CN104651536A - Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof - Google Patents
Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof Download PDFInfo
- Publication number
- CN104651536A CN104651536A CN201510095356.2A CN201510095356A CN104651536A CN 104651536 A CN104651536 A CN 104651536A CN 201510095356 A CN201510095356 A CN 201510095356A CN 104651536 A CN104651536 A CN 104651536A
- Authority
- CN
- China
- Prior art keywords
- prrsv
- lamp
- reverse transcription
- isothermal amplification
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a visible reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) and application thereof. The kit comprises RT-LAMP primers, a 2*reaction buffer solution, EM, a fluorescent visual detection reagent, ultrapure water and a PRRSV RNA template, wherein the RT-LAMP primers include outer primers F3 and B3, inner primers FIP and BIP and loop primers LF and LB. The pathologic tissue of PRRSV is detected by using the kit. Specific detection and sensitive detection prove that the RT-LAMP kit provided by the invention can be used for monitoring the reaction in real time and quantitatively detecting the copy number of the porcine reproductive and respiratory syndrome virus and fast and accurately acquiring the detection result, thereby bringing the convenience for easily, conveniently and fast detecting the porcine reproductive and respiratory syndrome virus.
Description
Technical field
The present invention relates to technical field of microbial detection, relate to a kind of quick, visual and can the reverse transcription loop-mediated isothermal amplification kit of Real_time quantitative detection pig breeding dysfunction and breath syndrome virus (PRRSV) and application thereof specifically.
Background technology
Porcine reproductive and respiratory syndrome (PRRS) is that the one occurred late 1980s is newly sick, it is the high degree in contact sexually transmitted disease of the boar caused by porcine reproductive and respiratory syndrome virus (PRRSV), the pig of different ages, kind and sex all can infect, but with pregnant sow and the more easy infection of the piglet within 1 monthly age.This disease is with Sow abortion, and product stillborn foetus, weak tire, mummy tire and piglet expiratory dyspnea, septicemia, high mortality are principal character.First PRRS finds in the North Carolina state in the U.S. in 1987, after be rapidly to and spread all over the world, China introduced accidentally in nineteen ninety-five.Within 1996, Chinese scholar is separated to PRRSV at home, thus confirms the existence of this disease in China.Before 2006, PRRS distributes in some places of China, and some places present and spread and popular situation, and main manifestations is pregnant sow breeding difficulty and piglet expiratory dyspnea.Since summer in 2006, economize in China Jiangxi, Anhui, Zhejiang, Hunan, Hubei, Jiangsu etc. there occurs do not move back with hyperpyrexia, epidemic disease that skin rubefaction, expiratory dyspnea are main clinic symptoms.Cut open inspection change hemorrhage for prominent feature in various degree with dispersivity, hemorrhagic interstitial lymphoglandula and each internal organs, through epidemiology survey, virus purification, genetic analysis, animal experiment etc., finally be defined as, hyperpyrexia disease is caused by PRRS virus variant, in view of its Clinical symptoms is different from classical PRRS virus, by its called after highly pathogenic PRRS.
PRRS morbidity is anxious, propagation is fast, sickness rate is high, the course of disease is long, case fatality rate is high, and summer and autumn is multiple, and ill pig and the malicious pig of band are the important contagium of this disease.A porcine reproductive and respiratory syndrome virus infected pigs, the pig of various kind, different ages and purposes all can infect, but with pregnant sow and the most susceptible of the piglet within 1 monthly age, fattening pig also can fall ill.Piglet case fatality rate within 40 ages in days is up to 100%, and growing and fattening pigs case fatality rate is about 50%; On the pig farm in some areas, sickness rate is close to 100%, and case fatality rate is 30% ~ 50%, and even the case fatality rate of selected swine farms can reach more than 80%.
Porcine reproductive and respiratory syndrome virus mainly carries out horizontal transmission through reproductive tract through respiratory tract or by the seminal fluid of boar between same swinery, also can carry out vertical transmission by mothers and sons, just can involve full group or contiguous group in a short time.Susceptible pig also can directly contact with the malicious pig of band or have the transportation means of porcine reproductive and respiratory syndrome virus, device contacts all can be infected with pollution.
