KR20180038404A - Recombinant microorganism with regulated glycolytic flux and method of producing compound using the same - Google Patents

Abstract

The present invention relates to a recombinant microorganism with regulated glycolytic flux and to a method for producing a compound using the same, and more specifically, to a recombinant microorganism having improved productivity of butanol, butylic acid and 2,3-butanediol by regulating a glycolytic process by regulating the expression level of the ptsG gene, and to a method for producing butanol, butylic acid and 2,3-butanediol using the same. The recombinant microorganism which regulates the expression of the ptsG gene by regulating the expression level of the ptsG gene, according to the present invention, has remarkably increased productivity of the butanol, butylic acid and 2,3-butanediol compared with a parent strain to be widely used in various industrial fields using the butanol, butylic acid and 2,3-butanediol.

Description

TECHNICAL FIELD [0001] The present invention relates to a recombinant microorganism and a method for producing the same. More particularly, the present invention relates to a recombinant microorganism,

The present invention relates to a recombinant microorganism whose process is controlled and a method for producing the compound using the recombinant microorganism. More specifically, the present invention relates to a method for producing a recombinant microorganism, And a process for producing butanol, butyric acid and 2,3-butanediol using the recombinant microorganism.

Due to the recent rise in oil prices, interest in alternative energy sources such as biofuels has increased, and interest in butanol, which is superior to gasoline as a substitute for gasoline, is increasing.

On the other hand, 2,3-butanediol, which is one of the alcohols having four carbon atoms and two hydroxyl groups (-OH) (CH3CHOHCHOHCH3), is a 1,3-butadiene (1,3-butadiene) (Mie et al., Biotechnol. Adv., 29: 351, 2011) can be converted into methyl ethyl ketone (MEK) as a fuel additive and solvent. In addition, 2,3-butanediol is an industrially important intermediate because it can be mixed with gasoline as an octane booster (Celinska et al., Biotechnol. Adv., 27: 715, 2009).

2,3-butanediol can be produced through a chemical synthesis process and a microbial fermentation process. However, since 2,3-butanediol production cost is very high, 2,3-butanediol production on a commercial scale has not been achieved. In recent years, along with the rapid development of 2,3-butanediol production technology through the microbial fermentation process, the rapid increase of the price of raw materials of fossil materials and the regulation of international environmental pollution have been strengthened, Interest in production and the importance of research and development are increasing.

The present inventors have confirmed that the process can be effectively controlled by controlling the expression level of the ptsG gene, and a recombinant microorganism having improved production of butanol, butyric acid, and 2,3-butanediol by controlling the quantitative expression level of the gene To thereby complete the present invention.

It is an object of the present invention to provide a method for producing a 5 ' UTR sequence comprising introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; And a method for producing a microorganism for producing butanol.

It is another object of the present invention to provide a recombinant microorganism for producing butanol, which is produced using the above method.

It is still another object of the present invention to provide a method for producing a recombinant microorganism, which comprises culturing the recombinant microorganism; And a method for producing butanol.

It is another object of the present invention to provide a method for producing a 5 ' UTR sequence comprising the steps of: introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; And a method for producing a microorganism for producing 2,3-butanediol.

Also, an object of the present invention is to provide a recombinant microorganism for producing butyric acid or 2,3-butanediol, which is produced by using the above production method.

It is still another object of the present invention to provide a method for producing a recombinant microorganism, which comprises culturing the recombinant microorganism; Butanediol or 2,3-butanediol.

It is an object of the present invention to provide a method for producing a 5 ' UTR sequence comprising introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; And a method for producing a microorganism for producing butanol.

It is another object of the present invention to provide a recombinant microorganism for producing butanol, which is produced using the above method.

It is still another object of the present invention to provide a method for producing a recombinant microorganism, which comprises culturing the recombinant microorganism; And a method for producing butanol.

It is another object of the present invention to provide a method for producing a 5 ' UTR sequence comprising the steps of: introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; And a method for producing a microorganism for producing 2,3-butanediol.

Also, an object of the present invention is to provide a recombinant microorganism for producing butyric acid or 2,3-butanediol, which is produced by using the above production method.

It is still another object of the present invention to provide a method for producing a recombinant microorganism, which comprises culturing the recombinant microorganism; Butanediol or 2,3-butanediol.

The productivity of butanol, butyl acid or 2,3-butanediol was significantly increased in the recombinant microorganisms controlling the process through the regulation of the expression level of the ptsG gene according to the present invention, - It can be widely applied in various industrial fields where butanediol is used.

Figure 1 is a schematic diagram illustrating the dynamic imbalance between glycolysis and metabolic pathways and the concept of a metabolic valve. Specifically, it is possible to produce optimized products by quantitatively controlling the process using the expression amount of ptsG as a metabolic valve.
Figure 2 is a schematic diagram of a metabolic pathway of E. coli wild type (a), ptsG UTR variant are glucose uptake rate in each of the strains introduced ^- growth rate of the ^{(mmol g DCW -1 h 1)} (b), acetic acid (c) and pyruvic acid (d) of Fig.
FIG. 3 is a graph showing the results of confirming the degree of consumption of biomass, butanol, pyruvic acid, and glucose in each strain in which the ptsG UTR mutants were introduced (a), a schematic diagram of the n-butanol metabolic pathway. Specifically, the degree of accumulation of pyruvic acid (c) according to the glucose consumption rate was confirmed, and the yield (blue line) and productivity (red line) of n-butanol in each strain were confirmed (d).
FIG. 4 shows the metabolic pathway diagram (a) of butyric acid, the metabolic pathway diagram (b) of 2,3-butanediol, the JHL265 strain redesigned metabolic pathway for the production of butyric acid, and UTR5 for overexpression of ptsG Comparison of butyl acid production of JHL266 strain (c) and comparison of JHL267 strain redesigned for metabolism pathway for 2,3-butanediol production and 2,3-butanediol production of JHL268 strain with UTR5 for overexpression of ptsG (d ). Fig.

Hereinafter, the present invention will be described in detail.

Terms not otherwise defined herein have meanings as commonly used in the art to which the present invention belongs.

The present inventors have conducted extensive studies to produce E. coli capable of producing metabolic products such as butanol, butyric acid or 2,3-butanediol with high yield and high productivity by quantitatively controlling the corresponding processes. A recombinant microorganism capable of efficiently producing a desired metabolite by introducing a ptsG gene linked to a synthetic 5 'UTR sequence artificially redesigned to regulate the expression level in an E. coli strain that has been redesigned for metabolic pathway, and a recombinant microorganism The manufacturing method was first described.

In one embodiment, the present invention provides a method for producing a 5 ' UTR sequence comprising: introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; And a method for producing a microorganism for producing butanol.

In order to control the expression level of the ptsG gene coding for the glucose-specific transporter of the phosphotransferase system (IICB ^Glc ), Escherichia coli (Escherichia coli) may have been redesigned based on the base pair between SgrS and ptsG, a small RNA (sRNA) from E. coli. The synthetic 5 'UTR can be constructed in a manner that sequentially regulates the relative activity of the 5' UTR relative to the wild type 5 'UTR (UTR _WT in one embodiment of the invention).

In the present invention, the synthetic 5 'UTR may be a synthetic 5' UTR consisting of a single sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 4.

In addition, in the present invention, the method comprises: introducing an adhE2 gene and a fdh1 gene for butanol production into a microorganism; But is not limited thereto.

In the present invention, the microorganism introduction of the target gene is preferably carried out through genetic information substitution of the microbial chromosome, and this can be carried out by using methods known in the art without limitation. In an embodiment of the present invention, a red recombination system is used, but the present invention is not limited thereto.

In addition, the introduction of the microorganism into the target gene may be accomplished through the introduction of a recombinant vector, and the recombinant vector may be composed of one or a plurality of vectors, and the one or more vectors may be introduced into the microorganism. It is not limited.

In the present invention, "gene" should be regarded as the broadest meaning, and it is possible to encode a structural or regulatory protein. Wherein the regulatory protein comprises a transcription factor, a heat shock protein or a protein involved in DNA / RNA replication, transcription and / or translation. In the present invention, the target gene to be inhibited in expression may exist as an extrachromosomal component.

