KR101865779B1 - Recombinant microorganism having ability to fix carbon dioxide and the method for producing useful substance using thereof - Google Patents

Abstract

The present invention relates to a recombinant microorganism into which a gene coding for ACS / CODH (acetyl-CoA synthase / carbon monoxide dehydrogenase complex) involved in the Wood-Ljungdahl pathway is introduced, and the recombinant microorganism according to the present invention has a carbon- And is useful for producing useful materials such as alcohols and organic acids from CO2 at high concentration and high yield.

Description

TECHNICAL FIELD The present invention relates to a recombinant microorganism having carbon dioxide fixability and a method for producing a useful substance using the recombinant microorganism,

The present invention relates to a method for producing a recombinant microorganism having carbon dioxide fixing ability and a method for producing a useful substance such as alcohol by using the recombinant microorganism having carbon dioxide fixability. More particularly, the present invention relates to a method for producing a recombinant microorganism having carbon dioxide fixing ability by expressing a gene encoding ACS / And a recombinant microorganism into which such a gene is introduced, a method for fixing CO ₂ using the recombinant microorganism, and a method for producing a useful substance.

The syngas is a mixture of carbon monoxide (CO) gas, carbon dioxide (CO ₂ ) gas, hydrogen (H ₂ ) gas and other volatile gases (CH ₄ , N ₄ , NH ₃ , H ₂₅ ) , Organic wastes, coal, petroleum, plastics or other carbon-containing materials or modified natural gas.

The acetogenic Clostridia microorganisms grown in the atmosphere containing these syngas can absorb CO, CO ₂ , and H ₂ , which are components of syngas, and can produce alcohols and aliphatic C ₂ -C ₆ organic acids. These syngas components activate the Wood-Ljungdahl metabolic pathway, leading to the formation of acetyl-coenzyme A, a major intermediate in the Wood-Ljungdahl pathway.

The Wood-Ljungdahl pathway is a pathway for biosynthesis of acetyl-CoA, and is used as an important means of generating energy for growth in some anaerobic microorganisms.

The enzymes that activate the Wood-Ljungdahl pathway are carbon monooxide dehydrogenase (CODH) and hydrogenase (hydrogenase). These enzymes capture electrons from CO and H ₂ in syngas and deliver it to ferredoxin, an iron-sulfur (FeS) electron transport protein. Because oxidation-reduction potentials are very low during synthesis gas fermentation, ferredoxin is a major electron-transporting agent in the Wood-Ljungdahl pathway, mainly in anaerobic Clostridia.

In electron transfer, ferredoxin changes its electron state from Fe3 + to Fe2 +. Ferredoxin - binding electrons are then delivered to the co - hosts NAD + and NADP + via the activity of ferredoxin oxidoreductases (FORS). Reduced nucleotide cofactors (NAD + and NADP +) are used to generate intermediate compounds in the Wood-Ljungdahl pathway and form acetyl-CoA.

In acetyl-CoA synthesis via the Wood-Lungdahl pathway, CO ₂ or CO provides a substrate for this pathway. Carbon derived from the CO ₂ is by being first formate dehydrogenase (FDH) back by the reduced enzyme to the formate, methyl tetrahydrofolate further reduced to intermediate, and finally reduced to a methyl group. Carbon derived from CO is reduced to carbonyl group by CODH. The two carbon moieties are then incorporated into acetyl-CoA by acetyl-CoA synthetase (ACS), which is part of the CODH / ACS complex. Acetyl-CoA is a central metabolite in the production of C ₂ -C ₆ alcohols and acids in acetogenic Clostridia.

Thus, acetogenic Clostridia, through the Wood-Ljungdahl pathway, partly produces a mixture of currently commercially-attracted C ₂ -C ₆ alcohols and acids such as ethanol, n-butanol, hexanol, acetic acid, and butyric acid . However, there is a problem that the productivity is very low and the metabolism is difficult to operate.

Therefore, the present inventors have made efforts to develop a microorganism having improved yield of the desired product based on the Wood-Ljungdahl pathway. As a result, the present inventors have found that the ACS / CODH (acetyl-CoA synthase / carbon monoxide dehydrogenase complex) And then introduced into a heterologous host microorganism to express the ACS / CODH complex-encoding gene and the activity of the enzyme, which is the product of the ACS / CODH complex, as well as the recombinant microorganism having the ability to fix the carbon dioxide And confirmed that the recombinant microorganism is suitable for fixing CO ₂ and producing a high yield of a useful substance such as alcohol and completed the present invention.

It is an object of the present invention to provide a gene encoding a acetyl-CoA synthase / carbon monooxide dehydrogenase (ACS / CODH) complex or a recombinant vector containing the gene A recombinant microorganism having carbon dioxide fixability, and a method for producing the recombinant microorganism.

Another object of the present invention is to provide a method for fixing CO ₂ using the recombinant microorganism and a method for producing a useful substance.

In order to accomplish the above object, the present invention provides a method for producing a microorganism, which comprises administering to a host microorganism a gene coding for an acetyl-CoA synthase / carbon monooxide dehydrogenase (ACS / CODH) complex, A recombinant microorganism having the ability to fix carbon dioxide is introduced.

The present invention also relates to a method for producing a recombinant vector comprising a gene coding for an acetyl-CoA synthase / carbon monooxide dehydrogenase (ACS / CODH) complex or a recombinant vector containing the gene, And then introducing the recombinant microorganism.

The present invention also provides a method of fixing the CO ₂ which comprises culturing a recombinant microorganism under the CO ₂ present.

The present invention also provides a method for producing a useful substance, characterized in that the recombinant microorganism is cultured in the presence of CO ₂ to produce a useful substance, and then the produced useful substance is recovered.

The present invention relates to a recombinant microorganism into which a gene coding for ACS / CODH (acetyl-CoA synthase / carbon monoxide dehydrogenase complex) involved in the Wood-Ljungdahl pathway is introduced, and the recombinant microorganism according to the present invention has a carbon- And is useful for producing useful materials such as alcohols and organic acids from CO2 at high concentration and high yield.

FIG. 1 is a schematic diagram illustrating the production of various biochemicals and biofuel using the Wood-Ljungdahl pathway, which is a pathway for biosynthesis of acetyl-CoA from syngas.
Figure 2 is a cleavage map of the recombinant vector pTHL20-ACS-CODH.
3 is a schematic diagram of a gene coding for the Tetrahydrofolate cycle and the ACS / CODH complex in Clostridium acetobutylicum.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The present inventors experimentally cloned genes encoding ACS / CODH (acetyl-CoA synthases / carbon monoxide dehydrogenase complex) involved in the Wood-Ljungdahl pathway and firstly expressed them in heterologous host microorganisms.

Accordingly, in one aspect, the present invention provides a method for producing a gene encoding a acetyl-CoA synthase / carbon monooxide dehydrogenase (ACS / CODH) complex or a gene encoding the acetyl-CoA synthase / carbon monooxide dehydrogenase To a recombinant microorganism having carbon dioxide fixing ability.

In the present invention, the gene coding for the ACS / CODH complex is dihydrolipoamide dehydrogenase (CD0723) (SEQ ID NO: 1), carbon monooxide dehydrogenase chaperone ( CD0724) (SEQ ID NO: 2), corrinoid iron-sulfur protein small subunit (CD0725) (SEQ ID NO: 3), corrinoid iron-sulfur protein large subunit CD0726) (SEQ ID NO: 4), methyltransferase subunit (CD0727) (SEQ ID NO: 5), acetyl-CoA synthetase (ACS) or ACS / CODH subunit alpha (CD0728) And a gene coding for the glycine cleavage system H protein (CD0729) (SEQ ID NO: 7), but is not limited thereto.

