CN102277445A

CN102277445A - PRRS RT-LAMP detection method and detection kit

Info

Publication number: CN102277445A
Application number: CN2010105830316A
Authority: CN
Inventors: 杨素; 廖秀云; 廖明; 沙才华; 徐海聂
Original assignee: ZHUHAI ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU OF PRC
Current assignee: ZHUHAI ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU OF PRC
Priority date: 2010-12-10
Filing date: 2010-12-10
Publication date: 2011-12-14

Abstract

The invention discloses a simple, rapid and specific PRRS RT-PCR detection method and a detection kit. By the application of the reverse transcription loop-mediated isothermal amplification technology (RT-LAMP), two pairs of specific primers are designed in six areas of the PRRSV nucleocapsid protein (N protein) ORF 7 gene conserved sequence, and the PRRS virus (PRRSV) RT-LAMP detection method is established through a reaction system, reaction condition optimization as well as a sensitivity and singularity test. The research result shows that no complex apparatus but only a common thermostat water bath cauldron is required in the detection method, a nucleic acid amplification reaction can be completed after insulation for one hour under isothermal condition (63 DEG C), and the test result can be accurately determined by naked eyes after the addition of a nucleotide dye SYBRGreenI. The invention provides a cheap, simple, rapid and novel method with high sensitivity and good specificity for the detection of PRRS in the field, on the scene and in primary departments.

Description

Blue otopathy RT-LAMP detection method and detection kit

Technical field

The present invention relates to a kind of blue otopathy RT-LAMP detection method and detection kit.

Background technology

Pig blue-ear disease mainly is by porcine reproductive and respiratory syndrome virus (Porcine Reproductive and Respiratory Syndrome virus, PRRSV) infect the disease that causes, blue otopathy broke out in Europe in 1990～1991 years, cause the pig death above 1,000,000, Dutch Wenswort in 1991 etc. isolate this virus first in sick pig body.Blue otopathy pig mortality ratio is generally 50%, even 90%～95%, mainly cause pregnant sow miscarriage, premature labor, stillbirth and mummy tire, and piglet mainly contains symptoms such as cough, expiratory dyspnea.Blue otopathy is the category-B zoonosis of OIE regulation, the intensive culture field is in case infect, be difficult to purify, since U.S.'s reported first in 1987, blue otopathy has spread to the whole world, all cause enormous economic loss every year, the pig industry of countries in the world has been constituted serious threat, quick, special, responsive detection PRRSV effectively controls the PRRSV tool to pig industry and important meaning.

Chinese scholars has been set up the method for the blue otopathy of multiple detection.Immunological detection methods such as indirect immunofluorescence assay, immunoperoxidase monolayer assay, are made a definite diagnosis difficulty at quarantine cycle length, complex operation, thereby are unfavorable for monitoring accurately, fast and efficiently the epidemic situation of PRRSV.Development along with modern molecular biology, existing multiple molecular diagnostic techniques is applied to the detection of blue otopathy, as RT-PCR, biochip technology, nucleotide sequence dependent amplification (NASBA), real-time fluorescence RT-PCR, mispairing amplification mutant test (MAMA) etc., but these methods all need expensive instrumentation and reagent, be not suitable for applying in the basic unit laboratory, and the novel nucleic acids amplification technique---ring mediated isothermal amplification (LAMP) is compared with other detection method, have easy, fast, advantage such as special, do not need the PCR instrument, in water-bath, can finish amplification, be particularly suitable for the basic unit laboratory and promote the use of.Also do not set up at present a kind of convenience and reached easy, quick, the special RT-PCR detection method that blue otopathy detection is carried out in the basic unit laboratory in the open air.

Summary of the invention

Technical problem to be solved by this invention is to overcome the deficiencies in the prior art, and a kind of easy, quick, special blue otopathy RT-PCR detection method and detection kit are provided.

The technical solution adopted in the present invention is: the blue otopathy RT-LAMP detection method that the present invention relates to may further comprise the steps:

A: get sample extraction nucleic acid to be checked, carry out reverse transcription to obtain cDNA;

B: with described cDNA is template, carries out constant-temperature amplification with outer primer (B3, F3) and inner primer (FIP, BIP) in reaction system; The sequence of described outer primer (B3, F3) and inner primer (FIP, BIP) is as follows respectively:

B3：5’-ATGCTGAGGGTGATGCTGT-3’

F3：5’-CATTTCCCTCTAGCGACTGA-3’

FIP：5’-GCCCTGATTGAAGGCAGTCTGGACTTTACCCCTAGTGAGCGG-3’

BIP：5’-ACCCTGTCAGATTCAGGGAGGATCAGACGCACAGTATGTTGC-3’；

C: in amplified production, add developer and come result of determination according to colour-change; Perhaps get amplified production and come result of determination with the agarose electrophoresis detection method.