Blue otopathy is a kind of high degree in contact sexually transmitted disease, in endemicity.Pig to infect after virus 2 ~ 14 weeks all by contact by virus disseminating to other susceptible pigs, from nasal cavity, the ight soil of sick pig and all can virus be detected urinating.After Infection in Piglets porcine reproductive and respiratory syndrome virus, in usual 1 ~ 2 week, can virus be detected in blood, even arrive 23d and this virus can also be detected.This shows individual, the active period that porcine reproductive and respiratory syndrome virus infects is generally shorter, but, carry out smearing culture with the pig tonsil infecting rear 23d, detect porcine reproductive and respiratory syndrome virus, this important discovery shows, porcine reproductive and respiratory syndrome virus can exist or " hiding " at some position of infected pigs.
Porcine reproductive and respiratory syndrome is the important epidemic disease that harm China pig produces, and closely monitors and quick diagnosis, be conducive to the control of this disease to this disease.At present, the detection technique of porcine reproductive and respiratory syndrome virus mainly contains ordinary method and molecular biology method.Ordinary method is the isolation identification of virus, and accurately and reliably, but general survey method exists complicated operation to its result, and need complicated plant and instrument, required time is long, and the shortcoming such as affected factor is many, is unfavorable for the quick diagnosis of porcine reproductive and respiratory syndrome.Molecular biological method mainly detects the specific gene of porcine reproductive and respiratory syndrome virus by reverse transcriptase polymerase chain reaction (RT-PCR) method, although comparatively ordinary method is quick and precisely for RT-PCR method, but need expensive plant and instrument, cost is higher, need to carry out agarose gel electrophoresis on result judges, easily cause laboratory pollution to cause occurring false positive results, these problems propose a great problem to basic unit and Site Detection.
Summary of the invention
The object of the invention is, in order to solve basic unit's detection pig breeding dysfunction and breath syndrome virus (PRRSV) fast, accurately and in real time, to provide a kind of and facilitate the test kit that basic unit is easy, fast detect PRRSV exactly.The technical scheme used for realizing the object of the invention is:
A kind of PRRSV reverse transcription loop-mediated isothermal amplification kit, this test kit comprises RT-LAMP primer, 2 × reaction buffer, EM, fluorescence visual detection reagent, ultrapure water and PRRSV RNA template, and described RT-LAMP primer comprises outer primer F3(SEQ ID NO:1) with B3(SEQ ID NO:2), inner primer FIP(SEQ ID NO:3) with BIP(SEQ ID NO:4) and ring primer LF(SEQ ID NO:5) and LB(SEQ ID NO:6);
Wherein the sequence of primer is respectively:
F3 TGCTTAGGCTGGAGGGTG
B3 ATGGCACTGCTAGGCAAAT
FIP GCCCTGAACACATTCAAGGGGGAGCATTGGACCGTCTCTGT
BIP AGCATAAGGGCGGTCTTGGTTTCAAGGCAGGCAGGATCA
LF TTATGCTCACAACAGCCCTGAAC
LB ACTGGCTGAGGTAATGCATTTG；
Above-described 2 × reaction buffer comprises Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
Above-described PRRSV RNA template is the RNA that virus genom DNA/RNA extracts that test kit extracts PRRSV.
Above-described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
Above-described 2 × reaction buffer comprises Tris-HCL 40-50mM, KCL 20-30mM, MgSO
416-20mM, (NH
4)
2sO
420-25mM, Tween20 0.2-0.5 ℅, Betaine 1.6-3.2M and dNTPs 2.8-4 mM, above-mentioned solvent, under pH is 8.8 conditions, evenly obtains by its compound method.
An application for PRRSV reverse transcription loop-mediated isothermal amplification kit, for detecting PRRSV, or whether there is PRRSV for the pathological tissues detecting doubtful PRRSV infection on veterinary clinic, concrete detecting step comprises:
(1) Design and synthesis of RT-LAMP primer
(2) extraction of PRRSV RNA template
(3) RT-LAMP reaction system is set up
(4) RT-LAMP detection method.