In the present invention, "vector" means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. In addition, the recombinant plasmid vector may preferably be pCOLADuet, pCDFDuet, pETDuet or pRSFDuet, but is not limited thereto.

Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several to several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector, (C) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA. After ligation, the vector should be transformed into the appropriate host cell. Transformation can be easily accomplished using a calcium chloride method or electroporation.

As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and detoxification control regulatory sequence that functions within the selected expression host. Preferably, the expression control sequence and the gene are contained within a recombinant vector containing a bacterial selection marker and a replication origin.

In the present invention, a "recombinant vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked to a particular host organism. The recombinant vector may preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include, but are not limited to, antibiotic resistance genes such as ampicilin, kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, It can be selected appropriately.

Also, the present invention provides a recombinant microorganism for producing butanol, which is produced using the above method.

In the present invention, the recombinant microorganism means transformed. In the present invention, "transformation" means introducing a vector containing a promoter or a gene encoding a desired protein into a host cell, and includes overexpression or deletion of the gene. In addition, the gene encoding the transformed target protein can be inserted into the chromosome of the host cell or located outside the chromosome as long as it can be expressed in the host cell.

Not all vectors function equally well in expressing the DNA sequences of the present invention, and likewise all hosts do not function equally in the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

In the present invention, the microorganism may be selected from the group consisting of bacteria, yeast and fungi. Preferably, the bacteria are selected from the group consisting of Corynebacterium and Escherichia , And more preferably E. coli.

The present invention also relates to a method for producing a recombinant microorganism, which comprises culturing the recombinant microorganism of the present invention; ≪ / RTI >

The medium used for culturing the microorganism of the present invention and other culture conditions may be any medium used for culturing Escherichia genus microorganisms, but the microorganisms of the present invention must satisfy the requirements of the present invention. Preferably, the microorganism of the present invention is cultured in an ordinary medium containing an appropriate carbon source, a nitrogen source, an amino acid, a vitamin, and the like under aerobic conditions while controlling temperature, pH, and the like.

The medium may include potassium phosphate, potassium phosphate and the corresponding sodium-containing salts as a source. Examples of the inorganic compound may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate. In addition, amino acids, vitamins and suitable precursors may be included. These media or precursors may be added to the culture either batchwise or continuously.

During the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, foaming can be suppressed by using a defoaming agent such as fatty acid polyglycol ester during the culture. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without injecting gas to maintain anaerobic and aerobic conditions.

The temperature of the culture can usually be set at 27 캜 to 37 캜, preferably at 30 캜 to 35 캜. The incubation period can be continued until the desired amount of useful substance is obtained, preferably, for 10 to 100 hours.

The butanol produced in the culturing step of the present invention may further include purification or recovery, and the method for recovering the target protein from the microorganism or the culture may be performed by a method known in the art, for example, centrifugation, filtration, anion exchange Chromatography, crystallization, HPLC, and the like may be used, but the present invention is not limited to these examples.

The recovering step may include a purification step, and a person skilled in the art can select and utilize it according to the needs of various known purification processes.

In addition, the present invention provides a method for producing a 5 ' UTR sequence comprising introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; And a method for producing a microorganism for producing 2,3-butanediol.

In the present invention, the synthetic 5 'UTR may be composed of the nucleotide sequence shown in SEQ ID NO: 5.

Also, in the present invention, the method comprises: introducing a crt gene, hbd gene and tesB gene for production of butyric acid into a microorganism; But is not limited thereto.

In addition, in the present invention, the method comprises: introducing a budABC operon for producing 2,3-butanediol into a microorganism; But is not limited thereto.

In addition, the present invention provides a recombinant microorganism for producing butyric acid or 2,3-butanediol, which is produced by using the above method.

The present invention also relates to a method for producing a recombinant microorganism, which comprises culturing the recombinant microorganism of the present invention; ≪ RTI ID = 0.0 > 2,3-butanediol < / RTI > On the other hand, redundant contents are omitted in consideration of the complexity of the present specification.

Hereinafter, preferred embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the invention.

Example  One. ptsG  The synthetic 5 ' UTR  Redesign

1-1. Material example

All Escherichia coli strains, plasmid information and gene information used in the present invention are shown in Tables 1, 2 and 3, respectively. The oligonucleotides used in the present invention were synthesized in Macrogen (Daejeon, Korea) and shown in Table 4. Phusion polymerase and restriction enzymes were purchased from New England Biolaps (Ipswich, Mass., USA) and T4 DNA ligase was purchased from TaKaRa (USA). The rPSL-neo template DNA was purchased from Counter-selection BAC Modification Kit (Gene Bridges, Heidelberg, Germany) Bio Inc. (Shiga, Japan). Genomic DNA and plasmids were used for the GeneAll Exgene ^™ Cell SV kit and the Accuprep Nano-Plus Plasmid Mini Extraction kit (Bioneer, Taejon, Korea). GeneAll Expin ^™ Gel SV kit (GeneAll Biotechnology, Seoul, , Korea). All of the materials used for the culture were purchased from BD Biosciences (Sparks, MD, USA) and other chemicals were purchased from Sigma (St. Louis, Mo., USA).

Strain name Property source Mach1-T1R F ^- φ80 (lac Z) ΔM15 Δ lac X74 hsd R (r _K ^- m _K ⁺⁾ Δ rec A1 end A1398 ton A Invitrogen W3110 F ^- ? ^- rph-1 IN ( rrnD , rrnE ) 1 ATCC 27325 JHL163 W3110 rpsL * A128G ( Str ^R ) This experiment JHL110 JHL163 ptsG :: rpsL- neo ( Str ^S , Kan ^R ) This experiment JHL164 JHL163 ptsG UTR5 This experiment JHL165 JHL163 ptsG UTR4 This experiment JHL166 JHL163 ptsG UTR3 This experiment JHL167 JHL163 ptsG UTR2 This experiment JHL168 JHL163 ptsG UTR1 This experiment JHL169 JHL163 ΔptsG This experiment JHL59 W3110 ΔatoDAΔadhE ΔldhAΔpaaFGH
ΔfrdABCD Δpta PatoB :: BBa _J23100
Plpd :: BBa _J23100 lpd ( G1060A )
PaceEF :: BBa _J23100 Lim et al, 2013 JHL170 JHL59 rpsL * A128G ( Str ^R ) This experiment JHL178 JHL170 / pCDF - BuOH , pCOLA- F5 This experiment JHL179 JHL170 ptsG UTR5 / pCDF - BuOH , pCOLA- F5 This experiment JHL180 JHL170 ptsG UTR4 / pCDF - BuOH , pCOLA- F5 This experiment JHL181 JHL170 ptsG UTR3 / pCDF - BuOH , pCOLA- F5 This experiment JHL182 JHL170 ptsG UTR2 / pCDF - BuOH , pCOLA- F5 This experiment JHL183 JHL170 ptsG UTR1 / pCDF - BuOH , pCOLA- F5 This experiment JHL184 JHL170 PptSG / pCDF - BuOH , pCOLA- F5 This experiment JHL265 JHL170 / pBASP This experiment JHL266 JHL170 ptsG UTR5 / pBASP This experiment JHL267 JHL170 / pZSbudABC This experiment JHL268 JHL170 ptsG UTR5 / pZSbudABC This experiment