In addition, the gene coding for the ACS / CODH complex, such as those of SEQ ID NOS: 1 to 7, involved in the Wood-Ljungdahl pathway can be obtained from a variety of biological sources, and particularly from acetogen or methanogen More preferably, In the present invention, meta nojeon is Methanobacterium bryantii, Methanobacterium formicum, Methanobrevibacter arboriphilicus, Methanobrevibacter gottschalkii, Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanocalculus chunghsingensis, Methanococcoides burtonii, Methanococcus aeolicus, Methanococcus deltae, Methanococcus jannaschii, Methanococcus maripaludis, Methanococcus vannielii, Methanocorpusculum labreanum, Methanoculleus bourgensis (Methanogenium olentangyi & Methanogenium bourgense), Methanoculleus marisnigri, Methanofollis liminatans, Methanogenium cariaci, Methanogenium frigidum, Methanogenium organophilum, Methanogenium wolfei, Methanomicrobium mobile, Methanopyrus kandleri, Methanoregula boonei, Methanosaeta concilii, Methanosaeta thermophila, Methanosarcina acetivorans, Methanosarcina barkeri, Methanosarcina mazei, Methanosphaera stadtmanae, Methanospirillium hungatei, Methanothermobacter defluvii (Methanobacterium defluvii), Methanothermobacter thermau totrophicus (Methanobacterium thermoautotrophicum), can be exemplified such as Methanothermobacter thermoflexus (Methanobacterium thermoflexum), Methanothermobacter wolfei (Methanobacterium wolfei), Methanothrix sochngenii, acetonitrile former is Acetoanaerobium ruminis, Acetoanaerobium noterae, Acetoanaerobium romashkovii, Acetobacterium baloi, Acetobacterium carbinolicum, Acetobacterium dehalogenans, Acetobacterium fimetarium, Acetobacterium malicum, Acetobacterium paludosum, Acetobacterium psammolithicum, Acetobacterium tundrae, Acetobacterium wieringae, Acetobacterium woodii, Acetobacterium sp., Acetonema longum, Bryantella formatexigens, Butyribacterium methylotrophicum, Caloramator fervidus, Clostridium aceticum, Clostridium autoethanogenum, Clostridium coccoides, Clostridium difficile, Clostridium formicaceticum, Clostridium glycolicum, Clostridium ljungdahlii, Clostridium magnum, Clostridium mayombei, Clostridium methoxybenzovorans, Clostridium scatologenes, Clostridium ultunense, Clostridium sp., Eubacterium sp., Eubacterium limosum, Holophaga foetida, Moorella glycerini, Moorella muldereri, Moorella thermoacetica, Moorella thermoautotrophica, Moorella sp., Natroniella acengena, Natronincola histidinovorans, Oxobacter pfennigii, Ruminococcus hydrogenotrophicus, Ruminococcus productus, Ruminococcus schinkii, Ruminococcus sp. , Sporomusa acidovorans, Sporomusa aerivorans, Sporomusa malonica, Sporomusa ovata, Sporomusa paucivorans, Sporomusa silvacetica, Sporomusa sphaeroides, Sporomusa termitida, Sporomusa sp., Syntrophococcus sucromutans, Thermoacetogenium phaeum and Thermoanaerobacter kivui.

In the present invention, genes coding for the ACS / CODH complex are genes that form an ACS / CODH complex involved in the step of biosynthesis of a carbonyl group, a methyl group and coenzyme A in the Wood-Ljundahli pathway. Clostridium difficille clones a gene of about 9 kb in length without a homologous protein and then expresses it in Clostridium acetobutylicum, a heterologous host microorganism in which the gene has been deleted. Thus, the genes are expressed in ACS / CODH complex activity , Which is an important gene in the human genome.

The gene of the present invention may be modified in various ways within the scope of not altering the amino acid sequence of the protein expressed from the coding region and may be modified or modified within a range not affecting the expression of the gene, An expression can be made, and such modified genes are also included in the scope of the present invention.

Therefore, the present invention also includes a polynucleotide having a base sequence substantially identical to the gene and a fragment of the gene. Substantially the same polynucleotide means a gene encoding an enzyme having the same function as that used in the present invention regardless of the homology of the sequence. Means a gene encoding an enzyme having the same function as that used in the present invention regardless of the fragment of the gene and the length of the fragment.

In addition, the amino acid sequence of the protein, which is an expression product of the gene of the present invention, can be ensured from biological resources such as various microorganisms within a range not affecting the activity and activity of the enzyme, And are included in the scope of the present invention.

Thus, the present invention also includes polypeptides having substantially the same amino acid sequence as the protein and fragments of the polypeptides. A substantially identical polypeptide means a protein having the same function as that used in the present invention regardless of the homology of the amino acid sequence. A fragment of the polypeptide also means a protein having the same function as that used in the present invention regardless of the length of the fragment.

As used herein, " vector " means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in the appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms " plasmid " and " vector " are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several to several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector, (C) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA. After ligation, the vector should be transformed into the appropriate host cell. Transformation can be readily accomplished using a calcium chloride method or electroporation (Neumann, et al., EMBO J. , 1: 841, 1982).

As a vector used for overexpression of the gene according to the present invention, an expression vector known in the art can be used.

A nucleotide sequence is " operably linked " when placed in a functional relationship with another nucleic acid sequence. This may be the gene and regulatory sequence (s) linked in such a way as to enable gene expression when a suitable molecule (e. G., Transcriptional activator protein) is attached to the regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a whole protein participating in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; Or a ribosome binding site is operably linked to a coding sequence if positioned to facilitate translation. Generally, " operably linked " means that the linked DNA sequences are in contact and, in the case of a secretory leader, are in contact and present in the reading frame. However, the enhancer need not be in contact. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction sites. If such a site does not exist, a synthetic oligonucleotide adapter or a linker according to a conventional method is used.

As is well known in the art, in order to increase the expression level of a transgene in a host cell, the gene must be operably linked to a transcriptional and detoxification regulatory sequence that functions in a selected expression host. Preferably the expression control sequence and the gene are contained within a recombinant vector containing a bacterial selection marker and a replication origin. If the host cell is a eukaryotic cell, the recombinant vector should further comprise a useful expression marker in the eukaryotic expression host.

The host cells transformed with the recombinant vectors described above constitute another aspect of the present invention. As used herein, the term " transformation " means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration.

Of course, it should be understood that not all vectors function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

In addition, the gene coding for the ACS / CODH complex may be introduced into the genome of the host cell to exist as a chromosomal factor. It will be apparent to those skilled in the art that the present invention has the same effect as that of introducing the recombinant vector into the host cell by inserting the gene into the genome of the host cell.

In the present invention, the host microorganism is not limited as long as it is a microorganism, but it is preferable to use a microorganism belonging to the genus Clostridium.

In the present invention, microorganisms belonging to the genus Clostridium include Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonum, Clostridium perfringens, Clostridium tetani, Clostridium difficile, Clostridium butyricum, Clostridium spp. ), Clostridium butylicum, Clostridium kluyveri, Clostridium tyrobutylicum, Clostridium tyrobutyricum, and the like. can do.

Up to now, there have been efforts to express ACS / CODH in various hosts, but no cases have been shown to be expressed in heterologous hosts. In the past, only simple computational annotation information based on genome sequencing has been proven experimentally, and since it is not characterized, expression in heterologous host was very difficult. In addition, it is impossible to verify the genes possessed by these strains due to the lack of the molecular biologic researches and the related tools in these strains. In addition, functional analysis of genes based on simple computational annotation information and the actual activity of proteins through expression of genes are separate tasks. The present inventors have succeeded in expressing Clostridium difficille by cloning a gene of about 9 kb in length without a homologous protein and then expressing it in Clostridium acetobutylicum, a heterologous host microorganism in which the gene has been deleted. When the genes are expressed in the ACS / CODH complex It is proved through experiments that the gene is important for activity.

In the present invention, the host microorganism may be characterized in that it has some or all of the genes encoding enzymes involved in the Wood-Lung pathway.

The gene coding for the enzymes involved in the Wood-Ljungdahl pathway is a concept that includes a gene encoding the ACS / CODH complex, and the host microorganism may have some or all of the genes encoding enzymes involved in the Wood-Lung pathway. The present inventors have demonstrated through experiments that genes coding for enzymes involved in the Wood-Ljungdahl pathway present in Clostridium acetobutylicum are important genes for ACS / CODH complex activity. Specifically, the genes present in Clostridium acetobutylicum were proved to be important genes for ACS / CODH complex activity by knockout experiments.

The recombinant microorganism of the present invention has carbon dioxide fixing ability by using a gene encoding enzymes involved in the Wood-Lung pathway originally possessed by the host microorganism and / or a gene encoding the ACS / CODH complex cloned by the present inventor.

In the present invention, the gene coding for the enzymes involved in the Wood-Lung pathway of the host microorganism is carbon monooxide dehydrogenase (CAC0116, also CAC2498) (SEQ ID NO: 8, SEQ ID NO: 9) , Formyl-H4folate synthase (CAC3201) (SEQ ID NO: 10), formimido-tetrahalophate cyclodiaminease (CAC2310, CAC2083) , SEQ ID NO: 12), formyl-tetrahydrofolate cyclohydrolase / methylene-H4folate dehydrogenase (CAC2091) (SEQ ID NO: 13), and methylene-tetrahydrofolate dehydrogenase And a gene coding for methylene-H4folate reductase (CAC2091) (SEQ ID NO: 13), but it may be one or more genes selected from the group consisting of One that does not.

According to another aspect of the present invention, there is provided a host microorganism, which comprises a gene encoding an acetyl-CoA synthase / carbon monooxide dehydrogenase (ACS / CODH) complex, And introducing a recombinant vector into the recombinant microorganism.

In yet another aspect, the present invention provides a recombinant microorganism according to the present invention CO ₂ The present invention relates to a method of immobilizing CO ₂ in the presence of a culture medium. The recombinant microorganism according to the present invention can fix CO ₂ using the newly introduced gene and the original gene.

