gas into useful compounds. We are investing vast budgets to study chemical methods.

The development of the original gas refinery technology for the recycling of greenhouse gas and by-product gas can be advantageous in securing global price competitiveness of basic chemical materials and creating a growth engine for the chemical industry. As such, a C1 metabolism circuit of a living organism can be utilized as a useful means for recycling the C1 gas. Most organisms use a tetrahydrofolate circuit for one carbon metabolism. Metabolism of tetrahydrofolate C1 is linked to serine cycle, nucleic acid methylation, methionine cycle and the like, and the metabolic circuit plays an important role in C1 migration, such as induction of methylation of the metabolite in living body through the metabolic circuit It is known. That is, since the methionine cycle connected to the C1 metabolism circuit and the metabolism circuit is connected to the central metabolism for biosynthesis of useful compounds such as acetylcoe and pyruvic acid, the useful compound can be synthesized with high efficiency when the metabolic circuit is appropriately utilized. However, techniques for efficiently producing useful compounds by using such metabolic circuits have not yet been developed. Therefore, in the art, there is a desperate need for a technique for synthesizing useful compounds using the metabolic circuits.

On the other hand, it is known that one of the causes of cancer is the methylation of hundreds of metabolites such as DNA, RNA, protein, and fat from S-adenosylmethionineme (SAM) These problems are expected to be solved through the smooth synthesis of methionine through the tetrahydrofolate metabolism circuit and their conversion to SAM.

Accordingly, the inventors of the present invention have found that (1) a mutant capable of producing a useful compound with high efficiency, or (2) a precursor of S-adenosylmethionine, As a result of intensive research on metabolic regulation, it was possible to improve the methionine production ability in the C1 metabolism circuit, and in particular, to (i) knock down a gene encoding an enzyme that converts formyltetrahydrofolate to methenyltetrahydrofolate, (Ii) knocking down a gene encoding an enzyme that converts methenyltetrahydrofolate to methylene tetrahydrofolate, or (iii) knocking down a gene encoding an enzyme involved in the conversion of glycine to serine, or Iv) The production of methionine is significantly increased in the C1 metabolism of organisms knocked down by combining these three genes It was confirmed and completed the invention. In addition, the inventors of the present invention have completed the present invention by confirming that the introduction of the siRNAs of the above genes can improve the cancer treatment efficiency in order to smoothly supply the precursor of S-adenosylmethionine.

It is an object of the present invention to provide a mutant cell in which the biosynthesis of methionine is increased.

Another object of the present invention is to provide a method for producing metanin using the above mutant cells.

It is another object of the present invention to provide a novel anti-cancer composition.

In order to accomplish the above object, the present invention provides a method for the production of a gene encoding a gene encoding an enzyme that converts formyltetrahydrofolate to methinyltetrahydrofolate in a cell having a tetrahydrofolate C1 metabolic circuit, methanetetrahydrofolate A gene coding for an enzyme that converts an enzyme for converting glycine into serine into methylene tetrahydrofolate and a gene encoding an enzyme for converting glycine to serine are deleted or the expression of the gene is suppressed or decreased do.

The present invention also relates to a method for producing a mutant cell, comprising: culturing the mutant cell to biosynthesize methionine; And recovering the biosynthesized methionine. ≪ Desc / Clms Page number 5 >

The present invention also relates to a gene encoding an enzyme involved in the conversion of formyl tetrahydrofolate to methenyl tetrahydrofolate, a gene encoding an enzyme involved in methylene tetrahydrofolate conversion from methanetetrahydrofolate, and An inhibitor for a gene selected from the group consisting of a gene encoding an enzyme involved in the conversion of serine from glycine, wherein the inhibitor is a vector comprising siRNA, antisense oligonucleotide, shRNA, miRNA or one of them Or a pharmaceutically acceptable salt thereof.

The present invention also relates to a gene encoding an enzyme that converts formyl tetrahydrofolate to methanetetrahydrofolate, a gene that encodes an enzyme that converts methanetetrahydrofolate to methylene tetrahydrofolate, and a gene that encodes glycine as serine A substance that inhibits the expression of a gene selected from the group consisting of genes encoding an enzyme that converts; An enzyme that converts formyl tetrahydrofolate to methenyl tetrahydrofolate, an enzyme that converts methanetetrahydrofolate to methylene tetrahydrofolate, and an enzyme that converts glycine to serine. As an active ingredient.

The present invention provides a mutant cell in which the biosynthesis of methionine is increased by regulating the expression level of a specific gene encoding an enzyme involved in the C1 metabolic pathway. When the mutant cell is cultured, methionine can be easily produced on a large scale , Recovered from the medium after culture and can be used in a variety of industrial applications including animal feed, pharmaceuticals, food additives, cosmetics, and dietary supplements. In addition, since the production of S-adenosylmethionine (SAM) can be increased through the above-mentioned reaction, it can be used as a methyl group donor to induce the methylation reaction of various (living) .

FIG. 1 shows the pathway in which the expression of an enzyme involved in the conversion of formyltetrahydrofolate to methenyltetrahydrofolate is inhibited or reduced and blocked in the tetrahydrofolate C1 metabolism circuit.
Figure 2 shows the pathway in which inhibition or reduction of the expression of enzymes involved in methylene tetrahydrofolate conversion from methanetetrahydrofolate is blocked in the tetrahydrofolate C1 metabolism circuit.
Fig. 3 shows a pathway in which the expression of an enzyme involved in the conversion of serine from glycine is inhibited or reduced in the tetrahydrofolate C1 metabolism circuit.
Figure 4 shows the one-carbon (C1) delivery pathway using the tetrahydrofolate metabolism circuit.
Figure 5 shows the mechanism of cancer induction via methyl sink in the tetrahydrofolate metabolism circuit.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In the present invention, the tetrahydrofolate C1 metabolic circuit is a circulating metabolic circuit for one-carbon (C1) transfer, in which a formulated molecule meets with tetrahydrofolate to formyl-tetrahydrofolate (Formyl-THF) In a pathway that metabolizes tetrahydrofolate via methyl-tetrahydrophthalate (Methylen-THF), methylene-tetrahydrofolate (Methylen-THF) and methyl- tetrahydrofolate, homocysteine is converted to methionine , And glycine (Glycine) to serine (serine).