Plasmid name Features (Genotype) source pKD4 Template plasmid for FRT-flanked kanamycin resistance gene; Amp ^R , Km ^R Datsenko et al, 2013 pKD46 Red recombinase expression vector, Amp ^R Datsenko et al, 2013 pCP20 FLP expression vector; Amp ^R Datsenko et al, 2013 pCR2.1-TOPO Cloning vector, Amp ^R , Km ^R Invitrogen pMD20-T Cloning vector, Amp ^R Takara pGEM T-Easy Cloning vector, Amp ^R Promega pFRT4 From pGEM T-Easy, FRT-Kan ^R -FRT (4) This experiment pCDF-BuOH cloDF13 ori, Sm ^R, PJ23100 crt- PJ23100 :: :: :: hbdPJ23100 ter- PJ23100 :: adhE2 Lim et al, 2013 pCOLA-F5 ColA ori, Km ^R , PJ23100 :: F5UTR- fdhl _SC Lim et al, 2013 pBASP p15A ori, Cm ^R , PJ23100 :: crt- PJ23100 :: hbdPJ23100 :: ter- PJ23100 :: tesB Lim et al, 2013 pZSbudABC pSC101 ori, Km ^R , E. aerogenes bud ABC operon under the control of PLtetO-1 Mazumdar et al, 2013

gene origin SEQ ID NO: ptsG Escherichia coli W3110 7 adhE2 Clostridium acetobutylicum 8 fdh1 Saccharomyces cerevisiae 9 crt Clostridium acetobutylicum (ATCC824) 10 hbd Clostridium acetobutylicum (ATCC824) 11 sweat Treponema denticola 12 tesB Escherichia coli W3110 13 budABC operon Enterobacter aerogenes KCTC2190 14

name The sequence (5'-3 ') SEQ ID NO: FRT4_F ctagtgctggagcgaactgcg aagttcctatactttctagagaataggaacttcggaataggaacttcaagatcccctcacgctgccgc 15 FRT4_R ggagtactcgcggttgactg agttcctattccgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctggggtg 16 ptsG_del4_F cgttgtatcgcatgttatggcagaagcaggcggttccgtctttgcaaaca ctagtgctggagcgaactgc 17 ptsG_del4_R aacgctgacgcgcagacgggtaatacatgcgtcgaggttagtaatgtttt ggagtactcgcggttgactg 18 rpsL-A128G-oligo cgttagtcagacgaacacggcatactttacgcagcgcggagttcggttttctaggagtggtagtatatacacgagtacatacgccacgtttttgcgggcat 19 ptsG_rpsLneo_F acacggcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagcaggcctggtgatgatggcggg 20 ptsG_rpsLneo_R atcagcgatttaccgaccttttgcaggttagcaaatgcattcttaaacattcagaagaactcgtcaagaaggcgatagaag 21 ptsG_UTR1_oligo acacggcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagca ATATTGAG
AAGGACATCTCCTCGATA atgtttaagaatgcatttgctaacctgcaaaaggtcgg
taaatcgctgat 22 ptsG_UTR2_oligo acacggcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagca ATATTGAG
AAGGAGATATCTCAATA atgtttaagaatgcatttgctaacctgcaaaaggtcggta
aatcgctgat 23 ptsG_UTR3_oligo acacggcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagca ATATTGAG
AAGGAGTTATCTCGATA atgtttaagaatgcatttgctaacctgcaaaaggtcggta
aatcgctgat 24 ptsG_UTR4_oligo acacggcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagca ATAACGAG
TAGGAGTTTCTCGATA atgtttaagaatgcatttgctaacctgcaaaaggtcggtaa
atcgctgat 25 ptsG_UTR5_oligo acacggcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagca ACATTCAC
AAGGAGACGTCAACAATC atgtttaagaatgcatttgctaacctgcaaaaggtcg
gtaaatcgctgat 26 C-ptsG_UTR-F catatgttttgtcaaaatgtgcaacttctccaatgat 27 C-ptsG_UTR-R ttttaaccatgatgccataggcaacaactgc 28 C-ptsG_del-F cggtaaatcgctgatgctgccggta 29 C-ptsG_del-R gtggttacggatgtactcatccatctcg 30 - Primers whose names start with "C" are designed to confirm homologous recombination results.
- The underlined parts represent different priming sites designed to increase homologous recombination efficiency.
- The bolded portion is a 5 'UTR base sequence that has been redesigned to maximize each gene.

1-2. Synthesis 5 ' UTR  Redesign

To control the expression of the ptsG gene (GenBank: BAA35908.1) encoding the glucose transporter, the 5 'UTR (Untranslated region) was redesigned on the chromosome. Specifically, the UTR engineering of ptsG was performed by substituting the genetic information (5'-UTR region) of the E. coli chromosome through the red recombination system, and the knock-out mutation of ptsG was performed using pKD46 and pCP20 plasmid combination system. In addition, plasmids (pFRT4) having different priming sites were used to increase homologous recombination efficiency.

In order to overexpress or under-express the ptsG gene, the wild-type 5'UTR of the ptsG gene was redesigned through a scar-less recombination method using the rpsL-neo counter-selection system. A mutation associated with the rpsL gene that confers a streptomycin resistance phenotype was introduced using rpsL-A128G-oligo, and the transformed strain was named JHL163. Then, we construct five kinds of ptsG 5'UTR variants through pTSG_UTR (1 to 5) _oligo recombination with different sequences redesigned through UTR Designer (http://sbi.postech.ac.kr/utr_designer) 1 to 5 < / RTI >

The wild-type UTR (WT) and UTR 1-5 sequences of ptsG for over- or under-expression of the ptsG gene are shown in Table 5.

Gene name The synthetic 5'UTR sequence (5'-3 ') SEQ ID NO: UTR1

One UTR2

2 UTR3

3 UTR4

4 UTR5

5 WT

6 - * indicates the predicted base pairing region required to inhibit translation of ptsG mRNA. In particular, the bolded portion represents the minimal base pair for the effective ptsG translation inhibition activity of SgrS.
- The italicized parts indicate the Shine-Dalgarno (SD) sequence and the initiation codon of ptsG.
- The underlined part indicates the part of nucleotide sequence changed from wild type ptsG UTR.

Example  2. Preparation and Culture Conditions of Recombinant Escherichia coli

2-1. Production of recombinant E. coli strain

The recombinant vector pCDF-BuOH for the production of butanol was prepared by amplifying the adhE2 gene (SEQ ID NO: 8) which is a butanol synthesis pathway and introducing the crt-hbd-ter gene (SEQ ID NOS: 10, 11 and 12). In addition, a recombinant vector pCOLA-F5 was constructed by amplifying the fdh1 gene (SEQ ID NO: 9) whose expression level was regulated with a tailor-made 5'UTR sequence. The vector was introduced into strain JHL170 to prepare strain JHL178, which is a butanol-producing strain. The 5 'UTR sequence was redesigned to allow the regulation of the expression level of the ptsG gene (SEQ ID NO: 7) encoding the glucose transporter in the JHL178 strain, and introduced into E. coli, thereby achieving high yield and high productivity of butanol E. coli strains JHL179 to 183 that can be produced were prepared.

Next, the crt and hbd genes serving as the butyric acid synthesis pathway were introduced, and the tesB gene (SEQ ID NO: 13) was amplified from the W3110 genomic DNA to prepare a recombinant vector pBASP for production of butyl acid. The resulting recombinant vector was introduced into the JHL170 strain JHL265 strain. In addition, UTR5, designed to overexpress the ptsG gene, was ligated and further introduced to produce a strain of JHL266, a butyric acid producing strain.

Finally, a recombinant vector pZSbudABC for producing 2,3-butanediol was prepared by amplifying the budABC operon (SEQ ID NO: 14) and introduced into the JHL170 strain to prepare a JHL267 strain. In addition, UTR5 designed to overexpress the ptsG gene was ligated and introduced to produce a strain, JHL268, which is a 2,3-butanediol producing strain.

2-2. Culture of wild type strain

Cultures of the wild-type strain W3110 and the experimental strains (JHL163, JHL110, JHL164 to JHL169) for glucose consumption rate were prepared using medium M9 medium (6.78 g Na ₂ HPO ₄ , 3 g KH ₂ PO ₄ , 1 g NH ₄ Cl, was performed by the addition of 40g / L glucose 0.5 g of NaCl, in 2 mL 1 M MgSO _4, and 0.1 mL of 1 M CaCl _2). Streptomycin (25 μg / mL) was used to identify and maintain the rpsL * A128G genotype. Approximately 1% of the W3110 medium grown overnight in LB was inoculated into medium M9 and cultured until an OD ₆₀₀ of ~0.8. Then, the culture was inoculated into 25 ml M9 medium containing 300 ml flask so as to have a final OD ₆₀₀ of ~0.05, and cultured at 37 ° C and 250 rpm.