In another aspect, the present invention relates to a method for producing a useful substance, which comprises culturing a recombinant microorganism according to the present invention to produce a useful substance, and then recovering the produced useful substance. The recombinant microorganism according to the present invention uses CO ₂ as a carbon source to produce a useful substance such as alcohol.

In the present invention, the useful substance may be butanol or ethanol-containing alcohol, but the present invention is not limited thereto. For example, all substances produced by the recombinant microorganism having CO ₂ fixing ability according to the present invention.

Examples of useful substances include alcohols, amino acids, organic acids, alkenes, and polymeric monomers. The alcohols include linear or branched alcohols having 2 to 10 carbon atoms, more specifically, ethanol, isobutanol, propanol, hexanol, Butanol, 2-pentanol, 3-pentanol, 2-methyl-1-butanol, 3-methyl-1-butanol, 2-methyl- 2-butanol, and the like.

The recombinant microorganism according to the present invention is characterized in that a desired useful substance such as alcohol can be produced at a high concentration and a high yield compared with strains which naturally fix carbon dioxide using the Wood-Ljungdal pathway. Further, by introducing a metabolic circuit capable of fixing CO ₂ to a mutant microorganism subjected to metabolic engineering for producing a specific target compound (amino acid, organic acid, alkene, polymer monomer, etc.) using the present invention, And the like.

In one embodiment of the present invention, a gene encoding an ACS / CODH complex is cloned from Clostridium difficille, and the gene is introduced into Clostridium acetobutylicum host microorganism having a part of a gene encoding enzymes involved in the Wood-Ljungdahl pathway, Microorganisms were produced. Then, the produced recombinant microorganism was cultured to confirm that the recombinant microorganism produced butanol and ethanol at a high yield.

[ Example ]

Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

In the following examples, only specific clostridium acetobuttilicum strains are exemplified as the host strains for expressing the gene according to the present invention. However, even if other clostridium or other genus microorganisms are used, homologous or identical It is also apparent to those skilled in the art that a target compound such as butanol, ethanol, amino acid, organic acid, alkene, polymer monomer, etc. can be prepared by introducing a gene and using the same.

Although only the production of butanol or ethanol is exemplified in the following examples, it will also be apparent to those skilled in the art that other desired compounds such as amino acids, organic acids, alkenes, and polymeric monomers can be prepared.

Example  One. pTHL20  Vector production

A shuttle vector for the expression of foreign proteins including a thiolase promoter of clostridium acetobutylicum and a ribosome binding site (RBS) was constructed as follows. It is known that thialase is capable of continuously and stably expressing a gene without being greatly affected by the cell growth cycle (Tummala et al., Appl. Environ. Microbiol., 65: 3793-3799, 1999). Therefore, in this example, the promoter located at the upper end of the Cytolase (NCBI GeneID: 1119056) was cloned and inserted into pIMP-H1del. pIMP-H1del is a shuttle vector having pIMP1 as a template, which removes one HindIII site existing in the 3408th nucleotide sequence from pIMP1 having two HindIII restriction enzyme sites and leaves only restriction enzyme sites in the 743th nucleotide sequence. PCR was performed using the total DNA of the primers Clostridium acetobutylicum (ATCC 824) of SEQ ID NO: 1 and SEQ ID NO: 2 as a template to amplify the thialase promoter. The amplified thiolase promoter fragments were purified and recovered, treated with HindIII and PstI restriction enzymes, and then ligated with the pIMP-H1del shuttle vector treated with the same enzyme to complete pTHL1 vector production.

[SEQ ID NO: 14]: 5'-GGCCCCAAGCTTAGAATGAAGTTTCTTATGCACAAG-3 '

[SEQ ID NO: 15]: 5'-AAACTGCAGTCTAACTAACCTCCTAAATTTTGATAC-3 '

Also, PCR was performed using the primers of SEQ ID NO: 3 and SEQ ID NO: 4, pSOS95-Cm as a template to amplify the chloramphenicol resistance gene, and the amplified chloramphenicol resistance gene fragments were purified and recovered, treated with HindIII restriction enzyme, The pTHL2-Cm vector with the NcoI site added to the MCS site was completed by ligation with the enzyme-treated pTHL1 shuttle vector. pSOS95-Cm can be prepared by cloning the thioloase promoter of ATCC 824 strain in pSOS95 (Nair and Papoutsakis, J. Bacteriol., 176: 5843-5846, 1994) and cloning the chloramphenicol / thiamphenicol resistance gene in the down-stream .

[SEQ ID NO: 16]: 5'-CCAAGCTTCGACTTTTTAACAAAATATATTG-3 '

[SEQ ID NO: 17]: 5'-AAAACTGCAGCCATGGTCTAACTAACCTCCTAAATTTTGATAC-3 '

In order to add XbaI-PstI-KpnI-SphI site between the NcoI and SalI sites, a part of the thiolase gene was amplified by PCR using ATCC 824 gDNA as a template using the primers of SEQ ID NO: 18 and SEQ ID NO: 19 below, The fragments were purified and recovered and then treated with NcoI and SalI restriction enzymes and ligation with the pTHL2-Cm shuttle vector treated with the same enzyme to construct a pTHL20 vector with XbaI-PstI-KpnI-SphI digits added to the MCS site .

[SEQ ID NO: 18]: CATGCCATGGTCTAGACTGCAGTTACCACATGGGAATAACAGC

[SEQ ID NO: 19]: TACGCGTCGACGCATGCGGTACCGTTGATCCAAATCTAGGGTGC

Example  2. pTHL20 - ACS - CODH  Production of vector

The first fragment of the ACS / CODH gene complex was amplified by PCR using primers of SEQ ID NO: 20 and SEQ ID NO: 21 and the total DNA of C. difficile as a template, and the amplified gene fragments were purified and recovered. Then, NcoI-PstI Treated with restriction enzymes and ligated with the pTHL20 shuttle vector treated with the same enzyme to complete the production of pTHL20-ACS-CODH1.

[SEQ ID NO: 20]: CATGCCATGGATGAAGATAGTAGTAGTAGGTGGTGG

[SEQ ID NO: 21]: GTTTGAACCACCTACTAAAACAC

The second fragment of the ACS / CODH gene complex was amplified by performing PCR using the total DNA of C. difficile as primers of SEQ ID NOS: 22 and 23, and the amplified gene fragments were purified and recovered. Then, PstI-AvaI Treated with restriction enzymes and ligated with pTHL20-ACS-CODH1 treated with the same enzyme to complete pTHL20-ACS-CODH2 production.

[SEQ ID NO: 22]: CATTTGGACCATTAAGTGAATTAG

[SEQ ID NO: 23]: CCCCCGGGGGCTATGAATATATCTGCATTTCTTGC

The second fragment of the ACS / CODH gene complex was amplified by PCR using the total DNA of C. difficile as primers of SEQ ID NO: 24 and SEQ ID NO: 25, and the amplified gene fragments were purified and recovered. The PstI restriction enzyme , And ligated with pTHL20-ACS-CODH2 treated with the same enzyme to complete pTHL20-ACS-CODH production (FIG. 2).

[SEQ ID NO: 24]: CAGAAGAAAGAACTATAGCAATGG

[SEQ ID NO: 25]: TGGGAATCCTAAAGCTATTGC

Example  3. Production of recombinant microorganisms

The recombinant vector pTHL20-ACS-CODH prepared in Example 2 was introduced into clostridium acetobutylicum ATCC 824 strain using an electroporation method to prepare an ATCC 824-ACS / CODH strain.

First, the Bacillus subtilis phage (Bacillus subtilis Phage) Φ3T I methyltransferase expression vector, pAN1 (Mermelstein et al . , Appl . Environ . Microbiol ., 59: 1077, 1993) was introduced into E. coli TOP10, and the methylation was induced so that the vectors were suitable for transformation into clostridium. The methylated vector was isolated and purified from Escherichia coli, and this vector was introduced into clostridium acetobutylicum mutant ATCC 824 to prepare a recombinant mutant microorganism.

ATCC 824 competent cells for transformation were prepared as follows. First, 10 ml CGM (Table 1) was inoculated with strain M5 and cultured until OD 0.6. Using this, 10% of the cells were inoculated in 60 ml of 2X YTG medium (16 g of Bacto Tryptone, 10 g of yeast extract, 4 g of NaCl, 5 g of glucose, per liter) and cultured for 4-5 hours. After washing twice with transformation buffer (EPB, 15 ml of 270 mM sucrose, 110 μl of 686 mM NaH ₂ PO ₄ , pH N.4), the microbial cells were suspended in 2.4 ml of the same buffer. 600 μl of the competent cells and 25 μl of the recombinant plasmid DNA were mixed and filled into a 4 mm electrode cuvette, and then electric shock was applied at 2.5 kV and 25 μF. The cells were immediately suspended in 1 ml of 2X YTG medium, cultured at 37 ° C for 3 hours, and then plated on 2 × YTG solid medium containing 40 μg / ml erythromycin to select transformant ATCC 824-ACS / CODH .