Above-described RT-LAMP reaction system is set up in 25 μ L,
2 × reaction buffer 12.5 μ L
EM 1 μL
FIP 40 pmol
BIP 40 pmol
LF 25 pmol
LB 25 pmol
F3 5 pmol
B3 5 pmol
PRRSV RNA 5 μL
Ultrapure water supplies 25 μ L.
Above-described RT-LAMP detection method is the method adopting specific detection, sensitivity Detection and fluorescent visual to detect.
Above-described RT-LAMP detection method adopts the real-time turbidimeter of Loopamp LA-320C to carry out airtight complete monitoring, and temperature of reaction is 63 DEG C, reacts appearance amplification between 20-30 minute.
Substantive distinguishing features of the present invention and significant progress are:
1) high specificity
RT-LAMP detection reagent box specific detection of the present invention goes out pig breeding dysfunction and breath syndrome virus (PRRSV), and the negative control virus detected, negative control bacterium and all no positive result of water contrast are out, consistent with RT-PCR detected result.And easy and simple to handle, obtain detected result fast, without the need to instrument costly, conventional RT-PCR method need first carry out reverse transcription (RT), and then with RT product for template carries out PCR reaction, employ two response procedures, and RT-LAMP method can complete two response procedures in a reaction tubes simultaneously, within one hour, amplification can be completed.
2) highly sensitive
The sensitivity of common RT-PCR detection method is 1.736 × 10
-4ng/ μ L, and use detection method, detectability is about 1.736 × 10
-6ng/ μ L is 100 times of conventional RT-PCR.
3) obtain a result rapidly
The whole process of common RT-PCR just can be obtained a result at 24 hours, the RT-LAMP reaction method that current majority is set up after the completion of reaction, the video picture of agarose gel electrophoresis ultraviolet analysis must be adopted to carry out result of determination, extract acquisition test-results from viral RNA, need 5-6 hours.Amplification is there is in RT-LAMP detection method reaction provided by the invention between 20-30 minute, can complete amplification in 60 minutes, and result interpretation mode is easy--, under visible light positive and negative pipe is compared, obviously can see that positive reaction is obvious muddiness by naked eyes, negative reaction pipe is transparent; Of short duration centrifugal after, have obvious white magnesium pyrophosphate throw out bottom positive reaction pipe, and a sediment-free bottom negative reaction pipe; Or add fluorescence dye, positive reaction pipe under ultraviolet light in green, with the naked eye just observable experimental result.Do not need to carry out the video picture of agarose gel electrophoresis ultraviolet analysis again or uncap to add fluorescence dye and carry out carrying out sentence read result, extract from viral RNA and obtain net result and can complete in 2-3 hour.
4) do not pollute
Although set up RT-LAMP development process for detecting pig breeding dysfunction and breath syndrome virus at present, but development process can only be reaction terminate after uncap and add fluorescence dye and carry out color reaction, whether observe has colour developing to carry out interpretation test-results, or the method for being swum by leakage of electricity carries out result judgement, uncap to detect and easily cause aerosol product to pollute laboratory.And RT-LAMP fluorescence Visual detection methods of the present invention, fluorescence dye adds before the reaction, avoids uncapping polluting.In addition, RT-LAMP detection method of the present invention, on result judges, is directly carried out result of determination by the turbidity value of turbidimeter detection reaction pipe, can not be carried out fluorescent dye determination detected result or carry out agarose gel electrophoresis detected result, do not need to uncap, can effectively avoid polluting.
5) can real-time quantitative
The present invention utilizes Tubidimeter real-time LA-320 turbidimeter to carry out the result of real-time analysis RT-LAMP reaction, the typical curve that time of the turbidity value that the concentration of different standard models is corresponding is depicted as, substitute into typical curve equation, pig breeding dysfunction and the breath syndrome virus copy number of each time can be obtained, reach the object of detection by quantitative product.