2-3. Culture of n-butanol producing strain

n- butanol production strain (JHL59, JHL170, JHL178 to 184) of the culture was Teffific Broth (TB; yeast extract solution of tryptone, 24 g of 12 g per liter, 2.31 g of KH ₂ PO _4, of 12.54 g K ₂ HPO ₄ and 4 mL of glycerol) was carried out by adding 25 g / L glucose. 25 μg / mL spectinomycin and 15 μg / mL kanamycin antibiotics were used to maintain multiple plasmids (pCDF-BuOH and pCOLA-F5). In order to maintain the anaerobic condition, a 60 ml serum bottle was sealed with a rubber stopper inside the anaerobic chamber (Coy Laboratories, Ann Arbor, MI, USA). The overnight culture was inoculated in 20 ml of TB to a final OD ₆₀₀ of ~0.05 and cultured under anaerobic conditions at 37 ° C and 250 rpm.

2-4. Culture of Butyl Acid Production Strain

Culture of the butyric acid producing strains (JHL265 and JHL266) was carried out using Terrific Broth (TB: 12 g of tryptone per liter, 24 g of yeast extract, 2.31 g of KH ₂ PO ₄ , 12.54 g of K ₂ HPO ₄ , Was added 10 g / L glucose and 34 [mu] g / mL chloramphenicol was added to maintain the plasmid pBASP. In order to maintain the anaerobic condition, a 60 ml serum bottle was sealed with a rubber stopper inside the anaerobic chamber (Coy Laboratories, Ann Arbor, MI, USA). The overnight culture was inoculated in 20 ml of TB to a final OD ₆₀₀ of ~0.05 and cultured under anaerobic conditions at 37 ° C and 250 rpm.

2-5. 2,3- Butanediol  Cultivation of production strain

The culture of the 2,3-butanediol producing strains (JHL267 and JHL268) was carried out in M9 medium (6.78 g Na ₂ HPO ₄ , 3 g KH ₂ PO ₄ , 1 g NH ₄ Cl, 0.5 g NaCl, 2 mL Of 1 M MgSO ₄ and 0.1 mL of 1 M CaCl ₂ ), 40 g / L glucose and 5 g / L yeast extract were added and 30 μg / mL kanamycin antibiotics were added to maintain the plasmid pZSbudABC. The culture medium that had been grown overnight in the medium was inoculated in 100 ml of M9 medium to a final OD ₆₀₀ of ~0.05, followed by partial anaerobic culture at 37 ° C and 180 rpm. Anhydrotetracycline, an inducing agent, was added to a final concentration of 100 ng / ml when the OD ₆₀₀ reached ~ 0.5.

Example  3. The presence in the medium Metabolite  Analysis method

The concentration of glucose, organic acid, and alcohol in the medium was determined by high performance liquid chromatography (UltiMate 3000 Analytical HPLC System; Dionex, Sunnyvale, Calif., USA) using an Aminex HPX-87H column (Bio-Rad Laboratories, . At this time, the mobile phase was 5 mM H ₂ SO ₄ . For 2,3-butanediol producing strains, the mobile phase was flowed at 0.5 mL / min at a column temperature of 65 ° C, and the remainder was analyzed at 14 ° C and 0.6 mL / min. The signals were measured using a UV-VIS diode array detector (210 nm) and a Shodex RI-101 detector (Shodex, Klokkerfaldet, Denmark).

Example  4. ptsG  The 5 ' UTR  Analysis of glucose consumption rate by redesign

For the production of butanol, butyric acid and 2,3-butanediol in E. coli by controlling the expression level of the ptsG gene of the present invention, the 5'UTR sequence was regulated The ptsG gene was introduced into Escherichia coli strain and transformed. The transformed strains were named JHL164 to JHL168. The introduced wild-type strain 5'UTR _(WT UTR) as a positive control (JHL110), ΔptsG sets the introduced strain (JHL169) as a negative control, each of the glucose consumption rate of the control group and ptsG UTR variant are introduced strain Respectively. The results are shown in Fig.

As shown in FIG. 2 (b), strains into which ΔptsG , UTR _WT, and UTR 1 to 5 were introduced exhibited different glucose uptake rates, respectively, and these results are highly related to the specific growth rate (R ² = 0.89). Furthermore, as, glucose consumption rate is closely and ethyl (R ² = 0.88) and pyruvic acid (R ² = 0.77) accumulation occurring as a by-product of the wild type strain (UTR _WT) metabolic processes shown in a, c and d 2 Respectively. From the above results, it is confirmed that UTR engineering targeting ptsG is suitable for controlling the process speed.

Specifically, as shown in b to d of FIG. 2, as the UTR of the ptsG gene region was redesigned, the glucose consumption rate was increased by 20.8% as compared with the parent strain, and the increase of the glucose consumption rate was accompanied by the increase of the growth rate (+ 7.3%), acetic acid (+ 13.9%) and pyruvic acid (+ 11.0%). From the above results, it was confirmed that the glucose transporter coded by ptsG acts as a primary rate determining step in the process and can amplify the process.

Example  5. Metabolic path redesign for butanol production

If the process is dominant over the production route, as shown in FIG. 3 (a), by reducing the process, excess carbon source can be prevented from flowing and byproducts can be prevented. An example of this is the butanol production system. Previous studies have attempted to optimize the butanol production pathway, but still considerable amounts of pyruvic acid have emerged as by-products (Lim et al., 2013a; Nielsen et al., 2009; Shen et al., 2011). Thus, in the present invention, the previously tested ΔptsG , UTR _WT, and five ptsG UTR mutants were introduced into E. coli strains using JHL59, a butanol production strain, as a parent strain, and transformed into JHL184, JHL178 and JHL179 to JHL183 . The amount of biomass, butanol, pyruvic acid, and glucose consumed by each strain after 24 hours of culture was analyzed. The results are shown in FIG.

As shown in Figure 3 b, it was confirmed that the major by-product of pyruvate is reduced approximately 99% as the glucose consumption rate is reduced (in the UTR5 introduced JHL179 43.92 mM, reduced to 0.50 mM in the ΔptsG introduced JHL184). As shown in FIG. 3 (c), it was confirmed that the decrease in the production of pyruvic acid was closely related to the glucose consumption rate (R ² = 0.98). In Fig., In the case of n- butanol yields the _WT UTR is introduced JHL178 is displayed nateu or ΔptsG with 69.88 mM introduced in JHL184 as shown in 3 b was confirmed that reduction in 54.54 mM.

Meanwhile, as shown in Fig. 3 (d), when the degree of butanol production of the strains into which each UTR variant was introduced was compared and analyzed in terms of yield and productivity, which are main parameters of the cell plant, the butanol yield was increased However, productivity was not significantly affected.

Specifically, as shown in FIGS. 3C and 3D, the JHL181 strain into which UTR3 was introduced exhibited a yield of about 0.84 mol / mol glucose relative to the wild-type strain, and there was a large difference in productivity between the two strains (2.91 mM butanol L- ¹ h ^-1 in JHL181 with UTR3, 2.91 mM butanol L- ¹ h ^-1 in JHL178 with UTR _WT introduced). However, it was confirmed that the butanol productivity decreased with decreasing the glucose consumption rate at the glucose consumption rate lower than UTR3. From the above results, it was confirmed that the process itself serves as a rate determining step for butanol production under UTR3. On the other hand, the strain JHL179 into which UTR5 was introduced showed a remarkable decrease in yield and productivity, as shown in Fig. 3 (c), which was judged to be caused by pH decrease due to accumulation of pyruvic acid. Overall, the JHL181 strain introduced with UTR3 had optimized butanol yield and yield, indicating excellent butanol productivity compared to the wild type strain.

From the above results, it was confirmed that maximum productivity in butanol production can be maintained and the yield can be maximized using the optimization of the process through the regulation of ptsG expression level.