CGM  Composition of medium ingredient Content (g / l) Glucose 8.5 to 80 K ₂ HPO ₄ 3H ₂ O 0.982 KH ₂ PO ₄ 0.75 MgSO ₄ 0.348 MnSO ₄ H ₂ O 0.01 FeSO ₄ 7H ₂ O 0.01 (NH _{4) 2} SO ₄ 2 NaCl One Asparagine 2 p-Aminobenzoic acid 0.004 Yeast extract 5

Example  4. Using recombinant microorganisms CO ₂  fixing

The recombinant mutant microorganism ATCC 824-ACS / CODH was cultured to evaluate the carbon dioxide fixability. A 100 ml serum bottle containing 10 ml of CGM medium was sterilized and taken out at a temperature of 80 ° C or higher. After cooling to room temperature in the post anaerobic chamber, 40 μg / ml of erythromycin was added, and the recombinant mutant microorganisms were inoculated, After complete closure, incubation was carried out for 7 days with the anaerobic tank at 37 占 폚. Culture was performed in three replicate experiments. In this example, there was no supply of carbon dioxide and hydrogen from the outside (ATCC 824 strain produces enough carbon dioxide and hydrogen when cultured), but in the case of strains not producing it, two gases can be supplied externally. After completion of the incubation, the supernatant was recovered and the concentration of the produced metabolites was measured by gas chromatography (Agillent 6890N, manufactured by Supelco Carbopack ^™ B AW / 6.6% PEG 20M, 2 m × 2 mm ID, Bellefonte, GC System, Agilent Technologies Inc., CA, USA). Analysis of the metabolites obtained from the culture broth showed that the total organic carbon was 193 mmole for ATCC 824 and 213 mmole for the recombinant mutant microorganism ATCC 824-ACS / CODH. This indicates that the recombinant mutant microorganism ATCC 824-ACS / CODH produced approximately 20 mmole of carbon, ie, 20 mmole of carbon dioxide.

Example  5. Recombinant microorganism using 13C- CO ₂  fixing

The recombinant mutant microorganism ATCC 824-ACS / CODH was cultured in 13C-CO ₂ to evaluate the carbon dioxide fixability. The culture was carried out under the same conditions as in Example 4, but 13C-sodium bicarbonate was further supplied from the outside with 13C-CO ₂ . During the culture of the recombinant microorganism, the metabolites were collected and metabolites were analyzed using a gas chromatograph / mass spectrometer (Clarus 600 series + TurboMatrix HSS Trap, PerkinElmer). Electron ionization (EI) method was used for ionization of the mass spectrometer. As a result, no detection of isotopically labeled metabolites was observed in the control group. On the other hand, 13-C isotope compounds were observed in the metabolite analysis of cultures obtained from the recombinant mutant microorganism ATCC 824-ACS / CODH. For example, in the case of acetic acid, the mass spectrometry analyzed in the culture solution of the recombinant mutant microorganism ATCC 824-ACS / CODH at m / z 43 and 45, which are major ion peaks, is relatively higher than that of the control group / z 45, respectively. This is due to the fact that some of the CH ₃ CO- ions that should appear at m / z 43 are labeled with isotopes ( ¹³ CH ₃ ¹³ CO-) at m / z 45.

Example  6. Clostridium acetobutylicum  Existing within ACS / CODH  The gene encoding the complex

As confirmed in the above examples, the carbon dioxide fixing ability of the recombinant mutant microorganism ATCC 824-ACS / CODH was confirmed. Therefore, it is known that genes encoding some ACS / CODH complexes are also present in the ATCC 824 strain. In order to confirm this, candidate genes were excised (Fig. 3), and it was confirmed that the gene coding for ACS / CODH complex was deleted by deleting these genes and confirming disappearance of carbon dioxide fixed ability.

Example  7. Preparation of Target Compound Using Recombinant Microorganism

In the present invention, production ability of butanol, ethanol, acetone, and organic acid could be tested by using Clostridium acetobutylicum as a host. The butanol and ethanol production ability of the mutant microorganism ATCC 824-ACS / CODH prepared in the above example was confirmed. A 30 ml test tube containing 10 ml of CGM medium was sterilized and taken out at 80 DEG C or higher and filled with nitrogen gas. After cooling to room temperature in the anaerobic chamber, 40 .mu.g / ml of erythromycin was added and the mutant microorganism was inoculated to 37 The incubation was carried out under anaerobic conditions until the absorbance (600 nm) at 1.0 was reached to 1.0. A 500 ml flask containing 200 ml of CGM medium consisting of the same components was sterilized and treated in the same manner. 10 ml of the preculture was inoculated, and incubated at 37 ° C under anaerobic conditions (600 nm) until the absorbance Lt; / RTI > cells. After sterilization, the 5.0 L fermenter (LiFlus GX, Biotron Inc., Kyunggi-Do, Korea) containing 1.8 L of the above-mentioned components was sterilized and the temperature was lowered to room temperature 40 ㎍ / ml of erythromycin was added and 200 ml of the second preculture was inoculated and cultured at 37 캜 or 32 캜 for 60 hours at 200 rpm. Amount of pH was maintained at 5.0 or higher by automatic feeding using ammonia water, and nitrogen was supplied at 0.2 vvm (air volume / working volume / minute) during the culture.

Glucose in the medium was measured with a glucose analyzer (Model 2700 STAT, Yellow Springs Instrument, Yellow Springs, Ohio, USA), and the medium was collected over time. The concentration of acetone produced therefrom was measured using a packed column (Supelco Carbopack ^TM B (Agilent 6890N GC System, Agilent Technologies Inc., CA, USA) equipped with a mechanical stirrer, AW / 6.6% PEG 20M, 2 m x 2 mm ID, Bellefonte, PA, USA)

As a result, the mutant microorganism ATCC 824-ACS / CODH produced butanol at a final concentration of 13.8 g / l and ethanol at 2.6 g / l at 37 ° C fermentation (Table 2). This is better than the 10.4 g / L butanol and 0.8 g / L ethanol produced by the control group. In particular, the yield of butanol was 0.20 g / g, which was higher than that of the control group of 0.16 g / g, and the butanol productivity was 0.40 g / L / h as compared with that of the control group of 0.26. In addition, cell mass was also improved. On the other hand, Clostridium carboxidivorans strain P7, which has a natural Wood-Ljungdahl pathway, is still producing 2.2 mg / L butanol. The embodiment of the present invention is a result that is naturally superior to strains having the Wood-Ljungdahl pathway and shows the merit of introducing the Wood-Ljungdahl pathway to other hosts through recombination.

Fermentation results of mutant microorganism ATCC 824-ACS / CODH Glucose
Consumption (g / L)
&
Consumption rate (g / h) OD BuOH
(g / L) EtOH
(g / L) Acetone
(g / L) Acetate
(g / L) Butyrate
(g / L) BuOH yield
(g / g) BuOH productivity
(g / L / h) ATCC 824 64.0
2.5 11.9 10.4 0.8 3.7 4.1 2.5 0.16 0.26 ATCC 824-ACS / CODH 69.6
3.8 14.7 13.8 2.6 2.6 4.6 1.8 0.20 0.40 Clostridium carboxidivorans P7 - - <0.003 - - - - - -