The present inventors have found that the expression of genes encoding enzymes involved in the conversion of formyl tetrahydrofolate to methanetetrahydrofolate in cells having a tetrahydrofolate C1 metabolic circuit can be regulated or methanetetrahydrofolate It is confirmed that the expression of methionine biosynthesis is changed when the expression of a gene encoding an enzyme involved in methylene tetrahydrofolate conversion is controlled or the expression of a gene encoding an enzyme involved in the conversion of serine from glycine is regulated, It was confirmed that methionine biosynthesis was increased when the expression of any one of the three enzymes was inhibited or decreased.

Thus, in one aspect, the present invention relates to a method for treating a cell that has a tetrahydrofolate C1 metabolic circuit in a cell, a gene encoding an enzyme that converts formyltetrahydrofolate to methinyltetrahydrofolate, a methinyltetrahydrofolate, A gene coding for an enzyme which converts to tetrahydrofolate and a gene coding for an enzyme for converting glycine to serine are deleted or the expression of the gene is inhibited or reduced.

In the present invention, the enzyme which converts the formyl tetrahydrofolate to methenyl tetrahydrofolate is formidido-tetrahydrophosphate cyclodiaminease, and the methinyltetrahydrofolate is converted to methyltetrahydrofolate The enzyme that converts to folate is formyl-tetrahydrofolate cyclohydrolase / methylyleene-tetrahydrofolate dihydrogenase and an enzyme that converts glycine to serine The coding gene may be, but is not limited to, serine hydroxymethyltransferase.

In the present invention, the gene coding for the formidido-tetrahydrophosphate cyclic formamide (THF) is ftcd represented by the nucleotide sequence of SEQ ID NO: 1, and the formyl-tetrahydrophthalic acid cyclohydrolase / The gene encoding formyl-THF cyclohydrolase / methylene-THF dehydrogenase is folD represented by the nucleotide sequence of SEQ ID NO: 5, and the serine hydroxymethyltransferase is a gene encoding the methylene-tetrahydrofolate dihydrogenase . May be, but is not limited to, glyA represented by the nucleotide sequence of SEQ ID NO: 9.

In the present invention, the mutant cell may be characterized in that the biosynthesis of methionine is increased.

In the present invention, the cell having the tetrahydrofolate C1 metabolic circuit may be any one selected from the group consisting of human cells, bacteria, yeast, fungi, plant cells, animal cells, algae and microalgae.

The cell having the tetrahydrofolate C1 metabolic circuit may preferably be a bacterium and the bacterium is selected from the group consisting of a methanogenic bacterium, a methanogenic bacterium, an acetone, an Escherichia coli, a Corynebacterium, a crab cilia, a yeast, But are not limited to, Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, But are not limited to, Clostridium perfringens, Clostridium tetani, Clostridium difficile, Clostridium butyricum, Clostridium butylicum, Clostridium kluyveri, Clostridium tyrobutylicum, and Clostridium < RTI ID = 0.0 > And Clostridium tyrobutyricum, and most preferably Clostridium acetobutylicum. However, the present invention is not limited thereto.

In the present invention, the decrease or suppression of gene expression can be induced by introduction of an antisense oligonucleotide to the gene, but not limited thereto, and it is possible to reduce or suppress the expression of the gene, Technology can all be utilized.

In the present invention, the antisense to the gene encoding the enzyme that converts formyltetrahydrofolate to methenyltetrahydrofolate is represented by SEQ ID NO: 2, and the enzyme that converts methenyltetrahydrofolate to methylene tetrahydrofolate And the antisense to the gene encoding the enzyme that converts glycine to serine may be characterized by being represented by SEQ ID NO: 10.

The antisense represented by SEQ ID NO: 2 inhibits or reduces the expression of ftcd represented by the nucleotide sequence of SEQ ID NO: 1, which is a gene coding for formidido-tetrahydrofolate cyclodiaminephosphate (formimido-THF cyclodeaminase) The antisense represented by SEQ ID NO: 6 is a nucleotide sequence of SEQ ID NO: 5 which is a gene encoding formyl-tetrahydrofolate cyclohydrolase / methylyleene-methylene-THF dehydrogenase inhibiting or reducing folD expression of SEQ ID NO: and, antisense represented by the SEQ ID NO: 10 is the glyA expression represented by the base sequence of the gene of SEQ ID NO: 9 coding for serine hydroxymethyl transferase race (serine hydroxymethyltransferase) Inhibiting or decreasing the number of the cells.

In the present invention, the antisense may be introduced in a plasmid form, but is not limited thereto.

In the present invention, "regulation" of a gene includes all the steps of inducing gene expression by techniques such as deletion, expression inhibition, expression enhancement, knockdown, It is a concept encompassing the evolution or mutation of one or more of the existing enzymes.

In the present invention, "knockdown" means that the function of the gene is reduced by significantly reducing the expression amount of the gene, unlike the " knock-out " It can be regulated at the transcript level or at the protein level of the gene. However, the present invention relates to a method for producing a methionine tetrahydrofolate in a cell having a tetrahydrofolate C1 metabolism circuit, wherein a gene encoding an enzyme that converts formyltetrahydrofolate to methinyltetrahydrofolate and / or methynyltetrahydrofolate is reacted with methylene tetra Quot; knock-out "and" knock-out "because the expression of a gene encoding an enzyme that converts to a hydroxylase and / or an enzyme that converts an enzyme that converts glycine into serine It is also possible to accomplish the purpose of scavenging.