Example  6. Butyl acid and 2,3- Butanediol  Metabolic path redesign for production

Unlike Example 5, it is very difficult to increase the productivity beyond that when the production path is dominant because the yield is maximized by eliminating the competitive metabolic pathway or the like. As shown in Fig. 4 (a), butyric acid is a fermentation product produced under anaerobic conditions. In theory, the JHL265 strain was expected to exhibit a maximum yield of 83.4%. However, as shown in Fig. 4 (b), the conversion of pyruvic acid to 2,3-butanediol in the presence of oxygen is maximized, and some of the carbon source must be consumed to generate energy by conversion to carbon dioxide. In this case, it was deduced that it would be necessary to amplify the process. To confirm this, butyl acid and 2,3-butanediol were used as a model system. The expected yield and yield of butyric acid in the JHL265 strain redesigned for metabolic pathway production and the JHL266 strain introduced with UTR5 are shown in FIG. 4c. Also, the predicted yield and yield of 2,3-butanediol in the JHL267 strain, which has been redesigned for the production of 2,3-butanediol, and the JHL268 strain, which is further supplemented with UTR5, are shown in FIG.

As shown in FIG. 4 (c), the JHL266 strain showed a 7% increase in butyl acid productivity (1.45 mmol of butyl acid L ^- 1h ^{- 1} ) compared to JHL265 due to an increase in carbon source introduction into the process. Also, as shown in Fig. 4 (d), the strain JHL268 showed 2.3-butanediol productivity (2.38 mmol 2,3-butanediol L ^- h ^{- 1} ) increased by 12.45% compared to JHL267. The yields of butyric acid and 2,3-butanediol in JHL266 and JHL268 strains were similar to those of parent strains, respectively. From the above results, it is essential to amplify the corresponding process to maximize the productivity of butyric acid and 2,3-butanediol. The strains JHL266 and JHL268 to which UTR5 is introduced are strains optimized for the production of butyric acid and 2,3-butanediol Respectively.