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the invention is not limited thereby. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea Advanced Institute of Science and Technology <120> Recombinant microorganism having the ability to fix carbon dioxide          and the method for producing useful substance using thereof <130> P11-B153 <160> 25 <170> Kopatentin 2.0 <210> 1 <211> 1386 <212> DNA <213> Clostridium difficile <220> <221> gene &Lt; 222 > (1) .. (1386) <223> dihydrolipoamide dehydrogenase coding gene <400> 1 atgaagatag tagtagtagg tggtggacca ggaggatatg tagcagctat aaaagcttct 60 atgcttggtg cagatgtaac agttgttgaa aaaagaagag ttggaggaac ttgcttaaat 120 gcaggatgta taccaactaa agcacttctt gcttcttcag gagtattgaa tactgtaaaa 180 gaagcaaagg attttggtat agaaatagat ggtacagtta agccaaactt cactgccata 240 atggaaagaa aaaataaagt tgtaaaccaa ttaataagtg gtatagagtt cttatttgaa 300 aaaagaggag taaacttagt taatggtttt ggaaaattaa ttgataaaaa cactatagaa 360 gtaactaaag atgatggaac agtagaaact ataaaagcag ataagataat actagcaaat 420 ggttctgttc cagttgtacc aagaatgttc ccatatgatg gaaaagttgt aataactagt 480 gatgaagttc ttggacttga agagatacct gagtctatgt taatagtagg tggtggagtt 540 ataggatgtg agatagggca gttctttaga gccttaggaa cagaagtaac tatagttgag 600 atggttgacc aaatactatt aaatgaagac aaagatgtag ctaaacaact acttagacaa 660 tttaagaaag ataaaattaa ggttattaca ggtattggag tacaaacttg tgaagtagtt 720 gatggtaagg ctgttgcaac tctttctaat ggaaaggtta tagaagcaca atatgcatta 780 gtatgtgttg gtagaagacc taaccttgac aattctggag tagaagatat aggaattgaa 840 atggaaagag gaaaagtagt agttaatgaa catcttgaaa ctaatgtaga aggtatatac 900 gcaataggcg atataataga tactcctttc ctagcacatg ttgcttctaa agaaggtatc 960 gtagcagttg aaaatgcttt aggtaagact aaggtagtag attatagagc aattccaaga 1020 tgtgtttata ctgaacctga agttgctggt gttggtaaga ctgaaaagca acttgaagct 1080 gaaggtgtag aatacaatgt aggtcaattt gattttagag gtcttggaaa agcacaagct 1140 ataggacatt tccaaggatt tgtaaaagtt atagctgaca aagaaactga taagataata 1200 ggtgcagcag tagtaggacc tcatgctaca gatttattga cagagttgtc acttgctgtt 1260 catctaggat taacagtaga acaagtaggg gatgcaatac atccacatcc gagtttatct 1320 gaagggctaa tggaagcact tcatgatgta catggagaat gtgttcattc tgtacctaaa 1380 ttataa 1386 <210> 2 <211> 771 <212> DNA <213> Clostridium difficile <220> <221> gene &Lt; 222 > (1) .. (771) <223> carbon monooxide dehydrogenase chaperone coding gene <400> 2 atgggataca atatagctgt tgcaggaaaa ggtggaactg gtaaaacaag tctcacaggg 60 cttttgattg attatttggt taaggacaaa aagggaccag tattagttgt agatgctgat 120 gccaatgcta acataaatga agtattaggt atcgaagttg aagcaacaat aggagaaata 180 agagaagaag taaatcaaag agaaaagtta ggcaatgcat tccctggtgg tatgacaaag 240 gcacaatatc ttcaatttag attaaattct ataattgaag aaggcgaagg atatgactta 300 ttagtaatgg gtaggtcaga aggtgaagga tgttactgtt ttgtaaatgg gatacttaga 360 gaacaagtaa acaaaatatc tggtcattac aaatacttag tcatggacaa cgaagctggt 420 atggaacatc taagtagaaa agtcactaga catgttgata cacttttatt ggttagtgat 480 tgctcaagac gtagcataca agctgttgct agaataagag atttagctga ggaactaaag 540 ttaagtgttg gaagaatact tttgattgta aataaagttc caaatggggt tatgaatgat 600 ggtgttaaag aagaaattga aaagcataac ctagagctaa tcggtgttgt acctatggat 660 gaattgatat atgaatatga ttctacaggt attcctttag ttaatttacc tgaagattca 720 aaatctaaag tggctatgaa agaaattttt gctaaattag aattaaaata g 771 <210> 3 <211> 945 <212> DNA <213> Clostridium difficile <220> <221> gene <222> (1). (945) <223> corrinoid iron sulfur protein small subunit coding gene <400> 3 atggcattta aaatgtctac tcaaaaatat tctggaaaaa tatcagaagt tgaagtagga 60 ataggggaaa aagcaattaa attaggtggg gaaaatgtat taccttttta tagttttgat 120 ggagaagtag gtaattctcc aaaaataggt atacaaatat cagacgttta tcctgaaagc 180 tggactgatt catataagga attatacaaa gatgtagcta attgtccagt agagtgggct 240 aaatatgttg aagctaatac acaagcagat tttatttgtt taaaatttga tggttctgac 300 ccaaatggat tagataagtc agttgatgaa tgtgctgatg tagctaaggc agtaattgaa 360 gcaataaaat tacctttagt tgtagctggt tcaggaaatc atgaaaaaga tggtaaatta 420 tttgaaaaat tagctcaaac attggatgga cataactgct tatttatgtc agcagtagaa 480 gataactaca aaggagtagg agcatcagct ggtatggctt atgcacataa agtaggagct 540 gaatcttctg ttgatataaa cctagctaaa caattaaacg tattgttaac tcaactaggc 600 gttaaaggtg aaaatatagt tatgaatgtt ggatgttcag cagttggtta tggatatgag 660 tacgttgcat ctactatgga tagaattaga cttgcagcat ttggtcaaaa tgataagaca 720 ttacaaatgc ctatcataac accagtagct tttgaagtag gtcatgttaa agaagctata 780 gctccaatag aagatgagcc agattggggt tgtccagaag aaagaactat agcaatggaa 840 gtttcaactg cagcaagtgt tttagtaggt ggttcaaacg cagttatact tcgtcatcca 900 aaatcaatag aaactataaa agaattggtt aacgcattag cttaa 945 <210> 4 <211> 1368 <212> DNA <213> Clostridium difficile <220> <221> gene &Lt; 222 > (1) .. (1368) <223> corrinoid iron sulfur protein large subunit coding gene <400> 4 atggcattaa aagctttaga tatatttaaa ttaacaccaa agaaaaactg taaggattgt 60 ggattcccaa cttgtatggc tttctctatg aaggttgctt caggagctgt agaagtaggt 120 aaatgcccac atatgtctga tgacgctata gcaaaattat cagaggctac tgcaccttta 180 atgaaagctt taaaagttgg tgctggtgca tctgagtatg aactaggtgg agaaacagta 240 ttatttagac atgaaaaaac attagtaagt agaaatagat atgcagtttc attctgtact 300 tgtatgagtg atgaagcagt agatgctaaa atagctaaca tgaaaaaagt tgactatgta 360 agaattggtg aacaaatgaa agttgaaatg gctgttttag agtattgtgg agataaagat 420 gcgtatttaa aattaataga taaaataaaa ggcagtggat tagaagtagc ttatatttta 480 gcttgtgatg atgcacaagt agttaaagaa gctgttgaag tattaaaaga tgctagacca 540 atggatatatg gagcaactaa agagaactac aaagatatga tagaagtagt taaaggagca 600 agtttaccat taggtgtaaa agctggtagc ttagaagaat tatatgaaac agttgaatta 660 attcaagctg ctggatataa agaattagta ttagatgtaa caggagaaaa cataaaagat 720 acttacacta atgctataca agttagaaga acagctttaa aagagcaaga tagaacattt 780 ggatatcctt caatagtatt tgcaaataga ttatctaatt caaaccctat gatggaagtt 840 gctttatcat caatattcac tataaaatac ggttctataa tagtaataga tgatattagt 900 tatgctaagg cattaccatt atttgcacta agacaaaaca tatacactga cccacaaaga 960 ccaatgagag ttgaaccaaa gatttatcca atcaacaacc cagatgaaaa ttctccagta 1020 ttagttactg ttgactttgc attaacttac ttcatagttg ctggtgatat agaaagatca 1080 aaagttccag tatggttagt aataccagat gcaggtggat attcagttct tacatcttgg 1140 gctgctggta aatttggtgg aaactcaatc tctgctttca ttaaagaaag taaggtagaa 1200 gaagtaacta attgtaaaga ccttatcatt ccaggaaaag ttgcagtact taaaggtgat 1260 atagaagata acttaccagg atggaatgta gttataggac cagaggaatc tatggaatta 1320 cctaagttct taaaaggata ccaagaaaaa gcatgccaaa caaactaa 1368 <210> 5 <211> 807 <212> DNA <213> Clostridium difficile <220> <221> gene &Lt; 222 > (1) .. (807) <223> methyltransferase subunit coding gene <400> 5 atggaaaaat ttatgattat aggtgagaga atacattgta tatcaccttc aataagaaaa 60 gcattagcag aaagagaccc agctccaatc ttaaaaagag caaaagagca attagaagca 120 ggagcacact atatagattt taatatagga cctgccgaaa gagatggcga agaaataatg 180 acatggggaa tcaaattact tcaatctgag ttcaacaatg ttcctatagc attagataca 240 gctaataaaa aagctatcga agctggactt aaagtttatg atagaactaa tgcaaaacca 300 ataataaact ctgctgatgc tggctcaaga tttgatttaa tagatatagc agctgaatac 360 gaagcaatgg ttataggttt atgtgcaaaa gaaggtattc caagagataa tgatgagcgt 420 atggcttact gccaagaaat attagaaaaa ggcttaatgt taggaatgga gccaactgat 480 atactatttg acccattatg cttagttata aaaggtatgc aagaaaaaca agtagaagtt 540 ttagaagcta taaaaatgat gactgagatg ggacttttaa ctacaggagg