As used herein, the term "vector" means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several to several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector, (C) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA. After ligation, the vector should be transformed into the appropriate host cell. Transformation can be readily accomplished using a calcium chloride method or electroporation (Neumann, et al., EMBO J., 1: 841, 1982). The vector of the present invention is characterized by including a transcription initiation signal and a promoter so that antisense of the gene to be knocked down can be generated.

The promoter of the vector may be constitutive or inducible and may be further modified for the purposes of the present invention. In one embodiment of the present invention, a thiolase promoter is used. The expression vector also includes a selectable marker for selecting a host cell containing the vector, and a replication origin (Ori) in the case of a replicable expression vector. The vector may be self-replicating or integrated into the host genomic DNA. Preferably, the gene is inserted into the vector so that the transferred gene is irreversibly fused into the genome of the host cell, so that the gene expression in the cell can be stably maintained for a long period of time.

Specifically, the vector used in the present invention may be replaced with a vector such as pTHL1-Cm vector, or a vector such as pIMP1, pMTL21E, or pIM13 that is commonly used in the art to suppress the expression of the gene.

A nucleotide sequence is "operably linked" when placed in a functional relationship with another nucleic acid sequence. This may be the gene and regulatory sequence (s) linked in such a way as to enable gene expression when a suitable molecule (e. G., Transcriptional activator protein) is attached to the regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a whole protein participating in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; Or a ribosome binding site is operably linked to a coding sequence if positioned to facilitate translation. Generally, "operably linked" means that the linked DNA sequences are in contact and, in the case of a secretory leader, are in contact and present in the reading frame. However, the enhancer need not be in contact. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction sites. If such a site does not exist, a synthetic oligonucleotide adapter or a linker according to a conventional method is used.

As is well known in the art, in order to increase the expression level of a transgene in a host cell, the gene must be operably linked to a transcriptional and / or detoxification regulatory sequence that functions in a selected expression host. Preferably, the expression control sequence and / or the gene is contained within a recombinant vector containing a bacterial selection marker and a replication origin. If the host cell is a eukaryotic cell, the recombinant vector should further comprise a useful expression marker in the eukaryotic expression host.

The host cells transformed with the recombinant vectors described above constitute another aspect of the present invention. As used herein, the term "transformation" means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration.

Of course, it should be understood that not all vectors function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

In addition, the gene introduced in the present invention may be introduced into the genome of a host cell to exist as a chromosomal factor. It will be apparent to those skilled in the art that the present invention has the same effect as that of introducing the recombinant vector into the host cell by inserting the gene into the genome of the host cell.

The term " metabolic pathway " in the present invention is a concept encompassing pathways in which a target compound is synthesized from a specific metabolite in a cell, not limited to a pathway in which a target compound is synthesized from carbon provided through a C1 metabolic circuit or a glycolysis process.

In another aspect of the present invention, there is provided a method for producing a mutant cell, comprising: (a) biosynthesizing methionine by culturing the mutant cell; And (b) recovering the biosynthesized methionine.

Methionine can be produced on a large scale by the above production method, and recovered from the medium after cultivation and used for various industrial applications including, but not limited to, animal feed, pharmaceuticals, food additives, cosmetics and diet supplements.

On the other hand, the formic acid metabolic pathway supports DNA synthesis and repair pathway through the formation of nucleic acid building blocks. This metabolism is induced by deoxyuridine monophosphate (dUMP) from deoxythymidine (dUMP) through the addition of methyl group by enzyme thymidylate synthase monophosphate (dTMP, 5-CH2-dUMP) synthesized de novo and then synthesized deoxynucleotide triphosphate. Thymidine triphosphate (dTTP) is one of the four DNA essential for DNA synthesis and repair. DNA synthesis is limited by the level of intracellular dTTP.

In the tetrahydrofolate C1 metabolism circuit of the present invention, homocysteine due to the action of 5-methyl-THF-homocysteine S-methyltransferase (EC 2.1.1.13) is converted to methionine. Some of the methionine produced is then produced by methionine adenosyltransferase with S-adenosylmethionine (SAM or SAdoMet), phosphate and diphosphate with ATP. S-adenosylmethionine is a key substrate for methyltransferases and participates in more than 100 methylation reactions of biological molecules such as lipids and peptides. DNA methylation is an important epigenetic modification that uses S-adenosylmethionine as a methyl donor, and folate and metabolism synthesize and repair DNA in normal and malignant cells through DNA methylation very important.

The present inventors have found that a gene encoding an enzyme that converts formyl tetrahydrofolate into methanetetrahydrofolate, a gene that encodes an enzyme that converts methanetetrahydrofolate into methylene tetrahydrofolate, and a gene that converts glycine to serine It is possible to confirm that the occurrence and metastasis of cancer are reduced when the expression of the gene selected from the group consisting of the genes coding for the enzymes is inhibited or decreased.

Accordingly, the present invention provides, in another aspect, a gene encoding an enzyme that converts formyl tetrahydrofolate to methanetetrahydrofolate, a gene that encodes an enzyme that converts methetyltetrahydrofolate to methylene tetrahydrofolate, A substance that inhibits the expression of a gene selected from the group consisting of a gene encoding an enzyme that converts glycine to serine; An enzyme that converts formyl tetrahydrofolate to methenyl tetrahydrofolate, an enzyme that converts methanetetrahydrofolate to methylene tetrahydrofolate, and an enzyme that converts glycine to serine. As an active ingredient.

In the present invention, the substance that inhibits expression of the gene may be siRNA, antisense-oligonucleotide, shRNA, miRNA, or a vector containing any of them, but is not limited thereto.

In the present invention, the inhibitor may be an antibody or a platemer, but is not limited thereto.