Although the present invention has been described in terms of the preferred embodiments mentioned above, it is possible to make various modifications and variations without departing from the spirit and scope of the invention. It is also to be understood that the appended claims are intended to cover such modifications and changes as fall within the scope of the invention.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> RECOMBINANT MICROORGANISM WITH REGULATED GLYCOLYTIC FLUX AND          METHOD OF PRODUCING COMPOUND USING THE SAME <130> POSTECH1-34P-1 <150> KR 10-2016-0128973 <151> 2016-10-06 <160> 30 <170> KoPatentin 3.0 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> UTR1 (redesigned 5'UTR for ptsG) <400> 1 atattgagaa ggacatctcc tcgataatg 29 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > UTR2 (redesigned 5'UTR for ptsG) <400> 2 atattgagaa ggagatatct caataatg 28 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> UTR3 (redesigned 5'UTR for ptsG) <400> 3 atattgagaa ggagttatct cgataatg 28 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> UTR4 (redesigned 5'UTR for ptsG) <400> 4 ataacgagta ggagtttctc gataatg 27 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> UTR5 (redesigned 5'UTR for ptsG) <400> 5 acattcacaa ggagacgtca acaatcatg 29 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> wild-type sequence of the ptsG UTR <400> 6 cccatactca ggagcactct caattatg 28 <210> 7 <211> 1434 <212> DNA <213> Artificial Sequence <220> <223> ptsG gene from Escherichia coli W3110 <400> 7 atgtttaaga atgcatttgc taacctgcaa aaggtcggta aatcgctgat gctgccggta 60 tccgtactgc ctatcgcagg tattctgctg ggcgtcggtt ccgcgaattt cagctggctg 120 cccgccgttg tatcgcatgt tatggcagaa gcaggcggtt ccgtctttgc aaacatgcca 180 ctgatttttg cgatcggtgt cgccctcggc tttaccaata acgatggcgt atccgcgctg 240 gccgcagttg ttgcctatgg catcatggtt aaaaccatgg ccgtggttgc gccactggta 300 ctgcatttac ctgctgaaga aatcgcctct aaacacctgg cggatactgg cgtactcgga 360 gggattatct ccggtgcgat cgcagcgtac atgtttaacc gtttctaccg tattaagctg 420 cctgagtatc ttggcttctt tgccggtaaa cgctttgtgc cgatcatttc tggcctggct 480 gccatcttta ctggcgttgt gctgtccttc atttggccgc cgattggttc tgcaatccag 540 accttctctc agtgggctgc ttaccagaac ccggtagttg cgtttggcat ttacggtttc 600 atcgaacgtt gcctggtacc gtttggtctg caccacatct ggaacgtacc tttccagatg 660 cagattggtg aatacaccaa cgcagcaggt caggttttcc acggcgacat tccgcgttat 720 atggcgggtg acccgactgc gggtaaactg tctggtggct tcctgttcaa aatgtacggt 780 ctgccagctg ccgcaattgc tatctggcac tctgctaaac cagaaaaccg cgcgaaagtg 840 ggcggtatta tgatctccgc ggcgctgacc tcgttcctga ccggtatcac cgagccgatc 900 gagttctcct tcatgttcgt tgcgccgatc ctgtacatca tccacgcgat tctggcaggc 960 ctggcattcc caatctgtat tcttctgggg atgcgtgacg gtacgtcgtt ctcgcacggt 1020 ctgatcgact tcatcgttct gtctggtaac agcagcaaac tgtggctgtt cccgatcgtc 1080 ggtatcggtt atgcgattgt ttactacacc atcttccgcg tgctgattaa agcactggat 1140 ctgaaaacgc cgggtcgtga agacgcgact gaagatgcaa aagcgacagg taccagcgaa 1200 atggcaccgg ctctggttgc tgcatttggt ggtaaagaaa acattactaa cctcgacgca 1260 tgtattaccc gtctgcgcgt cagcgttgct gatgtgtcta aagtggatca ggccggcctg 1320 aagaaactgg gcgcagcggg cgtagtggtt gctggttctg gtgttcaggc gattttcggt 1380 actaaatccg ataacctgaa aaccgagatg gatgagtaca tccgtaacca ctaa 1434 <210> 8 <211> 2577 <212> DNA <213> Artificial Sequence <220> <223> adhE2 gene from Clostridium acetobutylicum <400> 8 atgaaagtta caaatcaaaa agaactaaaa caaaagctaa atgaattgag agaagcgcaa 60 aagaagtttg caacctatac tcaagagcaa gttgataaaa tttttaaaca atgtgccata 120 gccgcagcta aagaaagaat aaacttagct aaattagcag tagaagaaac aggaataggt 180 cttgtagaag ataaaattat aaaaaatcat tttgcagcag aatatatata caataaatat 240 aaaaatgaaa aaacttgtgg cataatagac catgacgatt ctttaggcat aacaaaggtt 300 gctgaaccaa ttggaattgt tgcagccata gttcctacta ctaatccaac ttccacagca 360 attttcaaat cattaatttc tttaaaaaca agaaacgcaa tattcttttc accacatcca 420 cgtgcaaaaa aatctacaat tgctgcagca aaattaattt tagatgcagc tgttaaagca 480 ggagcaccta aaaatataat aggctggata gatgagccat caatagaact ttctcaagat 540 ttgatgagtg aagctgatat aatattagca acaggaggtc cttcaatggt taaagcggcc 600 tattcatctg gaaaacctgc aattggtgtt ggagcaggaa atacaccagc aataatagat 660 gagagtgcag atatagatat ggcagtaagc tccataattt tatcaaagac ttatgacaat 720 ggagtaatat gcgcttctga acaatcaata ttagttatga attcaatata cgaaaaagtt 780 aaagaggaat ttgtaaaacg aggatcatat atactcaatc aaaatgaaat agctaaaata 840 aaagaaacta tgtttaaaaa tggagctatt aatgctgaca tagttggaaa atctgcttat 900 ataattgcta aaatggcagg aattgaagtt cctcaaacta caaagatact tataggcgaa 960 gtacaatctg ttgaaaaaag cgagctgttc tcacatgaaa aactatcacc agtacttgca 1020 atgtataaag ttaaggattt tgatgaagct ctaaaaaagg cacaaaggct aatagaatta 1080 ggtggaagtg gacacacgtc atctttatat atagattcac aaaacaataa ggataaagtt 1140 aaagaatttg gattagcaat gaaaacttca aggacattta ttaacatgcc ttcttcacag 1200 ggagcaagcg gagatttata caattttgcg atagcaccat catttactct tggatgcggc 1260 acttggggag gaaactctgt atcgcaaaat gtagagccta aacatttatt aaatattaaa 1320 agtgttgctg aaagaaggga aaatatgctt tggtttaaag tgccacaaaa aatatatttt 1380 aaatatggat gtcttagatt tgcattaaaa gaattaaaag atatgaataa gaaaagagcc 1440 tttatagtaa cagataaaga tttttttaaa cttggatatg ttaataaaat aacaaaggta 1500 ctagatgaga tagatattaa atacagtata tttacagata ttaaatctga tccaactatt 1560 gattcagtaa aaaaaggtgc taaagaaatg cttaactttg aacctgatac tataatctct 1620 attggtggtg gatcgccaat ggatgcagca aaggttatgc acttgttata tgaatatcca 1680 gaagcagaaa ttgaaaatct agctataaac tttatggata taagaaagag aatatgcaat 1740 ttccctaaat taggtacaaa ggcgatttca gtagctattc ctacaactgc tggcaccggt 1800 tcagaggcaa caccttttgc agttataact aatgatgaaa caggaatgaa atacccttta 1860 acttcttatg aattaccccc aaacatggca ataatagata ctgaattaat gttaaatatg 1920 cctagaaaat taacagcagc aactggaata gatgcattag ttcatgctat agaagcatat 1980 gtttcggtta tggctacgga ttatactgat gaattagcct taagagcaat aaaaatgata 2040 tttaaatatt tgcctagagc ctataaaaat gggactaacg acattgaagc aagagaaaaa 2100 atggcacatg cctctaatat tgcggggatg gcatttgcaa atgctttctt aggtgtatgc 2160 cattcaatgg ctcataaact tggggcaatg catcacgttc cacatggaat tgcttgtgct 2220 gtattaatag aagaagttat taaatataac gctacagact gtccaacaaa gcaaacagca 2280 ttccctcaat ataaatctcc taatgctaag agaaaatatg ctgaaattgc agagtatttg 2340 aatttaaagg gtactagcga taccgaaaag gtaacagcct taatagaagc tatttcaaag 2400 ttaaagatag atttgagtat tccacaaaat ataagtgccg ctggaataaa taaaaaagat 2460 ttttataata cgctagataa aatgtcagag cttgcttttg atgaccaatg tacaacagct 2520 aatcctaggt atccacttat aagtgaactt aaggatatct atataaaatc attttaa 2577 <210> 9 <211> 1131 <212> DNA <213> Artificial Sequence <220> <223> fdh1 gene from Saccharomyces cerevisiae <400> 9 atgtcgaagg gaaaggtttt gctggttctt tacgaaggtg gtaagcatgc tgaagagcag 60 gaaaagttat tggggtgtat tgaaaatgaa cttggtatca gaaatttcat tgaagaacag 120 ggatacgagt tggttactac cattgacaag gaccctgagc caacctcaac ggtagacagg 180 gagttgaaag acgctgaaat tgtcattact acgccctttt tccccgccta catctcgaga 240 aacaggattg cagaagctcc taacctgaag ctctgtgtaa ccgctggcgt cggttcagac 300 catgtcgatt tagaagctgc aaatgaacgg aaaatcacgg tcaccgaagt tactggttct 360 aacgtcgttt ctgtcgcaga gcacgttatg gccacaattt tggttttgat aagaaactat 420 aatggtggtc accaacaagc aattaatggt gagtgggata ttgccggcgt ggctaaaaat 480 gagtatgatc tggaagacaa aataatttca acggtaggtg ccggtagaat tggatatagg 540 gttctggaaa gattggtcgc atttaatccg aagaagttac tgtactacga ctaccaggaa 600 ctacctgcgg aagcaatcaa tagattgaac gaggccagca agcttttcaa tggcagaggt 660 gatattgttc agagagtaga aaaattggag gatatggttg ctcagtcaga tgttgttacc 720 atcaactgtc cattgcacaa ggactcaagg gggttattca ataaaaagct tatttcccac 780 atgaaagatg gtgcatactt ggtgaatacc gctagaggtg ctatttgtgt cgcagaagat 840 gttgccgagg cagtcaagtc tggtaaattg gctggctatg gtggtgatgt ctgggataag 900 caaccagcac caaaagacca tccctggagg actatggaca ataaggacca cgtgggaaac 960 gcaatgactg ttcatatcag tggcacatct ctggatgctc aaaagaggta cgctcaggga 1020 gtaaagaaca tcctaaatag ttacttttcc aaaaagtttg attaccgtcc acaggatatt 1080 attgtgcaga atggttctta tgccaccaga gcttatggac agaagaaata a 1131 <210> 10 <211> 789 <212> DNA <213> Artificial Sequence <220> <223> crt gene from Clostridium acetobutylicum ATCC824 <400> 10 atggaactaa acaatgtcat ccttgaaaag gaaggtaaag ttgctgtagt taccattaac 60 agacctaaag cattaaatgc gttaaatagt gatacactaa aagaaatgga ttatgttata 120 ggtgaaattg aaaatgatag cgaagtactt gcagtaattt taactggagc aggagaaaaa 180 tcatttgtag caggagcaga tatttctgag atgaaggaaa tgaataccat tgaaggtaga 240 aaattcggga tacttggaaa taaagtgttt agaagattag aacttcttga aaagcctgta 300 atagcagctg ttaatggttt tgctttagga ggcggatgcg aaatagctat gtcttgtgat 360 ataagaatag cttcaagcaa cgcaagattt ggtcaaccag aagtaggtct cggaataaca 420 cctggttttg gtggtacaca aagactttca agattagttg gaatgggcat ggcaaagcag 480 cttatattta ctgcacaaaa tataaaggca gatgaagcat taagaatcgg acttgtaaat 540 aaggtagtag aacctagtga attaatgaat acagcaaaag aaattgcaaa caaaattgtg 600 agcaatgctc cagtagctgt taagttaagc aaacaggcta ttaatagagg aatgcagtgt 660 gatattgata ctgctttagc atttgaatca gaagcatttg gagaatgctt ttcaacagag 720 gatcaaaagg atgcaatgac agctttcata gagaaaagaa aaattgaagg cttcaaaaat 780 agatagtga 789 <210> 11 <211> 849 <212> DNA <213> Artificial Sequence <220> <223> hbd gene from Clostridium acetobutylicum (ATCC824) <400> 11 atgaaaaagg tatgtgttat aggtgcaggt actatgggtt caggaattgc tcaggcattt 60 gcagctaaag gatttgaagt agtattaaga gatattaaag atgaatttgt tgatagagga 120 ttagatttta tcaataaaaa tctttctaaa ttagttaaaa aaggaaagat agaagaagct 180 actaaagttg aaatcttaac tagaatttcc ggaacagttg accttaatat ggcagctgat 240 tgcgatttag ttatagaagc agctgttgaa agaatggata ttaaaaagca gatttttgct 300 gacttagaca atatatgcaa gccagaaaca attcttgcat caaatacatc atcactttca 360 ataacagaag tggcatcagc aactaaaaga cctgataagg ttataggtat gcatttcttt 420 aatccagctc ctgttatgaa gcttgtagag gtaataagag gaatagctac atcacaagaa 480 acttttgatg cagttaaaga gacatctata gcaataggaa aagatcctgt agaagtagca 540 gaagcaccag gatttgttgt aaatagaata ttaataccaa tgattaatga agcagttggt 600 atattagcag aaggaatagc ttcagtagaa gacatagata aagctatgaa acttggagct 660 aatcacccaa tgggaccatt