attatctaac 600 gtatctaatg gatgtcctaa gcatgttaga cctgttttag atagtgcatt cttagcaatg 660 gcaatggcta atggatttag ttcagctata atgaatccat gtgacccaga attaatgaaa 720 actgtaaaat cttgtgacat aatcaacggg gcatctttat atgcagactc tttcttagag 780 ttaaatgaag gtggatttgc tttctag 807 <210> 6 <211> 2127 <212> DNA <213> Clostridium difficile <220> <221> gene &Lt; 222 > (1) .. (2127) <223> ACS or ACSCODH subunit alpha coding gene <400> 6 atgaatctat ataatataat ctttacaggg tcagaacaag ctttaggtgc ggctcaagct 60 atgttagctg aagctataga aaagaatgga aaagagcata aagttgcttt ccctgataca 120 gcatattcat taccttgtat atatgctgca acaggacaaa agatgaacac tttaggggac 180 ttagaaggtg ctttagaagt agtaaaatct ttaataaata gaactcattt actagaacat 240 gcttttaatg ctggtttagc tacagcttta gcagcagaag taattgaagc attaaaatat 300 tcaactatgg atgctccata tagtgagcca tgtgcaggtc atataactga ccctataatc 360 agatcacttg gtgtaccatt agttacagga gatatacctg gtgttgcagt tgttcttggt 420 gagtgtccag atgcagaatc agcagcaaaa gttataaaag attaccaatc taaaggttta 480 ctaactttct tagttggtaa agttatagac caagctatag aagctggagt aaaaatgggt 540 cttgagctaa gagttatacc tctaggatat gatgtaactt ctgttataca cgttgtatct 600 gttgcagtaa gagcagcatt aatattcggt ggattaactc ctggtgattt aaacggatta 660 ttagagtaca cagctaatag agttcctgca tttgttaatg catttggacc attaagtgaa 720 ttagttgtat ctgcaggtgc tggagcaata gctttaggat tcccagttat aactgaccaa 780 acagttcttg aagttccaat gaacctatta actcaaaaag attacgataa gatagtagct 840 acttcattag aagctagagg aataaaaata aaagttactg aaatacctat cccagtttca 900 tttgcagcag catttgaagg tgagagaatt agaaagagcg atatgtttgc tgagtttggt 960 ggaaacagaa ctgaagcttg ggagcttgtt gttaagaaag aagcaacaga agttgaagac 1020 cataagatag aaataatagg accaaatata gatgaagttg atgcagatgg tgtattaaga 1080 ttaccacttg ctgtaatagt taaaatagct ggtaaaaata tgcaagaaga tttcgagcca 1140 gttcttgaaa gacgtttcca ctacttctta aactatatag aaggtgtaat gcacgttgga 1200 caaagagata tggcttgggt aagaatctct aaagatgcat ttgataaagg atttagactt 1260 gagcatatag gagaagtttt atatgctaag atgttagatg aatttgaatc agtagttgat 1320 aagtgtgaaa taactataat tacagatgct gaaaaagttt ctgaattaaa aggtgaagca 1380 atagctaagt acaatgctag agatgaaaga ttagcttcat tagttgatga aagtgttgac 1440 actttctatt cttgtaactt atgtcaatca tttgcaccag ctcacgtttg tgttgttact 1500 cctgaaagac ttggtctttg tggagcagtt agctggttag atgctaaggc tactaaagaa 1560 ttagacccaa caggtccttg tcaaccaata gaaaaaggcg agtgcttaga tgatagaaca 1620 ggtgtatgga attcagtaaa tgaaactgta aaccaaatat ctcaaggtgc agttgaatct 1680 gttacattat actctatact agaagaccca atgacttctt gtggatgctt cgaatgtatc 1740 tgtggtataa tgccagaagc aaatggattt gttgtagtta acagagaatt tgcaagtgtt 1800 actccagttg gtatgacttt cggagaactt gcttctatga caggtggagg agttcaaact 1860 ccaggattta tgggacacgg aagacatttc atatcttcta aaaaattcgc ttatgcagaa 1920 ggtggaccag aaagaatagt ttggatgcca aaagaattaa aagattatgt agctgataaa 1980 ttaaatgcta cagttaaaga aatgactgga atagaaaact tctgtgatat ggtttgtgat 2040 gaaactatag ctgacgattc tgaaggagta ttagctttct tagaagaaaa aggtcatcca 2100 gcattagcta tggaaagtgt aatgtaa 2127 <210> 7 <211> 378 <212> DNA <213> Clostridium difficile <220> <221> gene &Lt; 222 > (1) .. (378) <223> glycine cleavage system H protein coding gene <400> 7 atgaaattat taccagaatt aaaatactct aaagatcatg agtgggtaaa agtaattgat 60 ggagatgttg tatatatagg tataacagac tatgctcaag atcaattagg agaaatattg 120 tttgttgaaa caccagaagt agaagatact gtaactaagg gagtagattt tggagtagtt 180 gagtcttcta aagtagcttc tgatttaata tctcctgtta atggtgaggt attggaagtt 240 aatgaaaaat tagaagatga gccagaatgt ataaatgaag acccatatga aaactggata 300 ttaaaagtaa aactagctga tgtggctgaa cttgatacgt tattaagtga taaagaatac 360 gaggctggat tagaataa 378 <210> 8 <211> 1890 <212> DNA <213> Clostridium acetobutylicum <220> <221> gene <222> (1) .. (1890) <223> carbon monooxide dehydrogenase coding gene <400> 8 atgagtgaat gtcaaaattg tcatgtttgc gatgatgcag acaaaactct tcgtgatttt 60 atatgtgggt taaataatgt tgaaacgtca gaacatagag tggaaagtca aaagaataaa 120 tgtaagtttg gtaaagatgg tgtctgttgt aagctttgtg ctaatggacc atgtagaata 180 acaccaaagt caccaagagg tatttgtggt gcagatgctg acactatagt agctagaaac 240 tttttaagag cagttgcagc aggaacagca tgctatgttc acgttgtgga gactactgct 300 agaaacttaa aggctttagg agaaaacaag aagcctataa aaggaatgta tactcttaat 360 aagctagcaa atatgtttaa aatagatgaa aaagatgatc acaaaaaagc agttatgata 420 gcagatagag tactttctga tttatataaa ccaagatttg aaaaagcaga attagtaagc 480 gaaatagcat atgcaccaag attaaaaaaa tggcaggaac ttaatatact tccaggagga 540 gcaaaatcag aagtatttga tgctatagta aaaacttcaa caaatttaaa tagtgatcct 600 gtagatatga ctgtaaattg tcttactctt ggaatatcaa caggactata tggtcttact 660 ttaactaact tattaaatga tgttatactt ggtgaaccag taataagaca ggcaaatgtt 720 ggtttcaagg tagtagatcc ggattatata aatataatga taacaggaca tcaacattca 780 gtaatagaac atcttcaaga aagattaata gatgaagata ttactaagaa agctcaggct 840 ataggagcta aaggatttaa attagtggga tgtacatgtg ttggtcaaga tcttcaacta 900 agaggagaac attataagga agtattttca ggtcatgcag gaaataactt tacaagtgaa 960 gctttaattg caacaggtgg aatagacctt attatgtcag agtttaactg tactcttcca 1020 ggtatagaac ctattgccga agaatttgaa gttaaaatga tttgtgttga tgatgttgct 1080 aaaaagaaaa atgctgattt tataaagtat agttatgaag agagagaaaa tataactgat 1140 agatataatag aagaagctct taagagttat gaaaatagaa gaaaagatgt aacaattaat 1200 atacctaaag atcatggata tgatgatgtt gtaactggag tcagtgaaaa atctcttaaa 1260 gattttcttg gaggcacttg gaagccactt gtagatttga ttgcatctgg caaaatcaaa 1320 ggtgttgctg gagtagtagg atgttctaac cttacagcaa aaggtcatga tgtatttaca 1380 gtagaactta caaaagaact tataaaaagg aatataatag ttctttcagc aggatgctcc 1440 agtggtggac ttgaaaatgt agggcttatg tctccttcag cagctgatct tgcaggagat 1500 agtctaaaag aagtatgtaa atctcttggt attcccccag tacttaattt tggaccatgc 1560 cttgctatag gaagacttga gattgttgct acagaacttg ctgaatactt aggaatagat 1620 ataccacaac ttcctctagt actttctgca ccacaatggt tagaagaaca agcattagct 1680 gatggagctt ttggactttc attaggactt cctcttcatc ttgcaatttc accatttata 1740 gatggaagtg ctgttgtttc taagcttcta aaagaggatc ttactgatat tacaggaggt 1800 aagcttataa tagaagaaga tgtaataaaa gcagcagata agcttgagag ggaaattatt 1860 gatagaagag aaaaattagg gcttaattag 1890 <210> 9 <211> 1920 <212> DNA <213> Clostridium acetobutylicum <220> <221> gene <222> (1) (1920) <223> carbon monooxide dehydrogenase coding gene <400> 9 atgagtgaaa ccatatcaga aaagtcagag ggaagggtaa gctaccatga ttctgtagaa 60 gaaatggtaa aaaaaattag agaagatgga atgtctaatg tttttgatag atatgccctt 120 caagagaaaa tacgatgtaa gttttgtcta gaaggtttaa gctgtcagct ttgctctaat 180 ggtccttgta gaataagtga aaaaacaggc caagagaaag gagtttgcgg tataggccca 240 gatgcaatgg caatgagaaa ttttcttcta aaaaatataa tgggtgctgg tacatatagc 300 catcatgctt atgaagccta tagaacctta aaggctactg ctgaaggaag aacacctttt 360 aaaataacag atgaaaacaa acttaaatgg atgtgtgaaa agcttggcat tgatacagct 420 caatctataa acgatatggc ctttgagctt gctgtaatcc ttgaggatca acaaagaatt 480 ggagttgaag atcaaaatgt tatggttgag gcctttgctc caaagaaaag aatagaagct 540 tggaaaaaac taggcatata tcctgctgga acagttcatg aagagcaaaa ctgtgttgca 600 agctgcctta caaacgtaga tggaagtcat atatctcttg ctatgaaagc cttaagactt 660 ggaatagcta caatatataa cactcaaata ggtcttgaaa tggttcagga tatattgttt 720 ggaacaccaa cacctcatga agttaatatg gatttaggca taatggatcc tgaatatgtc 780 aacatagtat tcaatggtca tcaaccttgg ataggtgctg ccactatttt aaaagccaaa 840 actcctgaaa ttcaagatat ggcaaagcag gctggtgcta aaggtttaag ggttgtaggt 900 tccatcgaaa