Through optimization design, the concentration of the outer primer in the described reaction system (B3, F3) is 10 μ M, and the concentration of inner primer (FIP, BIP) is 80 μ M.

Through optimization design, the reaction conditions of constant-temperature amplification is in step B: 63 ℃ of 1h, 82 ℃ of termination reactions.

The developer that adds in the determination step as a result at step C is SYBR Green I, decision method is: after reaction finishes, in each reaction tubes, add 2 μ L～3 μ L SYBR Green I respectively, observe colour-change behind the mixing, when the positive control pipe shows light green, when the negative control pipe shows light red orange, show that absinthe-green pipe is judged to the positive, show that the pipe of light red orange is judged to feminine gender.

The RT-LAMP reaction system is in the detection kit involved in the present invention: 10 * ThermoPol Buffer, 2.5 μ l, Bst archaeal dna polymerase 1.0 μ l, the outer primer B3 1 μ l of 10 μ M, the outer primer F3 1 μ l of 10 μ M, the inner primer BIP 1 μ l of 80 μ M, the inner primer FIP 1 μ l of 80 μ M, the cDNA 1 μ l of 15ng/ μ l, the Betaine 5 μ l of 5M, DEPC water mend to 25 μ L; Wherein also contain Mg in this reaction system ²⁺3～15mM, dNTP 0.2～1.2mM.

Mg in the described reaction system ²⁺Be respectively 7.5mM, 0.4mM with the concrete preferred concentration of dNTP.

The invention has the beneficial effects as follows: the 2 pairs of special primers of 6 zone design that the present invention is directed to the N gene, utilize strand displacement archaeal dna polymerase (being Bst DNA polymerase) at isothermal condition (about 63 ℃) insulation 1h, can finish nucleic acid amplification reaction, from nucleic acid extraction, whole experiment only needs 2.5h.Compare other PCR detection methods, present method does not need processes such as the thermally denature of template, long-time temperature cycle, loaded down with trivial details electrophoresis, ultraviolet visualization, therefore do not need complex instrument, only with the logical thermostat water bath of a Daepori, after reaction finishes, by visual inspection just can be quick, easy, efficient, high specific, hypersensitivity ground detect reproductive and respiratory syndrome virus, for the detection of open-air, scene and department of basic unit indigo plant otopathy provide a kind of quick, easy, susceptibility is high, special good novel method.

Description of drawings

Fig. 1 is different dNTP concentration RT-LAMP electrophorograms;

M:50bp lader marker wherein; 1～6:0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, 1.0 mM, 1.2 mM; 7: blank;

Fig. 2 is a different Mg ²⁺Concentration RT-LAMP electrophorogram;

M:50bp lader marker wherein; 1～10:3 mM, 4.5 mM, 6 mM, 7.5 mM, 9 mM, 10.5 mM, 12 mM, 13.5 mM, 15mM;

Fig. 3 is a differing temps RT-LAMP electrophorogram;

M:50bp lader marker wherein; 1～10 swimming lane: 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃, 66 ℃, 67 ℃, 68 ℃;

Fig. 4 is a differential responses time RT-LAMP electrophorogram;

M:50bp lader marker wherein; 1～10 swimming lane: 5min, 10min, 20min, 30min, 40min, 50min, 60min, 70min, 80min, 90min;

Fig. 5 is a PRRSV RT-LAMP specificity developer test-results;

A:SIV wherein; B:PRV; C:TGEV; D:PCV2; E:FMDV; F:PRRSV VR; G:PRRSV LV; H:HP – PRRSV;

Fig. 6 is a PRRSV RT-LAMP specificity electrophoresis test-results;

M:50bp ladder marker wherein; 1:SIV; 2:PRV; 3:TGEV; 4:PCV2; 5:FMDV; 6:PRRSV VR; 7:PRRSV LV; 8:HP – PRRSV;

Fig. 7 is PRRSV RT-LAMP sensitivity test;

M:50bp ladder marker wherein; The PRRSV RNA that 1～9 swimming lane: 100～10-8 doubly dilutes;

Fig. 8 is PRRSV RT-PCR sensitivity test;

M:DNA marker DL-2000 wherein; The PRRSV RNA that 1～9 swimming lane: 100～10-8 doubly dilutes.