Accompanying drawing explanation
Fig. 1 is RT-LAMP detection method specific detection result of the present invention; Wherein: 1: pig breeding dysfunction and the type CH-1 strain of breath syndrome virus North America; 2: pig breeding dysfunction and the type TJM-F92 strain of breath syndrome virus North America; 3: pig breeding dysfunction and the type JXA1 strain of breath syndrome virus North America; 4: pig breeding dysfunction and breath syndrome virus Europe class; 5: Pestivirus suis; 6: foot and mouth disease virus; 7: Pseudorabies virus; 8: Transmissible gastroenteritis virus; 9: epidemic diarrhea virus; 10: parvovirus; 11: circovurus type 2; 12: Escherichia coli O 157: H7; 13:2 type suis; 14: haemophilus parasuis; 15: Salmonellas; 16: Pyrogenes; 17: water contrasts.There is the upcurve of turbidity in 4 strain pig breeding dysfunctions and breath syndrome virus (North America type and Europe class) reaction tubes, 7 strains contrast viral reaction tubes, 5 strain contrast bacterial reaction pipes and water control reaction Guan Junwu and increase.
Fig. 2 and Fig. 3 is the sensitivity Detection result that RT-LAMP of the present invention detects and traditional RT-PCR detects; Wherein 1:1.736 × 10
2ng/ μ L; 2:1.736 × 10
1ng/ μ L; 3:1.736 × 10
0ng/ μ L; 4:1.736 × 10
-1ng/ μ L; 5:1.736 × 10
-2ng/ μ L; 6:1.736 × 10
-3ng/ μ L; 7:1.736 × 10
-4ng/ μ L; 8:1.736 × 10
-5ng/ μ L; 9:1.736 × 10
-6ng/ μ L; 10:1.736 × 10
-7ng/ μ L; 11:1.736 × 10
-8ng/ μ L; 12:1.736 × 10
-9ng/ μ L; 13:1.736 × 10
-10ng/ μ L; 14:water.The initial concentration of breeding difficulty and the original RNA of breath syndrome virus is 1.736 × 10
2ng/ μ L, after 10 times of multiple proportions serial dilutions, carry out RT-LAMP and RT-PCR amplification, wherein RT-PCR is detected as National Standard Method, and result display RT-LAMP method detectability is about 1.736 × 10
-6ng/ μ L, and the detection of RT-PCR method is limited to 1.736 × 10
-4ng/ μ L.
Fig. 4 is visual results after adding fluorescence dye: the response situation of left pipe to be PRRSV RNA be template, be positive findings, right pipe is the response situation of negative control, is negative findings.
Fig. 5 is the typical curve of detection by quantitative PRRSV of the present invention; Utilize the typical curve that turbidity value corresponding to the concentration of different standard models was depicted as the time, substitute into typical curve equation, pig breeding dysfunction and the breath syndrome virus copy number of each time can be obtained.
Embodiment
Embodiment 1 RT-LAMP detects
1, the preparation of material
Pig breeding dysfunction and breath syndrome virus comprise 3 strain North America type strain CH-1 strains, TJM-F92 strain and JXA1-R, 1 strain Europe class strain; Contrast strain comprises Pestivirus suis, foot and mouth disease virus, Pseudorabies virus, Transmissible gastroenteritis virus, epidemic diarrhea virus, parvovirus, porcine circovirus 2 type, contrast bacterium comprises intestinal bacteria, suis 2 type, haemophilus parasuis, Salmonellas, Pyrogenes, for commercial available vaccines, or be Guangxi veterinary institute isolation identification and preservation.Reverse transcription loop-mediated isothermal amplification kit is purchased from Beijing Lanpu Biological Technology Co., Ltd., and article No. SLP244, it is century bio tech ltd purchased from health that virus genom DNA/RNA extracts test kit, article No. CW0548.