The anticancer composition according to the present invention may be a pharmaceutical composition and includes a carrier which is pharmaceutically acceptable together with the above-mentioned inhibitor as an active ingredient. The pharmaceutically acceptable carrier includes all carriers conventionally used in the art and may be one or more selected from the group consisting of water, saline, phosphate buffered saline, dextrin, glycerol, ethanol, and the like, It is not.

The subject to be treated of the pharmaceutical composition of the present invention may be a mammal, preferably a human, a monkey, a rodent (mouse, rat), and particularly has a disease or symptom associated with the expression of methionine, All of which may be mammals, such as humans.

Cancers which can be treated by the pharmaceutical composition according to the present invention include cancer such as lung cancer, liver cancer, colon cancer, pancreatic cancer, stomach cancer, breast cancer, ovarian cancer, kidney cancer, glioma adenocarcinoma, esophageal cancer, prostate cancer and other solid and osteosarcoma, Glioma, and the like.

The pharmaceutical composition according to the present invention can be introduced intracellularly in vivo or ex vivo for the treatment of cancer. When the inhibitor of the present invention is introduced into cells, the production of S-adenosylmethionine, which is a target protein, is increased, and cancer cells are killed and cancer treatment is enabled.

The pharmaceutical compositions of the present invention may be formulated for topical, oral, or parenteral administration. Specifically, it is preferable to use a topical administration including mucosal, vaginal, or intra-aortic administration of the eye, or an unspecified administration such as a lung, a bronchus, a nasal cavity, an outer skin, an endothelial administration, a vein, an artery, a subcutaneous, Oral administration, or the like. For topical administration, the pharmaceutical compositions may be formulated in the form of patches and ointments, lotions, creams, gels, powders, suppositories, sprays, solutions, powders, and the like. For parenteral, dural, or intracerebroventricular administration, the pharmaceutical compositions may include a sterile aqueous solution containing suitable additives such as buffers, diluents, permeation enhancers, and other typically pharmaceutically acceptable carriers or excipients.

In addition, the pharmaceutical composition of the present invention may be mixed with a composition for injection,

Or a gel composition or a percutaneous absorption-type adhesive composition, directly or indirectly administering the composition to the affected part by a transdermal route. The injectable composition is not particularly limited but is preferably in the form of an isotonic aqueous solution or suspension, and may be sterilized and / or supplemented with an adjuvant (for example, preservatives, stabilizers, wetting agents or emulsifier solution accelerators, salts for controlling osmotic pressure, And / or liposomal formulations). The gel composition contains a conventional gel preparation such as carboxymethyl cellulose, methyl cellulose, acrylic acid polymer, carbopol and the like, and a pharmaceutically acceptable carrier and / or liposome preparation, wherein the percutaneous absorption- Layer comprises a pressure sensitive adhesive layer, an adsorbent layer for absorbing sebum, and a therapeutic drug layer, wherein the therapeutic drug layer comprises, but is not limited to, a pharmaceutically acceptable carrier and / or a liposome preparation.

The effective amount of the inhibitor according to the present invention means an amount required for administration inhibition of cancer cell growth and cancer treatment. Therefore, it is preferable to administer the medicament such as the type of the disease, the degree of the symptom, the kind of the inhibitor to be administered, the type of the formulation, the patient's age, body weight, general health condition, sex and diet, And can be appropriately adjusted according to various factors including drugs. For example, the daily dose is preferably 0.001 mg / kg to 100 mg / kg, and the dose may be administered all at once or in several doses over several times.

Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

In particular, in the following examples, only Clostridium acetobutylicum is exemplified as an organism for gene knockdown according to the present invention. However, even if other organisms are used, it is also possible to use formyltetrahydrofolate as methinyltetrahydrofolate Or a gene encoding an enzyme that converts an enzyme that converts methanetetrahydrofolate into methylene tetrahydrofolate and / or a gene that encodes an enzyme that converts an enzyme that converts glycine into serine It will also be apparent to those skilled in the art that the same gene is regulated and used to have a C1 metabolic circuit with improved methionine biosynthesis.

Example  One: Formyl Tetrahydrofolate Methenyl Tetrahydrofolate  Production of gene knockdown plasmids encoding enzymes to switch

In order to knock down the CAC2310 gene (SEQ ID NO: 1), a gene encoding an enzyme that converts formyltetrahydrofolate to methenyltetrahydrofolate in clostridium acetobutylicum, the host microorganism, CAC2310 antisense ) (SEQ ID NO: 2) was constructed as follows.

[SEQ ID NO: 1] CAC2310  gene

5'-atgttacaggatatatctatagaggaatttataaaagaacttgcatcggaaaaaccaactcctggcggcggtggagcggcagcactttcagcagcactttcagcagcgcttaattgtatggtgtttaactttaccgtaggaaaaaaagtttatgaaaattatgataaagaaactaaaaaattaatcaatagcagtctagaaaaatcagacaagcttaaggattatttcttatgtggtatagataaagatgcggaggctttctcaaaaataataaatagttacaaacttccccaaagtacagaagaagaaaaagcatataggcataaatgtatacaagaagcttcaaaatttgcagcaaaagtaccagaagatgtagccaataatgcacgtgaactttttgaattgatttggatttcagcaaagttaggaaataaaaatcttataacagatgctggggcagctgcaataatggctgaagcagctattgaaacatcaatattgaatataaagataaacataggatctatagaggataaggagttaaaagcaagacttgaaaaaacttgcagagatttacttttagatagtaaagaatggaaagataaaatattaagtgaagtatattcgaatatatag-3 '