Embodiment

Below just concrete construction step of the present invention is further elaborated, mainly comprise following step:

1, RT-LAMP primer design and synthetic:

Design of primers is to set up the core of LAMP method, it and PCR primer have certain similarity, as primer GC optimum content is 40%～60%, and avoid forming requirements such as complementary hairpin structure at 3 ' end as far as possible, but also there are differences, will follow following several principles during the LAMP design of primers: 5 ' of F2 primer is held the distance of 5 ' end of B2 primer, preferably is controlled at 120 to 180bp, between F2 primer and the F3 primer and the distance between B2 primer and the B3 primer should be in 20bp; The Tm value normal circumstances of primer or to be rich in the GC zone be 60 to 65 ℃, being rich in the AT zone is 55 to 60 ℃, primer Tm value should satisfy F3/B3＜F2/B2＜F1/B1, F2 simultaneously〉60 ℃, B2＜65 ℃; F1c and B1c primer 5 ' end and F2/B2, the free energy of 6 bases of F3/B3 primer 3 ' end should be less than-5kcal/mol; The target sequence length of amplification had better not surpass 300bp (Notomi etc., 2000).Wherein, terminal stability and amplified fragments size are most important two parameters.

PRRSV is divided into Europe class (is representative with the LV strain) and american type (is representative with the VR-2332 strain), their N gene coding region ORF7 is all comparatively conservative, the present invention utilizes these characteristics to carry out PRRSV LAMP and detects design of primers, at first use MegAlign software analysis N gene coding region ORF7 gene order, seek the most conservative zone, then according to LAMP design of primers principle, design 2 pairs of primers with Primer Explore3.0 at conservative region, amplification purpose fragment length is 211bp, and primer sequence is as follows:

PRRSV?B3 5’-ATGCTGAGGGTGATGCTGT-3’ 19bp

PRRSV?F3 5’-CATTTCCCTCTAGCGACTGA-3’ 20bp

PRRSV?FIP 5’-GCCCTGATTGAAGGCAGTCTGGACTTTACCCCTAGTGAGCGG-3’?42bp

PRRSV?BIP 5’-ACCCTGTCAGATTCAGGGAGGATCAGACGCACAGTATGTTGC-3’42bp

2, the reverse transcription of viral RNA extraction and PRRSV RNA:

Viral RNA extracts and carries out according to RNA purified reagent Trizol specification sheets, RNA with the strain of PRRSV America is a template, carries out reverse transcription (20 μ L reaction system) with universal primer: universal primer 1 μ L, 5 * buffer, 4 μ L, 10 * dNTP, 2 μ L, inhibitor 1 μ L, template ribonucleic acid 11 μ L, above component mixing, add 1 μ L ThermoScript II after putting room temperature 5min, carry out reverse transcription by following reaction parameter then: 42 ℃ of 1h, 72 ℃ of 10min, ice bath 1min.

3, the optimization of the foundation of PRRSV RT-LAMP reaction system, reaction conditions:

Adopt matrix method respectively to Mg ²⁺Concentration, dNTP concentration, temperature of reaction and reaction times are optimized shaker test, optimize other conditionally complete unanimity of shaker test, and the graded of reaction is as follows: MgCl ₂Final concentration increases progressively with 1.5mmol/L from 3.0mmol/L, up to 15mmol/L; The dNTPs final concentration increases progressively with 0.2mmol/L from 0.2mmol/L, up to 1.2mmol/L; Temperature of reaction is since 59 ℃, increases progressively with 1 ℃, up to 68 ℃; Reaction times increases progressively with 10min from 5min, and up to 90min, reaction condition optimization the results are shown in Figure 1, Fig. 2, Fig. 3, Fig. 4.