2, the Design and synthesis of RT-LAMP primer
According to the pig breeding dysfunction in GenBank and breath syndrome virus NSP2 gene order, utilize a set of RT-LAMP primer of RT-LAMP method primer Autocad PrimerExplorer V4 software design, wherein F3, B3 are outer primer, FIP, BIP are inner primer, LF and LB is ring primer, wherein F3, B3 are that pig breeding dysfunction and breath syndrome virus RT-PCR detect primer, wherein
F3 TGCTTAGGCTGGAGGGTG
B3 ATGGCACTGCTAGGCAAAT
FIP GCCCTGAACACATTCAAGGGGGAGCATTGGACCGTCTCTGT
BIP AGCATAAGGGCGGTCTTGGTTTCAAGGCAGGCAGGATCA
LF TTATGCTCACAACAGCCCTGAAC
LB ACTGGCTGAGGTAATGCATTTG
3, viral RNA extracts or bacterial genomes DNA extraction
Virus genom DNA/the RNA using health to produce for century bio tech ltd extracts test kit, extract the RNA of pig breeding dysfunction and breath syndrome virus, the DNA/RNA of contrast virus, and the RNA of doubtful pig breeding dysfunction and respiration syndrome pathological tissues, use bacterial genomes DNA extraction kit to extract the genomic dna of control strain.
4, RT-LAMP reaction system is set up
According to test kit specification sheets, by 25 μ L system configurations:
2 × reaction buffer 12.5 μ L
EM 1 μL
FIP 40 pmol
BIP 40 pmol
LF 25 pmol
LB 25 pmol
F3 5 pmol
B3 5 pmol
PRRSV RNA 5 μL
Ultrapure water supplies 25 μ L.
RT-LAMP reaction is with real-time turbidimeter (LA-320C, Rong Yan company of Japan) form of carrying out airtight complete monitoring monitor present method detect situation, turbidimeter monitors amplification situation in real time, can drawing standard curve, time value corresponding to 0.1 turbidity value is reached by obtaining unknown sample, the starting copy number of this sample can be calculated from typical curve, temperature of reaction with 63 DEG C as temperature of reaction.
5, RT-LAMP detection method
1) specific detection
Use virus genom DNA/RNA to extract test kit and extract pig breeding dysfunction and breath syndrome virus (North America type and Europe class), Pestivirus suis, foot and mouth disease virus, Pseudorabies virus, Transmissible gastroenteritis virus, epidemic diarrhea virus, parvovirus, genomic dna/the RNA of circovurus type 2, bacterial genomes DNA extraction kit is used to extract intestinal bacteria, 2 type suis, haemophilus parasuis, the genomic dna of Salmonellas and Pyrogenes, as the template of RT-LAMP reaction, carry out the RT-LAMP amplification of each strain and bacterial strain simultaneously, simultaneously using water as blank, the specificity of checking R T-LAMP method.
2) sensitivity Detection
With the pig breeding dysfunction extracted and the geneome RNA of breath syndrome virus for template, measure its concentration, the initial concentration of pig breeding dysfunction and the original RNA of breath syndrome virus is 1.736 × 10
2ng/ μ L, becomes 13 extent of dilution with the continuous 10 times of doubling dilutions of RNA-Free Water, using each RNA extent of dilution as template, carries out RT-LAMP amplification and conventional RT-PCR amplification, the susceptibility of contrast two kinds of detection methods.
3) fluorescent visual detects
According to the condition that turbidimeter monitoring is optimized, add fluorescence dye before reaction, the dyestuff added is fluorexon commercial dyes, react at 63 DEG C after 60 minutes, observe under ultraviolet lamp, do not adopt the video picture of agarose gel electrophoresis ultraviolet analysis, avoid uncapping and run the Aerosol Pollution that electrophoresis observation causes.
The specific outcome of embodiment 2 RT-LAMP detection method
With breath syndrome virus (North America type and Europe class), 7 strains, virus stain is contrasted to 4 strain pig breeding dysfunctions, 5 strains contrast bacterium and water contrasts and carries out RT-LAMP amplification, result as shown in Figure 1, the upcurve of turbidity is there is in pig breeding dysfunction and breath syndrome virus reaction tubes at about 25 minutes, for positive findings, 7 strain contrast strain reaction tubess, 5 strain contrast bacterial reaction pipes and water control reaction pipe curve all occur without amplification situation, are negative findings.