agaattaggt gattttatag gtcttgatat atgtcttgct 720 ataatggatg ttttatactc agaaactgga gattctaagt atagaccaca tacattactt 780 aagaagtatg taagagcagg atggcttgga agaaaatcag gaaaaggttt ctacgattat 840 tcaaaataa 849 <210> 12 <211> 1194 <212> DNA <213> Artificial Sequence <220> <223> codon-optimized ter gene from Treponema denticola <400> 12 atgatcgtca agccaatggt gcgcaataat atctgtctga acgctcaccc gcagggttgt 60 aaaaagggtg tagaagacca gattgaatac actaagaaac gcatcaccgc agaagttaaa 120 gcaggtgcca aagcaccgaa aaacgtcctg gtgctgggct gcagcaacgg ctacggtctg 180 gcaagccgca ttacggctgc attcggttac ggcgctgcta ctattggtgt tagcttcgaa 240 aaggcgggtt ctgaaaccaa atacggcact ccaggctggt acaacaacct ggcattcgac 300 gaagcagcga agcgtgaggg tctgtactct gttaccatcg acggtgacgc gttctctgac 360 gagatcaaag ctcaggttat cgaggaagct aaaaagaaag gtatcaaatt cgacctgatt 420 gtgtactccc tggcctctcc ggttcgtacc gacccggata ccggcatcat gcacaaaagc 480 gtactgaagc cgtttggcaa aaccttcact ggtaaaaccg ttgatccttt caccggcgag 540 ctgaaggaaa tctccgccga gccagctaac gatgaggagg ctgctgcgac cgttaaagtg 600 atgggtggcg aagactggga acgttggatc aaacaactgt ccaaggaagg tctgctggag 660 ggggctgta ttactctggc atattcttac atcggcccgg aggcgactca ggcactgtat 720 cgtaagggca ccatcggtaa agcgaaagaa catctggagg ccaccgctca ccgtctgaac 780 aaggaaaacc cgagcatccg tgctttcgtg tccgttaaca agggcctggt tacgcgcgct 840 tccgcagtaa ttccggtcat tccgctgtac ctggcttccc tgtttaaagt catgaaagaa 900 aaaggcaacc acgaaggttg tatcgaacaa attactcgcc tgtatgcgga gcgcctgtac 960 cgtaaggatg gcactatccc ggttgatgaa gagaaccgca tccgcattga cgattgggaa 1020 ctggaagagg atgtacagaa agcggtttcc gcgctgatgg aaaaagtgac gggcgaaaac 1080 gcggaatccc tgacggatct ggcaggttac cgtcacgact ttctggcgtc taatggtttc 1140 gacgttgagg gtattaacta cgaggcagaa gttgaacgtt tcgatcgtat ttaa 1194 <210> 13 <211> 861 <212> DNA <213> Artificial Sequence <220> <223> tesB gene from Escherichia coli W3110 <400> 13 atgagtcagg cgctaaaaaa tttactgaca ttgttaaatc tggaaaaaat tgaggaagga 60 ctctttcgcg gccagagtga agatttaggt ttacgccagg tgtttggcgg ccaggtcgtg 120 ggtcaggcct tgtatgctgc aaaagagacc gtccctgaag agcggctggt acattcgttt 180 cacagctact ttcttcgccc tggcgatagt aagaagccga ttatttatga tgtcgaaacg 240 ctgcgtgacg gtaacagctt cagcgcccgc cgggttgctg ctattcaaaa cggcaaaccg 300 attttttata tgactgcctc tttccaggca ccagaagcgg gtttcgaaca tcaaaaaaca 360 atgccgtccg cgccagcgcc tgatggcctc ccttcggaaa cgcaaatcgc ccaatcgctg 420 gcgcacctgc tgccgccagt gctgaaagat aaattcatct gcgatcgtcc gctggaagtc 480 cgtccggtgg agtttcataa cccactgaaa ggtcacgtcg cagaaccaca tcgtcaggtg 540 tggatccgcg caaatggtag cgtgccggat gacctgcgcg ttcatcagta tctgctcggt 600 tacgcttctg atcttaactt cctgccggta gctctacagc cgcacggcat cggttttctc 660 gaaccgggga ttcagattgc caccattgac cattccatgt ggttccatcg cccgtttaat 720 ttgaatgaat ggctgctgta tagcgtggag agcacctcgg cgtccagcgc acgtggcttt 780 gtgcgcggtg agttttatac ccaagacggc gtactggttg cctcgaccgt tcaggaaggg 840 gtgatgcgta atcacaatta a 861 <210> 14 <211> 3262 <212> DNA <213> Artificial Sequence <220> <223> budABC operon from Enterobacter aerogenes KCTC2190 <400> 14 atgaatcatg cttcagattg cacctgtgaa gagagtctgt gtgaaacgct acgcgcgttt 60 tccgctcagc atcccgatag cgtgctgtat caaacttcgc tgatgagcgc cctgctcagc 120 ggcgtctacg aaggtaccac caccattgcg gacctgctga agcacggtga tttcgggctc 180 ggcactttta atgaactcga cggcgagctg atcgcgttta gcagccaggt ttatcaactg 240 cgtgccgacg gcagcgcgcg taaagcgcgt ccggaacaga aaacgccgtt tgcggtgatg 300 acctggtttc agccgcagta ccgtaaaacc tttgaccatc cggtcagccg ccagcagctg 360 gcgaatcgat 420 ggtcatttcc gccacgccca tacccgcacc gtgcctcgtc agacgccgcc ctaccgggcg 480 atgaccgacg tgctcgacga tcagccggtt ttccgcttta accagcgtga cggcgtactg 540 gtcggttttc gtaccccgca gcatatgcag ggaattaacg tcgccggcta tcacgaacac 600 ttcattaccg atgaccgcca gggcggcggc cacctgctgg actaccagct cgaccatggg 660 gtattgacct tcggcgaaat tcataagctg atgatcgacc ttcccgccga cagcgcgttc 720 ctgcaggcca atttgcatcc cgataatctc gatgccgcca tccgttcagt agaaagttag 780 gaggttcaca tggacaaaca gtatccgcag cgccagtggg cgcacggcgc cgatctggtc 840 gtcagccaac tggaagcgca aggcgtacgg caggtcttcg ggatccccgg cgctaaaatc 900 gataaggttt tcgactcgtt gctggactcc tcaatccgca ttattccggt acgtcacgag 960 gccaacgccg cctttatggc cgccgcggtc gggcgcatta ccggcaaagc gggcgtcgcg 1020 ctggtgacct ccggacccgg ttgttccaac ctgataaccg ggatggccac cgccaatagc 1080 gaaggcgacc cggtggtggc gctgggcggc gcggtcaaac gcgcggataa agccaaacag 1140 gtacaccaga gtatggacac ggtggcgatg ttcagcccgg tcaccaaata cgcggtagaa 1200 gtgacctcgc cggatgcgct ggcggaagtg gtttctaacg cttttcgcgc cgccgagcag 1260 ggtcgcccgg gcagcgcctt cgtcagtctg ccgcaggatg tggtcgatgg tccggtgacc 1320 ggcaaagtcc tgcccgccag cagcgcgccg cagatgggcg ccgcgcctga cgaggcaatc 1380 aatcaggttg cgaagttgat tgcccaggcg aagaatccgg tgttcctgct tggattaatg 1440 gccagccaga cggaaaacag cgccgcgctg catcgtttgc tggaaaccag ccatattccg 1500 gtcaccagca cctatcaggc cgccggggcg gtcaatcagg ataacttctc gcgcttcgcc 1560 gggcgcgtcg ggctgtttaa caatcaggcc ggtgaccgct tattgcaact ggccgacctg 1620 gttatctgca tcggctatag cccggtggaa tacgaaccgg cgatgtggaa cagcggcaac 1680 gcgacgctgg tacatatcga cgtactgccc gcctatgaag agcgtaacta cacgccggat 1740 gtcgagctgg tgggcgacat cgccggcacg ctgaacaagc tggcgcaaaa tatcgatcat 1800 cggctggtgc tctcgccgca ggctgctgaa atcctccacg accgccagca tcagcgggaa 1860 ctgcttgacc gccgcggagc gcagttgaat cagtttgccc tgcacccgct gcgtatcgtt 1920 cgcgccatgc aggatatcgt caacagcgac gtcacgctga cggtcgatat ggggagcttc 1980 catatctgga tcgcccgcta tctctacagc ttccgcgccc gtcaggtgat gatctccaac 2040 ggtcagcaga ccatgggcgt cgccctgccg tgggccatcg gggcctggct ggtcaatccg 2100 cgcgcaaag tggtctcggt ctccggcgat ggcggttttc tgcaatccag catggagctg 2160 gaaacggcgg tccgcctgaa agccaacatc ctgcatctta tctgggtcga taacggctac 2220 aacatggtcg ccatccagga agagaaaaaa tatcaacgcc tgtccggcgt cgagttcggt 2280 cctatggatt ttaaagccta tgccgaatcc ttcggcgcga aagggtttgc ggtggaaagc 2340 gctgaggcgc tggagccgac gctacgcgcg gcgatggacg tcgacggccc ggcggtggtc 2400 gccatccccg tggattaccg tgataacccg ctgctgatgg gccagctaca cctgagtcaa 2460 attctttaag tcatcacaaa aggaaatgga aatgaaaaaa gtcgcacttg tcaccggcgc 2520 cggtcagggc attggtaaag ctatcgcgtt acgcctcgtg aaggacggtt ttgccgtggc 2580 gatcgccgat tacaatgacg tcacagcgaa agccgtggcg gatgaaatca accagcacgg 2640 cggccgggca atcgcggtca aagtcgatgt ttccgaccgt gagcaggtgt ttgccgccgt 2700 cgaacaggcg cgaaaaacgc tgggcggatt caacgtcatc gtcaataacg ccggggtcgc 2760 gccatcaacg cctatcgaat ccattacgcc ggagattgtc gacaaggtct acaacatcaa 2820 cgttaaaggg gtgatctggg ggattcaggc ggcagtcgag gcctttaaaa aagaggggca 2880 cggcggcaaa atcatcaacg cctgttcgca ggccggacac gtcggcaacc cggaactggc 2940 ggtctacagc tcgagcaaat tcgccgtacg cggtttaacg caaaccgccg ctcgcgacct 3000 ggcgccgctg ggtattaccg ttaacggcta ctgcccgggg attgtgaaaa cgccgatgtg 3060 ggccgagatc gatcgtcagg tatccgaagc ggcgggtaaa cctctgggct acgggacagc 3120 cgaattcgcc aaacgcatca ccctcggccg cctgtctgag ccagaagatg tcgccgcctg 3180 cgtctcttat ctcgccagcc cggattccga ttatatgacc ggtcaatcgc tgctgatcga 3240 tggcgggatg gtattcaatt aa 3262 <210> 15 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> forward primer of FRT4 <400> 15 ctagtgctgg agcgaactgc gaagttccta tactttctag agaataggaa cttcggaata 60 ggaacttcaa gatcccctca cgctgccgc 89 <210> 16 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of FRT4 <400> 16 ggagtactcg cggttgactg agttcctatt ccgaagttcc tattctctag aaagtatagg 60 aacttcagag cgcttttgaa gctggggtg 89 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> forward primer of ptsG_del4 <400> 17 cgttgtatcg catgttatgg cagaagcagg cggttccgtc tttgcaaaca ctagtgctgg 60 agcgaactgc 70 <210> 18 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of ptsG_del4 <400> 18 aacgctgacg cgcagacggg taatacatgc gtcgaggtta gtaatgtttt ggagtactcg 60 cggttgactg 70 <210> 19 <211> 101 <212> DNA <213> Artificial Sequence <220> RpsL-A128G-oligo <400> 19 cgttagtcag acgaacacgg catactttac gcagcgcgga gttcggtttt ctaggagtgg 60 tagtatatac acgagtacat acgccacgtt tttgcgggca t 101 <210> 20 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> forward primer of ptsG_rpsLneo <400> 20 acacggcgag gctctccccc cttgccacgc gtgagaacgt aaaaaaagca ggcctggtga 60 tgatggcggg 70 <210> 21 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of ptsG_rpsLneo <400> 21 atcagcgatt taccgacctt ttgcaggtta gcaaatgcat tcttaaacat tcagaagaac 60 tcgtcaagaa ggcgatagaa g 81 <210> 22 <211> 126 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UTR1_oligo <400> 22 acacggcgag gctctccccc cttgccacgc gtgagaacgt aaaaaaagca atattgagaa 60 ggacatctcc tcgataatgt ttaagaatgc atttgctaac ctgcaaaagg tcggtaaatc 120 gctgat 126 <210> 23 <211> 125 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UTR2_oligo <400> 23 acacggcgag gctctccccc cttgccacgc gtgagaacgt aaaaaaagca atattgagaa 60 ggagatatct caataatgtt taagaatgca tttgctaacc tgcaaaaggt cggtaaatcg 120 ctgat 125 <210> 24 <211> 125 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UTR3_oligo <400> 24 acacggcgag gctctccccc cttgccacgc gtgagaacgt aaaaaaagca atattgagaa 60 ggagttatct cgataatgtt taagaatgca tttgctaacc tgcaaaaggt cggtaaatcg 120 ctgat 125 <210> 25 <211> 124 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UTR4_oligo <400> 25 acacggcgag gctctccccc cttgccacgc gtgagaacgt aaaaaaagca ataacgagta 60 ggagtttctc gataatgttt aagaatgcat ttgctaacct gcaaaaggtc ggtaaatcgc 120 tgat 124 <210> 26 <211> 126 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UTR5_oligo <400> 26 acacggcgag gctctccccc cttgccacgc gtgagaacgt aaaaaaagca acattcacaa 60 ggagacgtca acaatcatgt ttaagaatgc atttgctaac ctgcaaaagg tcggtaaatc 120 gctgat 126 <210> 27 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> forward primer of C-ptsG_UTR <400> 27 catatgtttt gtcaaaatgt gcaacttctc caatgat 37 <210> 28 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of C-ptsG_UTR <400> 28 ttttaaccat gatgccatag gcaacaactg c 31 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer of C-ptsG_del <400> 29 cggtaaatcg ctgatgctgc cggta 25 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of C-ptsG_del <400> 30 gtggttacgg atgtactcat ccatctcg 28