[SEQ ID NO: 2] CAC2310 Antisense

5'-tatctataccacataagaaataatccttaagcttgtctgatttttctagactgctattgattaattttttagtttctttatcataattttcataaactttttttcctacggtaaagttaaacaccatacaattaagcgctgctgaaagtgctgctgaaagtgctgccgctccaccgccgccaggagttggtttttccgatgcaagttcttttataaattcctctatagatatatcctgtaacataaattccctccaatagtttatagcatttctataattctttgcacttattagaaaactataatttttattttaacttatattttatcatgttttctaaataataaaagcataaattatgtatgagagcaagaatttaacctaagttcttgctctcatattaattatttcataacaagatgctttttttcagagtatggcatactccagtaatttctgtatatatgattttcaatatcctttggttcataatgtgctttagattctcctacttcgcctacaggtgttattgcaacaactgaatatttatctggtattctaagctcatctttcatacgtttctcat-3 '

First, the well-known pTHL1-Cm vector (Jang et al., Biotech. Prog. 29: 10831088, 2013) was used as a vector for expression of CAC2310 antisense. It has been known that a thialase promoter is introduced into the vector, and thyorase is capable of continuously and stably expressing the gene without being greatly affected by the cell growth cycle (Tummala et al., Appl. Environ. Microbiol., 65: 3793-3799, 1999). For CAC2310 antisense expression, PstI and AvaI restriction sites of the pTHL1-Cm vector were amplified using the genomic DNA of Clostridium acetobutylicum ATCC 824 as a template using SEQ ID NO: 3 and SEQ ID NO: 4 below DNA fragments were cloned.

[SEQ ID NO: 3]: 5'-CTGCAGTGAGAAAGCCTCCGCATCTT-3 '

[SEQ ID NO: 4]: 5'-CCCGGGCCTGCTGGATTGCTTCCTTTG-3 '

Example  2: Methenyl Tetrahydrofolate  Methylene Tetrahydrofolate  Production of gene knockdown plasmids encoding enzymes to switch

In order to knock down the CAC2083 gene (SEQ ID NO: 5), a gene encoding an enzyme that converts methenyltetrahydrofolate to methylene tetrahydrofolate, in the host microorganism Clostridium acetobutylicumum, CAC2083 antisense ) (SEQ ID NO: 6) was constructed in the same manner as in Example 1 above.

[SEQ ID NO: 5] CAC2083  gene

5'-atgggagatataattaatggaaaagcggaatctcaaaagtataaagataaaataattgaatttattaatgaaagaaagaaacaggggttagatattccatgcatagccagtataacagttggagatgatgggggctcattatactatgttaacaatcaaaaaaaagtatcagaaagtcttggaattgagtttaagagtatatttttagatgaaagtatacgagaggaagaactaataaagttaattgaaggtctaaacgtagataataaaattcatggaattatgcttcaattaccgctgcctaatcacattgatgcaaaactagtcacatctaaaatagatgctaataaagatatagatagtcttacagatataaatacaggaaaattttacaagggtgaaaaatcatttataccatgcacgccaagaagtattataaatcttataaagagtttaaatgtggatatttgtgggaaaaatgcagttgtaatagggagaagtaacattgtaggtaaacctacagcgcagcttttactaaatgaaaatgcaacggttacaatatgccactctagaacacaaaacttaaaagatatatgtaaaaaagctgatattattgtaagtgctattggaagaccaggttttataacagatgaatttgttaatgaaaaatctattgtaattgatgttggaactacagtagtagatggtaaacttcgtggagatgtggtttttgatgaggttataaaaaaggcagcttacgtaactccagttcctgggggagtaggggcgatgacaaccacaatgttaatattaaatgtttgtgaggcattgaaataa-3 '

[SEQ ID NO: 6] CAC2083 Antisense

5'-ttcctctcgtatactttcatctaaaaatatactcttaaactcaattccaagactttctgatacttttttttgattgttaacatagtataatgagcccccatcatctccaactgttatactggctatgcatggaatatctaacccctgtttctttctttcattaataaattcaattattttatctttatacttttgagattccgcttttccattaattatatctcccatacacaactactctcctttaaattatcatttttcctcagaactatttattaaatttccaataactccattaacaaatgagaaagagttctcttcagcataactttttgcaagttcaacagcctcatttgcagaaaccttacaaggtatatccttttcgaagaatatttcatatgctgccatcctaagtatggtgatatttatcttggatattctgcttatcttccacttcttgg-3 '

Namely, using the genomic DNA of Clostridium acetoButylicum ATCC 824 as a template as a template for the PstI and AvaI restriction sites of the pTHL1-Cm vector having the thiolase promoter, amplification was performed using SEQ ID NO: 7 and SEQ ID NO: 8 One DNA fragment was cloned.

[SEQ ID NO: 7]: 5'-CTGCAGCTTCAATTAACTTTATTAGTTC-3 '

[SEQ ID NO: 8]: 5'-CCCGGGTTCTAAAATTGAAGAAAGCT-3 '

Example  3: a gene encoding an enzyme that converts glycine to serine For knockdown  Plasmid production

(SEQ ID NO: 10) to knockdown the CAC2264 gene (SEQ ID NO: 9), which is a gene encoding an enzyme that converts glycine to serine, in the host microorganism Clostridium acetoButylicum. Vector was prepared in the same manner as in Example 1 above.

[SEQ ID NO: 9] CAC2264  gene

caaaaatactataccatttgagaaaaagagtccttttataacaagtggaataagaatgggtacaccttcagttagacagaggatttaaggaagaggaaatgaaaaaagtagcgtatttcataaactatgttatagagcatagagatgaagatttaagtgaaataaggaaacaagtttcagaattatgtagtggatttcctatatataagtaa-3 '

[SEQ ID NO: 10] CAC2264 Antisense

5'-tttaaaaagtttttttgccctttcacgtgcaagctcttcaactttatcaactacgtaacatccaccataatatctttttcctggatatccttctgcatacttattagttaaatatgaacccatagcttccattacagctttgcttgtgaagttttcagatgcaataagttctatattattttcttgtctcgcattttcttcttctatgatagaatagacttcagaatcacttacttttatattttcaaaatccatatataatacactccctcatacattaatttgctaagttaaaaaattatcaattttatgtatgattatataccaaaatagcgtagaattcaaataaaagtttgtgttataataatttctggtcagtatatatgacgaattttaattaaactatactatatcttttgaaaggttttgttaccctatgtctacagaaaaaattataaatttagctgcttatgcaggaaagattttacttcaaagtggagctgaaatatacagagtagaagaaactatgaataaaatttgtacagcctttaatgttaa-3 '

Namely, using the genomic DNA of Clostridium acetoButylicum ATCC 824 as a template for the PstI and AvaI restriction sites of the pTHL1-Cm vector having the thiolase promoter, amplification was carried out using SEQ ID NO: 11 and SEQ ID NO: 12 One DNA fragment was cloned.