The susceptibility results of embodiment 3 RT-LAMP detection method
The initial concentration of pig breeding dysfunction and the original RNA of breath syndrome virus is 1.736 × 10
2ng/ μ L, after 10 times of multiple proportions serial dilutions, carries out RT-LAMP and RT-PCR amplification simultaneously, and as shown in Figures 2 and 3, result display RT-LAMP method detectability is about 1.736 × 10 to result
-6ng/ μ L, and the detection of RT-PCR method is limited to 1.736 × 10
-4ng/ μ L.
The fluorescent visual detected result of embodiment 4 RT-LAMP detection method
According to the condition that turbidimeter monitoring is optimized, reaction tubes adds fluorescence dye, 63 DEG C of reactions are after 60 minutes, observe under ultraviolet lamp, Fig. 4 is observations, the response situation that Zuo Guanwei is template with pig breeding dysfunction and breath syndrome virus RNA, for positive findings, right pipe is the response situation of negative control, for negative findings, show that the RT-LAMP method that the present invention sets up can facilitate basic unit to use, the RT-LAMP primer that only test kit need be used to coordinate present method to design, after adding sample, with cheap water-bath keep 63 DEG C 60 minutes, get final product rapid examination result, and without the need to uncapping, avoid pollution.
The drafting of the quantitative pig breeding dysfunction of embodiment 5 and respiratory syndrome virus RT-LAMP method standard curve
Contrast is set: concentration is 1.736 × 10
2ng/ μ L, 1.736 × 10
1ng/ μ L, 1.736 × 10
0ng/ μ L, 1.736 × 10
-2ng/ μ L, 1.736 × 10
-3ng/ μ L, 1.736 × 10
-4ng/ μ L, 1.736 × 10
-5ng/ μ L and 1.736 × 10
-6the pig breeding dysfunction of ng/ μ L and each one of breath syndrome virus standard rna sample, because the negative logarithm of sample concentration and its amplification turbidity value be 0.1 time value linear, so the value that turbidimeter can be captured and time as shown in table 1ly make typical curve, obtain typical curve equation, y=0.3865x-12.585, as shown in Figure 5.From typical curve equation coefficient R
2be 0.9967, in good linear relationship.Take time as X value, the negative time number formulary of Y value and concentration can be obtained.As certain test sample reach turbidity value be 0.1 time be 30 minutes time, bring set up typical curve equation into, obtain Y and equal-0.99, then concentration is 10
0.99, then be multiplied by radix 1.736, be the concentration 1.736 × 10 of this test sample
0.99ng/ μ L, thus reach quantitative effect.
Table 1
| Time (min) | 26.9 | 29.9 | 32.9 | 38.2 | 40.9 | 42.9 | 44.9 | 47.9 |
| Standard value (-LOG) | -2 | -1 | 0 | 2 | 3 | 4 | 5 | 6 |
Claims (8)
1. a PRRSV reverse transcription loop-mediated isothermal amplification kit, it is characterized in that, this test kit comprises RT-LAMP primer, 2 × reaction buffer, EM, fluorescence visual detection reagent, ultrapure water and PRRSV RNA template, and described RT-LAMP primer comprises outer primer F3(SEQ ID NO:1) with B3(SEQ ID NO:2), inner primer FIP(SEQ ID NO:3) with BIP(SEQ ID NO:4) and ring primer LF(SEQ ID NO:5) and LB(SEQ ID NO:6);
Wherein the sequence of primer is respectively:
F3 TGCTTAGGCTGGAGGGTG
B3 ATGGCACTGCTAGGCAAAT
FIP GCCCTGAACACATTCAAGGGGGAGCATTGGACCGTCTCTGT
BIP AGCATAAGGGCGGTCTTGGTTTCAAGGCAGGCAGGATCA
LF TTATGCTCACAACAGCCCTGAAC
LB ACTGGCTGAGGTAATGCATTTG；
2 described × reaction buffer comprises Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
2. PRRSV reverse transcription loop-mediated isothermal amplification kit according to claim 1, is characterized in that, described PRRSV RNA template extraction is the RNA using virus genom DNA/RNA to extract the PRRSV that test kit extracts.