caggtcaaga gcttctacaa agattccctg ttgacgaagt atttgtaggt 960 catatgggaa attggcttgc aatagaaccc cttttagcta caggtactgt tgatatattt 1020 gcaatggaag aaaactgctc tcctccagct attgatatgt atgctgaaaa atatcaagta 1080 accttggcag ctgtaagtac tattatagat ttgcctggag ttaattataa atttccatac 1140 gatcctgcac aagctgatga aacagcacaa agattaattg aactcggaat agaaaacttt 1200 aaaaagagaa aagaaagaca gataaaacct cacgttcctc aaaaaataca aaaggctata 1260 gctggattct ctaccgaagc agttcttgga gctcttggca acaaacttga tccactagtt 1320 gatgtaatag ctaagggtca gattaaggga gttgttgctc ttgctaactg ttcaacttta 1380 cgaaatggtc ctcaagattg ggtaacaatt aaccttacaa aggaacttat taaaagagat 1440 attttagttg taagcggcgg ctgtggtaat catgctcttg aggttgcagg actttgtact 1500 ctcgatgctg caaataatat tgctggtaat ggtctaaaag cagtttgtaa tgcacttaag 1560 atacctcctg ttttaagttt tggaacctgc acagatacag gaagaatttc tatgcttgtt 1620 acagcattag ctgaacactt aaacgtagat gttccacaac ttcctattgc agtaacagct 1680 cctgagtgga tggaacagaa agctactata gacggtattt ttgctttagc ttatggtgcc 1740 tacactcatt tatcacctac tccttttatg actggagcta gacagctagt tgatttactt 1800 actaataaag ctgaggatgt aactggaggt aaaatagctc ttggcgatga ccctatgaag 1860 gttgcaaatg acattgagga tcacataatg agaaaaagga aagaattagg tttaagctaa 1920                                                                         1920 <210> 10 <211> 1671 <212> DNA <213> Clostridium acetobutylicum <220> <221> gene &Lt; 222 > (1) .. (1671) <223> formyl-H4folate synthase coding gene <400> 10 atgaaaactg atattgaaat agctcaagaa gctaaaatgg aacctatagt aaaaatagca 60 gagaagattg gtttaaatga agacgatatt gatttatatg gtaaatataa gtgtaaaata 120 tcgctagatg tattgaaaca aaacaagaac aaacaagatg gtaaattggt gttggttact 180 gctataaatc ctacaccagc tggtgaggga aaatctacag ttacagtggg acttggggaa 240 gccctatgca aaatgaacaa gaatacagtg attgcactta gagaaccttc tcttggacct 300 gtttttggta ttaaaggagg agctgctgga ggcggttacg ctcaagtagt accaatggaa 360 gatataaatc ttcattttac tggagatatg catgctataa cttcagcaaa caatttactc 420 tgcgcagcta tagataacca tattcaccaa ggaaatagtt tgaaaataga ccaaagaaga 480 atagtattta aaagagttat ggatatgaat gatagagctc ttagaagtat agtagttggt 540 cttggaggaa aagtaaatgg ttttccaaga gaagacggtt ttatgataac agttgcttct 600 gaaataatgg ctatactttg tttggcaaat gatcttatgg atttaaaaga gagaatggga 660 aagatactaa tagcctatga tttggatggg aatccagtat attgtaggga tctcaaagtt 720 gaaggtgcta tggctatgct tatgaaagac gcaatgaagc ctaatttggt tcaaacgctt 780 gagaatactc cagctataat tcatggtgga ccttttgcaa atatagccca tggatgcaac 840 agtatcttag ctacaaagat ggcgttgaag cttggagatt atgttattac agaggcaggt 900 ttcggtgcag atttaggagc tgaaaaattc ttagatataa aatgtaggta cggaaactta 960 aaccctgatt gcgttgtatt agttgcaaca attagagcac ttaaacatca cggtggtgca 1020 ctaaaggagg atttaagtaa accaaatgca aaggttcttg aaaaaggact atcaaattta 1080 ggtaaacaaa tagagaatat aaagaaatac ggtgtgcctg ttgttgttgc aataaataaa 1140 tttataacag acagtgaaga agaaataaaa tgcatcgaag aatactgtag taaacaggga 1200 gtaaaggtat cgcttacaga agtttgggaa aaaggcggag aaggtggaac agatcttgca 1260 aataaggttt tagacacttt agaaaatgaa aagagcaatt ttaagtatct atatgatgaa 1320 aagctaagta taaaagaaaa aatggatata atagctaaag aaatatatgg agcagatgga 1380 gttcagtata ctcctcaagc aaacaaacag ataaaagaaa ttgagaaatt taatttggat 1440 aaactcccta tatgtgttgc gaaaacacag tattctttat ctgataatcc agctctttta 1500 ggaagaccaa ctaactttac tataaatgtt aaggaagtaa gagtatctaa tggagcaggt 1560 tttgtggtag ttcaaaccgg aaatatcatg actatgccag gacttccaaa gactccagct 1620 gcaaataaaa tggatatatt tgaagatggc tctatagtag gtttatttta a 1671 <210> 11 <211> 636 <212> DNA <213> Clostridium acetobutylicum <220> <221> gene &Lt; 222 > (1) .. (636) <223> formimido-H4folate cyclodeaminase coding gene <400> 11 atgatacagg atatatctat agaggaattt ataaaagaac ttgcatcgga aaaaccaact 60 cctggcggcg gtggagcggc agcactttca gcagcacttt cagcagcgct taattgtatg 120 gtgtttaact ttaccgtagg aaaaaaagtt tatgaaaatt atgataaaga aactaaaaaa 180 ttaatcaata gcagtctaga aaaatcagac aagcttaagg attatttctt atgtggtata 240 gataaagatg cggaggcttt ctcaaaaata ataaatagtt acaaacttcc ccaaagtaca 300 gaagaagaaa aagcatatag gcataaatgt atacaagaag cttcaaaatt tgcagcaaaa 360 gtaccagaag atgtagccaa taatgcacgt gaactttttg aattgatttg gatttcagca 420 aagttaggaa ataaaaatct tataacagat gctggggcag ctgcaataat ggctgaagca 480 gctattgaaa catcaatatt gaatataaag ataaacatag gatctataga ggataaggag 540 ttaaaagcaa gacttgaaaa aacttgcaga gatttacttt tagatagtaa agaatggaaa 600 gataaaatat taagtgaagt atattcgaat atatag 636 <210> 12 <211> 837 <212> DNA <213> Clostridium acetobutylicum <220> <221> gene <222> (1). (837) <223> formimido H4folate cyclodeaminase coding gene <400> 12 atgggagata taattaatgg aaaagcggaa tctcaaaagt ataaagataa aataattgaa 60 tttattaatg aaagaaagaa acaggggtta gatattccat gcatagccag tataacagtt 120 ggagatgatg ggggctcatt atactatgtt aacaatcaaa aaaaagtatc agaaagtctt 180 ggaattgagt ttaagagtat atttttagat gaaagtatac gagaggaaga actaataaag 240 ttaattgaag gtctaaacgt agataataaa attcatggaa ttatgcttca attaccgctg 300 cctaatcaca ttgatgcaaa actagtcaca tctaaaatag atgctaataa agatatagat 360 agtcttacag atataaatac aggaaaattt tacaagggtg aaaaatcatt tataccatgc 420 acgccaagaa gtattataaa tcttataaag agtttaaatg tggatatttg tgggaaaaat 480 gcagttgtaa tagggagaag taacattgta ggtaaaccta cagcgcagct tttactaaat 540 gaaaatgcaa cggttacaat atgccactct agaacacaaa acttaaaaga tatatgtaaa 600 aaagctgata ttattgtaag tgctattgga agaccaggtt ttataacaga tgaatttgtt 660 aatgaaaaat ctattgtaat tgatgttgga actacagtag tagatggtaa acttcgtgga 720 gatgtggttt ttgatgaggt tataaaaaag gcagcttacg taactccagt tcctggggga 780 gtaggggcga tgacaaccac aatgttaata ttaaatgttt gtgaggcatt gaaataa 837 <210> 13 <211> 198 <212> DNA <213> Clostridium acetobutylicum <220> <221> gene &Lt; 222 > (1) .. (198) <223> formyl H4folate cyclohydrolase methylene H4folate dehydrogenase          coding gene, methylene H4folate reductase coding gene <400> 13 ttgcttgata tatcgctttt atttaaaatt gcgggagttg gaattcttac tataattata 60 gataaaatac ttaaatccag tggaaaagat gattttgcag tagtaacaaa tttggcaggc 120 atagtgatcc tcctcttgat ggtaataagc ctaataagta aattgtttga ggctgtaaag 180 actatgtttc aactttag 198 <210> 14 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ggccccaagc ttagaatgaa gtttcttatg cacaag 36 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 aaactgcagt ctaactaacc tcctaaattt tgatac 36 <210> 16 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ccaagcttcg actttttaac aaaatatatt g 31 <210> 17 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 aaaactgcag ccatggtcta actaacctcc taaattttga tac 43 <210> 18 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 catgccatgg tctagactgc agttaccaca tgggaataac agc 43 <210> 19 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tacgcgtcga cgcatgcggt accgttgatc caaatctagg gtgc 44 <210> 20 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 catgccatgg atgaagatag tagtagtagg tggtgg 36 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gtttgaacca cctactaaaa cac 23 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 catttggacc attaagtgaa ttag 24 <210> 23 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 cccccggggg ctatgaatat atctgcattt cttgc 35 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 cagaagaaag aactatagca atgg 24 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 tgggaatcct aaagctattg c 21