[SEQ ID NO: 11]: 5'-CTGCAGGGCTGTACATTAGCATGCTCTGC-3 '

[SEQ ID NO: 12]: 5'-CCCGGGGGGTAACAAAGCTTTCTGCCTCC-3 '

Example  4: Clostridium of the above plasmid Acetobutylicum  Transformation

The recombinant vectors prepared in Examples 1, 2 and 3 were introduced into clostridium acetobuttilicum. Prior to this, methylation of vectors was induced to be suitable for transformation into clostridium, that is, Bacillus subtilis Phage 3T I methyltransferase expression vector, pAN1 (Mermelstein et al. , Appl Environ Microbiol, 59:. .. 1077, 1993) an embodiment containing E. coli TOP 10 (Invitrogen Corporation, Carlsbad, Calif, USA) for example 1, example 2 and conducted by introducing the recombinant vector prepared in example 3 Methylation was induced. Two methylated vectors were isolated and purified from Escherichia coli and introduced into Clostridium acetobutylicum ATCC 824 strain known as a type strain to prepare a recombinant mutant microorganism.

Competent cells for transformation were prepared as follows. First, Clostridium acetobutylicum ATCC 824 strain was inoculated into 10 ml CGM medium (Table 1) and cultured until the OD value reached 0.6. The cultured strains were inoculated in 60 ml of 2X YTG medium (16 g of Bacto Tryptone, 10 g of yeast extract, 4 g of NaCl, 5 g of glucose, per liter) at a concentration of 10% and cultured for 4-5 hours. The microbial cells were suspended in 2.4 ml of the same buffer after washing with the transformation buffer (EPB, 15 ml of 270 mM sucrose, 110 μl of 686 mM NaH ₂ PO ₄ , pH 7.4, twice, (compent cell) and 25 μl of recombinant plasmid DNA were mixed and charged into a cuvette having a 4 mm electrode, and then subjected to electric shock under the conditions of 2.5 kV and 25 μF. Immediately, the cells were suspended in 1 ml of 2 × YTG medium And cultured at 37 ° C. for 3 hours. Then, transformants ATCC824CAC2310kd, ATCC824CAC2083kd and ATCC824CAC2264kd were selected by streaking on 2 × YTG solid medium containing 40 μg / ml of erythromycin.

Composition of CGM medium ingredient Content (g / l) Glucose 8 K ₂ HPO ₄ 3H ₂ O 0.982 KH ₂ PO ₄ 0.75 MgSO ₄ 0.348 MnSO ₄ H ₂ O 0.01 FeSO ₄ 7H ₂ O 0.01 ₍₄ NH) ₂ SO ₄ 2 NaCl One Asparagine 2 p-Aminobenzoic acid 0.004 Yeast extract 5

Example  5: Culture for analysis of C1 metabolic pathway of mutant strains

ATCC 824 strain, which is a wild-type Clostridium acetobutylicum strain, and the recombinant mutant strains ATCC824CAC2310kd, ATCC824CAC2083kd and ATCC824CAC2264kd were cultured to analyze the C1 metabolism circuit. To this end, a 30 ml test tube containing 10 ml of CGM medium containing ¹³ C-formate was sterilized, taken out at 80 ° C or higher, filled with nitrogen gas, and then cooled to room temperature in the anaerobic chamber. Then, 40 / / ml of erythromycin was added, and the recombinant mutant microorganisms were inoculated and incubated at 37 째 C for 16 hours with anaerobic digestion.

Example  6: Analysis of methionine biosynthesis through C1 metabolism circuit of mutant strains

After the culture was completed, the wild-type strain and the recombinant mutants ATCC824CAC2310kd, ATCC824CAC2083kd and ATCC824CAC2264kd were recovered to analyze the amino acids constituting the cells (Agilent 6890N, 5875 XL MS system, Agilent 7683 automatic injector, column , ID 0.25, film thickness 0.25 m, Agilent Technologies).