3. PRRSV reverse transcription loop-mediated isothermal amplification kit according to claim 1, is characterized in that, described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
4. PRRSV reverse transcription loop-mediated isothermal amplification kit according to claim 1, it is characterized in that, 2 described × reaction buffer comprises Tris-HCL 40-50mM, KCL 20-30mM, MgSO
416-20mM, (NH
4)
2sO
420-25mM, Tween20 0.2-0.5 ℅, Betaine 1.6-3.2M and dNTPs 2.8-4 mM.
5. an application for PRRSV reverse transcription loop-mediated isothermal amplification kit, is characterized in that, for detecting doubtful PRRSV, whether there is PRRSV for detecting doubtful PRRSV pathological tissues on veterinary clinic, concrete detecting step comprises:
(1) Design and synthesis of RT-LAMP primer
(2) extraction of PRRSV RNA template
(3) RT-LAMP reaction system is set up
(4) RT-LAMP detection method.
6. the application of PRRSV reverse transcription loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described RT-LAMP reaction system is set up in 25 μ L,
2 × reaction buffer 12.5 μ L
EM 1 μL
FIP 40 pmol
BIP 40 pmol
LF 25 pmol
LB 25 pmol
F3 5 pmol
B3 5 pmol
PRRSV RNA 5 μL
Ultrapure water supplies 25 μ L.
7. the application of PRRSV reverse transcription loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described RT-LAMP detection method is the method adopting specific detection, sensitivity Detection and fluorescent visual to detect.
8. the application of PRRSV reverse transcription loop-mediated isothermal amplification kit according to claim 5, is characterized in that, described RT-LAMP detection method adopts real-time turbidimeter to carry out airtight complete monitoring.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095356.2A CN104651536A (en) | 2015-03-04 | 2015-03-04 | Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095356.2A CN104651536A (en) | 2015-03-04 | 2015-03-04 | Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104651536A true CN104651536A (en) | 2015-05-27 |
Family
ID=53243174
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510095356.2A Pending CN104651536A (en) | 2015-03-04 | 2015-03-04 | Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651536A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108411040A (en) * | 2018-05-21 | 2018-08-17 | 浙江大学 | Pig acute diarrhea syndrome coronavirus Primer composition and its kit and method |
| CN110218819A (en) * | 2019-06-14 | 2019-09-10 | 广西壮族自治区兽医研究所 | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101319253A (en) * | 2008-07-18 | 2008-12-10 | 中国农业科学院兰州兽医研究所 | Method for detecting high-pathogenicity blue ear disease |
| CN101343672A (en) * | 2008-07-09 | 2009-01-14 | 中国农业大学 | Detection reagent kit for porcine propagate and breath complex virus and uses thereof |
| CN101413036A (en) * | 2008-12-02 | 2009-04-22 | 中山大学 | Primer for detecting porcine reproductive and respiratory syndrome virus, and use method thereof |
| CN101525671A (en) * | 2009-02-11 | 2009-09-09 | 中国农业大学 | Highly pathogenic porcine reproductive and respiratory syndrome virus detection reagent kit and application thereof |
| CN101575650A (en) * | 2009-06-24 | 2009-11-11 | 中国兽医药品监察所 | Porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and detection method thereof |
| CN102277445A (en) * | 2010-12-10 | 2011-12-14 | 中华人民共和国珠海出入境检验检疫局 | PRRS RT-LAMP detection method and detection kit |
| CN103276104A (en) * | 2013-04-27 | 2013-09-04 | 华南农业大学 | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications |
| CN103509880A (en) * | 2013-10-15 | 2014-01-15 | 江苏省农业科学院 | LAMP detection kit of highly-pathogenic porcine reproductive and respiratory syndrome viruses |
-
2015
- 2015-03-04 CN CN201510095356.2A patent/CN104651536A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101343672A (en) * | 2008-07-09 | 2009-01-14 | 中国农业大学 | Detection reagent kit for porcine propagate and breath complex virus and uses thereof |
| CN101319253A (en) * | 2008-07-18 | 2008-12-10 | 中国农业科学院兰州兽医研究所 | Method for detecting high-pathogenicity blue ear disease |