Through optimizing, it is the optimum response system of 25 μ L that the RT-LAMP that has determined to be suitable for PRRSV detects cumulative volume: 10 * ThermoPol Buffer, 2.5 μ l, Bst DNA polysaccharase 1.0 μ l, Mg ²⁺7.5mM, dNTP 0.4mM, primer B3(10 μ M) 1 μ l, F3(10 μ M) 1 μ l, BIP(80 μ M) 1 μ l, FIP(80 μ M) 1 μ l, template cDNA(15ng/ μ l) 1 μ l, Betaine(5M) 5 μ l, DEPC water mend to 25 μ L, optimum reaction condition is: 63 ℃ of 1h, 82 ℃ of termination reactions.After reaction finishes, in each reaction tubes, add 2 μ L～3 μ L SYBR Green I respectively, observe colour-change behind the mixing, when the positive control pipe shows light green, when the negative control pipe shows light red orange, show that absinthe-green pipe is judged to the positive, show that the pipe of light red orange is judged to feminine gender; Or get 5 μ L products and carry out electrophoresis detection with 2.5% agarose, when positive control the purpose band occurs at the 211bp place, when negative control the purpose band do not occur at the 211bp place, the sample that occurs the purpose band at the 211bp place is judged to the positive, and the sample that does not occur the purpose band at the 211bp place is judged to feminine gender.

4, specificity test:

Nucleic acid with SIV, PRV, TGEV, PCV2, FMDV, PRRSV VR, PRRSV LV and HP-PRRSV is template respectively, carry out constant-temperature amplification by RT-LAMP system and reaction conditions after optimizing, amplification finishes the back and judges by 2.2 method, PRRSV VR, PRRSV LV and HP-PRRSV reaction tubes all show light green, and there is specific band detected result positive (test-results is seen Fig. 5) to occur in the 211bp place behind the electrophoresis; And SIV, PRV, TGEV, PCV2 and FMDV reaction tubes all show light red orange, and detected result negative (test-results is seen Fig. 6) appears in no specific band in the 211bp place behind the electrophoresis.

5, sensitivity test:

The PRRSV RNA that gets concentration and be 15ng/ μ l carries out behind 10 times of gradient dilutions as template, carry out constant-temperature amplification by RT-LAMP system and reaction conditions after optimizing, simultaneously each extent of dilution is carried out conventional RT-PCR, amplification finishes the back and judges that by the agarose electrophoresis method RT-LAMP can detect 1.5 * 10 ^-6Ng/ μ l, i.e. RNA(Fig. 7 of 0.015pg/ μ l), and RT-PCR only detects 1.5 * 10 ^-5The RNA of ng/ μ l, i.e. RNA(Fig. 8 of 0.15pg/ μ l).

In sum, inner primer of the present invention is the principal element that influences the LAMP reaction efficiency, and inner primer concentration is high more, and the building-up reactions of beginning is just many more in the same time, and amplification efficiency is just high more.The optimal proportions of inside and outside primer concentration is 6:1～10:1, can both obtain good expanding effect in this scope, and through screening experiment, this optimum concn of studying inside and outside primer is respectively 80 μ M and 10 μ M.The Bst enzyme also is the key that influences reaction efficiency, but the enzyme of common used 8U (25 μ L system) has satisfied the synthetic needs fully, and improving its concentration does not have too big promoter action to amplification efficiency, and the used Bst DNA Polymerase of present method is 5U.Magnesium ion is the intermediate when stablizing base and forming, and it is identical to the influence mode of LAMP and PCR's, and concentration is too high or too low all to make reaction carry out or time lengthening, through screening the best Mg of present method ²⁺Concentration is 7.5mM.

Temperature of reaction is different with PCR to the influence mode of LAMP, and it does not act on DNA and acts on the Bst enzyme.Though temperature drops to 58 ℃, reaction still can be carried out, and this moment, the activity of enzyme was very weak, and reaction efficiency is extremely low.Originally discover that 62 ℃, 63 ℃, 64 ℃, 67 ℃, 68 ℃ all can amplify band preferably, illustrate that temperature is little to the influence of LAMP in Bst enzymic activity scope, but show that through testing repeatedly the optimum temperuture of present method is 63 ℃.

LAMP carries out strand displacement amplification by unique primer counter-rotating design to self, does not need the processes such as thermally denature, annealing, long-time temperature cycle of template, is incubated dozens of minutes usually, can finish.Amplification efficiency is high, can increase 109～1010 times in 15～60 minutes, and the reaction times can be above 1 hour usually.This result of study shows, can amplify purpose band preferably behind the insulation 60min, and the detected result behind insulation 70min, 80min and the 90min does not have significant difference with insulation 60min, so present method has been selected the soaking time of 60min.