Claims (22)

A gene encoding an acetyl-CoA synthase / carbon monooxide dehydrogenase (ACS / CODH) complex is added to a host microorganism having a gene encoding an enzyme involved in the Wood-Ljungdahl pathway. Or a recombinant vector containing the gene is introduced,
The gene coding for the ACS / CODH complex is preferably selected from the group consisting of i) dihydrolipoamide dehydrogenase, ii) carbon monooxide dehydrogenase chaperone, iii) cornoid iron-sulfur (V) Methyltransferase subunit; (vi) Acetyl-CoA synthase; (v) Methyltransferase subunit; (c) An enzyme (ACS) or an ACS / CODH subunit alpha; and vii) a gene encoding glycine cleavage system H protein.
delete 2. The method according to claim 1, wherein the gene encoding dihydrolipoamide dehydrogenase is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 1, wherein the carbon monooxide dehydrogenase chaperone is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 2 is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 2, and a gene encoding a corrinoid iron-sulfur protein small subunit is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 3, The gene encoding the cornino iron-sulfur protein large subunit is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 4 and the gene encoding the methyltransferase subunit is the nucleotide sequence of SEQ ID NO: (Acetyl-CoA synthetase (ACS), &lt; / RTI &gt;&lt; RTI ID = The gene coding for the ACS / CODH subunit alpha is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 6, and the gene coding for the glycine cleavage system H protein is a nucleic acid having the nucleotide sequence of SEQ ID NO: Wherein the recombinant microorganism has the ability to fix carbon dioxide.
2. The recombinant microorganism having the ability to fix carbon dioxide according to claim 1, wherein the gene encoding the ACS / CODH complex is obtained from acetogen or methanogen.
The recombinant microorganism having the ability to fix carbon dioxide according to claim 1, wherein the host microorganism is different from the microorganism that obtained the gene encoding the ACS / CODH complex.
The recombinant microorganism according to claim 1, wherein the host microorganism is derived from Clostridium sp.
delete 2. The method according to claim 1, wherein the gene coding for the enzymes involved in the Wood-Lung pathway is selected from the group consisting of carbon monooxide dehydrogenase, formyl-H4folate synthase, Formyl-H4folate cyclodeaminase, formyl-tetrahydrofolate cyclohydrolase / methylene-tetrahydrofolate dehydrogenase, and the like. Wherein the recombinant microorganism is one or more genes selected from the group consisting of genes coding for methylene-tetrahydrofolate reductase.
9. The method according to claim 8, wherein the gene encoding carbon monooxide dehydrogenase is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 9, and formyl-tetrahydrofolate synthetase, H4folate synthase) is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 10, and the gene encoding formimido-H4folate cyclodeaminase is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 12 Nucleotide sequence, and the gene encoding formyl-tetrahydrofolate cyclohydrolase / methylene-tetrahydrofolate dehydrogenase (SEQ ID NO: 13) is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: Is a nucleic acid molecule having a nucleotide sequence, and methylene-tetrahydropoly Reductase gene coding for (methylene-H4folate reductase) is a recombinant microorganism having a carbon dioxide fixing capacity characterized in that the nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 13.
A gene encoding an acetyl-CoA synthase / carbon monooxide dehydrogenase (ACS / CODH) complex is added to a host microorganism having a gene encoding an enzyme involved in the Wood-Ljungdahl pathway. Or a recombinant vector containing the gene is introduced,
The gene coding for the ACS / CODH complex is preferably selected from the group consisting of i) dihydrolipoamide dehydrogenase, ii) carbon monooxide dehydrogenase chaperone, iii) cornoid iron-sulfur (V) Methyltransferase subunit; (vi) Acetyl-CoA synthase; (v) Methyltransferase subunit; (c) An enzyme (ACS) or an ACS / CODH subunit alpha; and vii) a gene encoding glycine cleavage system H protein.
delete 11. The method according to claim 10, wherein the gene encoding dihydrolipoamide dehydrogenase is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 1, wherein the carbon monooxide dehydrogenase chaperone is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 2 is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 2, and a gene encoding a corrinoid iron-sulfur protein small subunit is a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 3, The gene encoding the cornino iron-sulfur protein large subunit is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 4 and the gene encoding the methyltransferase subunit is the nucleotide sequence of SEQ ID NO: (Acetyl-CoA synthetase (ACS), &lt; / RTI &gt;&lt; RTI ID = The gene coding for the ACS / CODH subunit alpha is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 6, and the gene coding for the glycine cleavage system H protein is a nucleic acid having the nucleotide sequence of SEQ ID NO: Wherein the recombinant microorganism has the ability to fix carbon dioxide.
11. The method according to claim 10, wherein the gene encoding the ACS / CODH complex is obtained from acetogen or methanogen.
[Claim 11] The method according to claim 10, wherein the host microorganism is different from the microorganism that obtained the gene encoding the ACS / CODH complex.
11. The method according to claim 10, wherein the host microorganism is derived from Clostridium sp.
delete 11. The method according to claim 10, wherein the gene coding for the enzymes involved in the Wood-Ljungdahl pathway is selected from the group consisting of carbon monooxide dehydrogenase, formyl-H4folate synthase, Formyl-H4folate cyclodeaminase, formyl-tetrahydrofolate cyclohydrolase / methylene-tetrahydrofolate dehydrogenase, and the like. Wherein the recombinant microorganism is one or more genes selected from the group consisting of genes coding for methylene-tetrahydrofolate reductase.
18. The method of claim 17, wherein the gene encoding carbon monooxide dehydrogenase is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 9, and formyl-tetrahydrofolate synthetase, H4folate synthase) is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 10, and the gene encoding formimido-H4folate cyclodeaminase is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 12 Nucleotide sequence, and the gene encoding formyl-tetrahydrofolate cyclohydrolase / methylene-tetrahydrofolate dehydrogenase (SEQ ID NO: 13) is a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: Is a nucleic acid molecule having a nucleotide sequence, and methylene-tetrahydropoly Reductase gene coding for (methylene-H4folate reductase) is a method of producing a recombinant microorganism having a carbon dioxide fixing capacity characterized in that the nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 13.
Of claim 1, claim 3 to claim 6, claim 8 and claim 9, wherein in any one of, CO ₂ fixation, comprising a step of culturing a recombinant microorganism under CO ₂ present.
The recombinant microorganism of any one of claims 1 to 10, wherein the recombinant microorganism is cultivated with CO ₂ as a carbon source to produce a useful substance, and then the produced useful substance is recovered Or a mixture thereof.
21. The method according to claim 20, wherein the useful substance is an alcohol.
22. The method of claim 21, wherein the alcohol comprises butanol or ethanol.

Images