As a result, the wild type strain of the control group exhibited a summed fractional labeling (SFL) of 10 for methionine, whereas the recombinant strains ATCC824CAC2310kd, ATCC824CAC2083kd and ATCC824CAC2264kd showed values of 11, 12 and 15, respectively. These results suggest that the methionine synthesis of the C1 metabolic pathway is improved in these three strains compared to the wild type strain.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea Advanced Institute of Science and Technology          INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> An engineered cell having improved methionine biosynthetic          ability <130> P17-B020 <160> 12 <170> KoPatentin 3.0 <210> 1 <211> 636 <212> DNA <213> Clostridium acetobutylicum <400> 1 atgatacagg atatatctat agaggaattt ataaaagaac ttgcatcgga aaaaccaact 60 cctggcggcg gtggagcggc agcactttca gcagcacttt cagcagcgct taattgtatg 120 gtgtttaact ttaccgtagg aaaaaaagtt tatgaaaatt atgataaaga aactaaaaaa 180 ttaatcaata gcagtctaga aaaatcagac aagcttaagg attatttctt atgtggtata 240 gataaagatg cggaggcttt ctcaaaaata ataaatagtt acaaacttcc ccaaagtaca 300 gaagaagaaa aagcatatag gcataaatgt atacaagaag cttcaaaatt tgcagcaaaa 360 gtaccagaag atgtagccaa taatgcacgt gaactttttg aattgatttg gatttcagca 420 aagttaggaa ataaaaatct tataacagat gctggggcag ctgcaataat ggctgaagca 480 gctattgaaa catcaatatt gaatataaag ataaacatag gatctataga ggataaggag 540 ttaaaagcaa gacttgaaaa aacttgcaga gatttacttt tagatagtaa agaatggaaa 600 gataaaatat taagtgaagt atattcgaat atatag 636 <210> 2 <211> 587 <212> DNA <213> Artificial Sequence <220> <223> Antisense Sequence of CAC2310 gene <400> 2 tatctatacc acataagaaa taatccttaa gcttgtctga tttttctaga ctgctattga 60 ttaatttttt agtttcttta tcataatttt cataaacttt ttttcctacg gtaaagttaa 120 acaccataca attaagcgct gctgaaagtg ctgctgaaag tgctgccgct ccaccgccgc 180 caggagttgg tttttccgat gcaagttctt ttataaattc ctctatagat atatcctgta 240 acataaattc cctccaatag tttatagcat ttctataatt ctttgcactt attagaaaac 300 tataattttt attttaactt atattttatc atgttttcta aataataaaa gcataaatta 360 tgtatgagag caagaattta acctaagttc ttgctctcat attaattatt tcataacaag 420 atgctttttt tcagagtatg gcatactcca gtaatttctg tatatatgat tttcaatatc 480 ctttggttca taatgtgctt tagattctcc tacttcgcct acaggtgtta ttgcaacaac 540 tgaatattta tctggtattc taagctcatc tttcatacgt ttctcat 587 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC2310 antisense cloning <400> 3 ctgcagtgag aaagcctccg catctt 26 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC2310 antisense cloning <400> 4 cccgggcctg ctggattgct tcctttg 27 <210> 5 <211> 837 <212> DNA <213> Clostridium acetobutylicum <400> 5 atgggagata taattaatgg aaaagcggaa tctcaaaagt ataaagataa aataattgaa 60 tttattaatg aaagaaagaa acaggggtta gatattccat gcatagccag tataacagtt 120 ggagatgatg ggggctcatt atactatgtt aacaatcaaa aaaaagtatc agaaagtctt 180 ggaattgagt ttaagagtat atttttagat gaaagtatac gagaggaaga actaataaag 240 ttaattgaag gtctaaacgt agataataaa attcatggaa ttatgcttca attaccgctg 300 cctaatcaca ttgatgcaaa actagtcaca tctaaaatag atgctaataa agatatagat 360 agtcttacag atataaatac aggaaaattt tacaagggtg aaaaatcatt tataccatgc 420 acgccaagaa gtattataaa tcttataaag agtttaaatg tggatatttg tgggaaaaat 480 gcagttgtaa tagggagaag taacattgta ggtaaaccta cagcgcagct tttactaaat 540 gaaaatgcaa cggttacaat atgccactct agaacacaaa acttaaaaga tatatgtaaa 600 aaagctgata ttattgtaag tgctattgga agaccaggtt ttataacaga tgaatttgtt 660 aatgaaaaat ctattgtaat tgatgttgga actacagtag tagatggtaa acttcgtgga 720 gatgtggttt ttgatgaggt tataaaaaag gcagcttacg taactccagt tcctggggga 780 gtaggggcga tgacaaccac aatgttaata ttaaatgttt gtgaggcatt gaaataa 837 <210> 6 <211> 461 <212> DNA <213> Artificial Sequence <220> <223> Antisense Sequence of CAC2083 gene <400> 6 ttcctctcgt atactttcat ctaaaaatat actcttaaac tcaattccaa gactttctga 60 tacttttttt tgattgttaa catagtataa tgagccccca tcatctccaa ctgttatact 120 ggctatgcat ggaatatcta acccctgttt ctttctttca ttaataaatt caattatttt 180 atctttatac ttttgagatt ccgcttttcc attaattata tctcccatac acaactactc 240 tcctttaaat tatcattttt cctcagaact atttattaaa tttccaataa ctccattaac 300 aaatgagaaa gagttctctt cagcataact ttttgcaagt tcaacagcct catttgcaga 360 aaccttacaa ggtatatcct tttcgaagaa tatttcatat gctgccatcc taagtatggt 420 gatatttatc ttggatattc tgcttatctt ccacttcttg g 461 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC2083 antisense cloning <400> 7 ctgcagcttc aattaacttt attagttc 28 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC2083 antisense cloning <400> 8 cccgggttct aaaattgaag aaagct 26 <210> 9 <211> 1236 <212> DNA <213> Clostridium acetobutylicum <400> 9 atggattttg aaaatataaa agtaagtgat tctgaagtct attctatcat agaagaagaa 60 aatgacgagac aagaaaataa tatagaactt attgcatctg aaaacttcac aagcaaagct 120 gtaatggaag ctatgggttc atatttaact aataagtatg cagaaggata tccaggaaaa 180 agatattatg gtggatgtta cgtagttgat aaagttgaag agcttgcacg tgaaagggca 240 aaaaaacttt ttaaagcaga gcatgctaat gtacagccac attcaggttc acaagctaat 300 atggctgttt actttgcagt attgaagccg ggagacacta taatgggaat gaacctaaca 360 gatggaggtc atttaactca tggaagtcca gttaattttt caggaaaact ctttaatata 420 attgcctatg gtgtaagtga tgaaacagaa caaatagatt atgaagcgtt tagaaaaaaa 480 gccttggagt gtaagccaaa gatgatagta tctggtgcta gtgcatattc aagaattatt 540 gattttaaga aaataagaga aatatgcgat gaagtaggag catatatgat ggtagatatg 600 gctcatatag caggacttgt agcagcagga cttcatccgt caccaattcc atatgctgat 660 tttgtaacaa caactactca taagacttta aggggaccaa gaggcggagc aattttctgc 720 aaggaaaagt atgcaaagga cattgataaa tctgtattcc ctggaatgca ggggggacct 780 ttaatgcaca taattgcagg aaaagcagta tgctttggag aagctttaaa ggatgatttt 840 aaagattatg cacagcaaat agtaaataat gcaaaagtgt ttgcagatga acttacaaaa 900 tacggtttta gaatagtttc aggtggaact gataatcacc ttttattagt tgatttaacg 960 aacaaaaata taacaggaaa agatgcagaa catcttcttg attcagttgg aataactgca 1020 aacaaaaata ctataccatt tgagaaaaag agtcctttta taacaagtgg aataagaatg 1080 ggtacacctt cagttacaac tagaggattt aaggaagagg aaatgaaaaa agtagcgtat 1140 ttcataaact atgttataga gcatagagat gaagatttaa gtgaaataag gaaacaagtt 1200 tcagaattat gtagtggatt tcctatatat aagtaa 1236 <210> 10 <211> 558 <212> DNA <213> Artificial Sequence <220> <223> Antisense Sequence of CAC2264 gene <400> 10 tttaaaaagt ttttttgccc tttcacgtgc aagctcttca actttatcaa ctacgtaaca 60 tccaccataa tatctttttc ctggatatcc ttctgcatac ttattagtta aatatgaacc 120 catagcttcc attacagctt tgcttgtgaa gttttcagat gcaataagtt ctatattatt 180 ttcttgtctc gcattttctt cttctatgat agaatagact tcagaatcac ttacttttat 240 attttcaaaa tccatatata atacactccc tcatacatta atttgctaag ttaaaaaatt 300 atcaatttta tgtatgatta tataccaaaa tagcgtagaa ttcaaataaa agtttgtgtt 360 ataataattt ctggtcagta tatatgacga attttaatta aactatacta tatcttttga 420 aaggttttgt taccctatgt ctacagaaaa aattataaat ttagctgctt atgcaggaaa 480 gattttactt caaagtggag ctgaaatata cagagtagaa gaaactatga ataaaatttg 540 tacagccttt aatgttaa 558 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for CAC2264 antisense cloning <400> 11 ctgcagggct gtacattagc atgctctgc 29 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for CAC2264 antisense cloning <400> 12 cccggggggt aacaaagctt tctgcctcc 29