The LAMP method has the characteristics of high specific and hypersensitivity, and 4 primers are respectively at 6 different zones, and any one reaction that do not match just can't be carried out, and may occur the situation of non-specific amplification hardly; Generally can detect the following sample of 10 copies, for the viral load of lower concentration or asymptomatic virus carrier's the more conventional PCR height of detection sensitivity.Test-results shows, the PRRSV RT-LAMP detection method that the present invention sets up can specific detection PRRSV, has good specificity.Can detect the PRRSV RNA of 0.015pg/ μ l, and RT-PCR only can detect the RNA of 0.15pg/ μ l, is 10 times of conventional RT-PCR, has higher susceptibility.

The method that the present invention sets up is with low cost, only needs a thermostat water bath just can carry out, and does not also need other expensive consumptive materials.The RT-LAMP product detects three kinds of methods such as traditional agarose gel electrophoresis detection method, white precipitate detection method and SYBR Green I green fluorescence detection method, the present invention has selected the green fluorescence detection method for use, this method is the easiest, quick and reliable, with the naked eye can judge, can satisfy the needs that field, scene and department of basic unit reproductive and respiratory syndrome virus detect fully the result.

SEQUENCE?LISTING

＜110〉Zhuhai Entry-Exit Inspection and Quarantine Bureau of P.R.C.

＜120〉blue otopathy RT-LAMP detection method and detection kit

<130>

<160> 4

<170> PatentIn?version?3.3

<210> 1

<211> 19

<212> DNA

＜213〉artificial sequence

<220>

<221> misc_feature

<222> (1)..(19)

＜223〉outer primer B3

<400> 1

atgctgagggtgatgctgt 19

<210> 2

<211> 20

<212> DNA

＜213〉artificial sequence

<220>

<221> misc_feature

<222> (1)..(20)

＜223〉outer primer F3

<400> 2

catttccctctagcgactga 20

<210> 3

<211> 42

<212> DNA

＜213〉artificial sequence

<220>

<221> misc_feature

<222> (1)..(42)

＜223〉inner primer FIP

<400> 3

gccctgattgaaggcagtctggactttacccctagtgagcgg 42

<210> 4

<211> 42

<212> DNA

＜213〉artificial sequence

<220>

<221> misc_feature

<222> (1)..(42)

＜223〉inner primer BIP

<400> 4

accctgtcagattcagggaggatcagacgcacagtatgttgc 42

Claims

1. a blue otopathy RT-LAMP detection method is characterized in that, may further comprise the steps:

B3：5’-ATGCTGAGGGTGATGCTGT-3’

F3：5’-CATTTCCCTCTAGCGACTGA-3’

FIP：5’-GCCCTGATTGAAGGCAGTCTGGACTTTACCCCTAGTGAGCGG-3’

BIP：5’-ACCCTGTCAGATTCAGGGAGGATCAGACGCACAGTATGTTGC-3’；

2. blue otopathy RT-LAMP detection method according to claim 1 is characterized in that, the concentration of the outer primer in the described reaction system (B3, F3) is 10 μ M, and the concentration of inner primer (FIP, BIP) is 80 μ M.

3. blue otopathy RT-LAMP detection method according to claim 1 is characterized in that the reaction conditions of constant-temperature amplification is in step B: 63 ℃ of 1h, 82 ℃ of termination reactions.

4. blue otopathy RT-LAMP detection method according to claim 1, it is characterized in that, the developer that adds in the determination step as a result at step C is SYBR Green I, decision method is: after reaction finishes, add 2 μ L～3 μ L SYBR Green I respectively in each reaction tubes, observe colour-change behind the mixing, when the positive control pipe shows light green, when the negative control pipe shows light red orange, show that absinthe-green pipe is judged to the positive, show that the pipe of light red orange is judged to feminine gender.

5. detection kit that is used for the described blue otopathy RT-LAMP detection method of claim 1, it is characterized in that, the RT-LAMP reaction system is in the described detection kit: 10 * ThermoPol Buffer, 2.5 μ l, Bst archaeal dna polymerase 1.0 μ l, the outer primer B3 1 μ l of 10 μ M, the outer primer F3 1 μ l of 10 μ M, the inner primer BIP 1 μ l of 80 μ M, the inner primer FIP 1 μ l of 80 μ M, the cDNA 1 μ l of 15ng/ μ l, the Betaine 5 μ l of 5M, DEPC water mend to 25 μ L; Wherein also contain Mg in this reaction system ²⁺3～15mM, dNTP 0.2～1.2mM.

6. detection kit according to claim 5 is characterized in that, Mg in the described reaction system ²⁺Be respectively 7.5mM, 0.4mM with the concentration of dNTP.