| CN101413036A (en) * | 2008-12-02 | 2009-04-22 | 中山大学 | Primer for detecting porcine reproductive and respiratory syndrome virus, and use method thereof |
| CN101525671A (en) * | 2009-02-11 | 2009-09-09 | 中国农业大学 | Highly pathogenic porcine reproductive and respiratory syndrome virus detection reagent kit and application thereof |
| CN101575650A (en) * | 2009-06-24 | 2009-11-11 | 中国兽医药品监察所 | Porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and detection method thereof |
| CN102277445A (en) * | 2010-12-10 | 2011-12-14 | 中华人民共和国珠海出入境检验检疫局 | PRRS RT-LAMP detection method and detection kit |
| CN103276104A (en) * | 2013-04-27 | 2013-09-04 | 华南农业大学 | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications |
| CN103509880A (en) * | 2013-10-15 | 2014-01-15 | 江苏省农业科学院 | LAMP detection kit of highly-pathogenic porcine reproductive and respiratory syndrome viruses |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108411040A (en) * | 2018-05-21 | 2018-08-17 | 浙江大学 | Pig acute diarrhea syndrome coronavirus Primer composition and its kit and method |
| CN110218819A (en) * | 2019-06-14 | 2019-09-10 | 广西壮族自治区兽医研究所 | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103160615B (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN104651534A (en) | Porcine circovivus loop-mediated isothermal amplification kit and application thereof | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN105349702A (en) | PPV (porcine parvovirus) LAMP (loop-mediated isothermal amplification) kit and application thereof | |
| CN106435033A (en) | Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit | |
| CN104651535A (en) | Reverse transcription loop-mediated isothermal amplification test kit of hog cholera virus and application thereof | |
| CN104726614A (en) | Detection primer, kit and detection method of infectious bovine rhinotracheitis virus | |
| CN105349672A (en) | Mycoplasma hyopneumoniae loop-mediated isothermal amplification kit and application thereof | |
| CN104651536A (en) | Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof | |
| CN101392299B (en) | Equine influenza detection kit and detection method | |
| CN104651519A (en) | Mycoplasma bovis loop-mediated isothermal amplification kit and application thereof | |
| CN106148566A (en) | A kind of Andrias davidianus Blanchard irido virus CPA detection primer and application | |
| CN110747293A (en) | Triple fluorescence RT-PCR detection kit for identifying swine vesicular disease virus, foot and mouth disease virus and seneca valley virus | |
| CN114058719B (en) | Primer pair and kit for identifying brucella and application of primer pair and kit | |
| CN103205493B (en) | LAMP method for detecting Brucella | |
| CN110195120A (en) | Duplex PCR primer sets and kit a kind of while that detect MS-H vaccine strain and versatility | |
| CN113234860B (en) | Dual detection primer and probe combination for bovine viral diarrhea virus and bovine parainfluenza virus type 3 | |
| Li et al. | Inguinal lymph node sample collected by minimally invasive sampler helps to accurately diagnose ASF in dead pigs without necropsy | |
| CN106435015A (en) | Rapidly color developing LAMP kit for one-step detection of porcine parvoviruses | |
| CN104946747A (en) | Nested primer for early warning of cultured and wild Portunus trituberculatus microsporidium infection, and application thereof | |
| CN101319253B (en) | Method for detecting high-pathogenicity blue ear disease | |
| CN105385789A (en) | Reverse transcriphase loop-mediated isothermal amplification kit for swine transmissible gastroenteritis viruses and application of kit | |
| CN104651518A (en) | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof | |
| Lee et al. | Prevalence study of respiratory pathogens in Korean cats using real-time polymerase chain reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150527 |
|
| RJ01 | Rejection of invention patent application after publication |