Claims (12)

In a cell having a tetrahydrofolate C1 metabolic circuit, a gene encoding an enzyme that converts formyltetrahydrofolate to methenyltetrahydrofolate, an enzyme that converts methetyltetrahydrofolate to methylene tetrahydrofolate And a gene encoding an enzyme that converts glycine to serine is deleted or the expression of the gene is suppressed or decreased.
The method according to claim 1,
A gene encoding an enzyme that converts formyltetrahydrofolate to methenyltetrahydrofolate is represented by SEQ ID NO: 1,
The gene encoding the enzyme that converts methenyl tetrahydrofolate to methylene tetrahydrofolate is represented by SEQ ID NO: 5,
Wherein the gene encoding the enzyme that converts glycine to serine is SEQ ID NO: 9.
The mutant cell according to claim 1, wherein the mutant cell has increased methionine biosynthesis.
The method according to claim 1, wherein the cell having the tetrahydrofolate C1 metabolic circuit is derived from any one selected from the group consisting of bacteria, yeast, fungi, plant cells, animal cells, algae and microalgae cell.
5. The method of claim 4, wherein the bacteria is selected from the group consisting of methanogenic bacteria, methanogenic bacteria, acetone, E. coli, Corynebacterium, crab cilia, yeast, Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, Clostridium perfringens, Clostridium tetracycline, but are not limited to, clostridium butyricum, tetani, Clostridium difficile, Clostridium butyricum, Clostridium butylicum, Clostridium kluyveri, Is selected from the group consisting of Clostridium tyrobutylicum and Clostridium tyrobutyricum. .
The mutant cell according to claim 1, wherein the decrease or inhibition of gene expression is induced by antisense introduction to the gene.
The method according to claim 6,
The antisense to the gene encoding the enzyme that converts formyltetrahydrofolate to methenyltetrahydrofolate is represented by SEQ ID NO: 2,
The antisense for the gene encoding the enzyme that converts methenyl tetrahydrofolate to methylene tetrahydrofolate is represented by SEQ ID NO: 6,
Wherein the antisense to the gene encoding the enzyme that converts glycine to serine is represented by SEQ ID NO: 10.
7. The mutant cell according to claim 6, wherein the antisense is introduced in the form of a plasmid.
(a) culturing mutant cells of any one of claims 1 to 8 to biosynthesize methionine; And
(b) recovering the biosynthetic methionine.
A gene encoding an enzyme that converts formyl tetrahydrofolate into methenyl tetrahydrofolate, a gene that encodes an enzyme that converts methenyltetrahydrofolate into methylene tetrahydrofolate, and an enzyme that converts glycine into serine A substance which inhibits the expression of a gene selected from the group consisting of a gene coding for the gene;
An enzyme that converts formyl tetrahydrofolate to methenyl tetrahydrofolate, an enzyme that converts methanetetrahydrofolate to methylene tetrahydrofolate, and an enzyme that converts glycine to serine. Wherein the anticancer composition comprises an effective amount of an inhibitor that binds to the cell.
11. The anticancer composition according to claim 10, wherein the substance that inhibits the expression of the gene is an siRNA, an antisense-oligonucleotide, an shRNA, a miRNA, or a vector containing any one of them.
11. The anticancer composition according to claim 10, wherein the inhibitor is an antibody or a platemaker.

Images