Claims (15)

Introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; &Lt; / RTI &gt;
4. The method of claim 1, wherein the synthetic 5 'UTR comprises a sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1-4.
2. The method of claim 1, wherein the method comprises: introducing an adhE2 gene and a fdhl gene for butanol production into a microorganism; &Lt; / RTI &gt;
A recombinant microorganism for producing butanol, which is produced using the method according to any one of claims 1 to 3.
Culturing the recombinant microorganism of claim 4; &Lt; / RTI &gt;
Introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; &Lt; / RTI &gt;
7. The method of claim 6, wherein the synthetic 5 'UTR comprises the nucleotide sequence of SEQ ID NO: 5.
7. The method of claim 6, wherein the method further comprises: introducing a crt gene, hbd gene, and tesB gene for production of butyric acid into a microorganism; &Lt; / RTI &gt;
A recombinant microorganism for producing butyric acid, which is produced using the method according to any one of claims 6 to 8.
Culturing the recombinant microorganism of claim 9; &Lt; / RTI &gt;
Introducing a ptsG gene comprising a synthetic 5 ' UTR sequence into a microorganism; Wherein the microorganism is a microorganism capable of producing 2,3-butanediol.
12. The method of claim 11, wherein the synthetic 5 'UTR comprises the nucleotide sequence of SEQ ID NO: 5.
12. The method of claim 11, wherein the method comprises: introducing a budABC operon for 2,3-butanediol production into a microorganism; &Lt; / RTI &gt;
A recombinant microorganism for producing 2,3-butanediol, which is produced by using the method according to any one of claims 11 to 13.
Culturing the recombinant microorganism of claim 14; &Lt; RTI ID = 0.0 &gt; 2,3-butanediol &lt; / RTI &gt;

Images