CN103276104A - RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications - Google Patents
RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications Download PDFInfo
- Publication number
- CN103276104A CN103276104A CN2013101542120A CN201310154212A CN103276104A CN 103276104 A CN103276104 A CN 103276104A CN 2013101542120 A CN2013101542120 A CN 2013101542120A CN 201310154212 A CN201310154212 A CN 201310154212A CN 103276104 A CN103276104 A CN 103276104A
- Authority
- CN
- China
- Prior art keywords
- primer
- test strip
- detection
- nucleic acid
- lamp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a RT-LAMP nucleic acid test strip kit for detection of a porcine reproductive and respiratory syndrome virus, and applications The kit comprises a primer combination with a nucleotide sequence represented by SEQ ID NO. 1-6 and nucleic acid detection test strips. The usage of the kit is as follows: first preparing RT-LAMP reaction system comprising an AMV retrovirus, a 1* reaction buffer, a Bst DNA polymerase, a dNTP mixture, betaine, MgSO4, a FIP primer, a BIP primer, a LoopF primer, a LoopB primer, a F3 primer, a B3 primer, and RNA of a sample to be measured; carrying out a reaction at a constant temperature, after testing the obtained products by using the nucleic-acid-detecting test strip, judging and reading directly: the positive result is that two red strips appear, and one strip is in the detection zone while the other strip is in the control zone. The kit has the advantages of simple operation, low cost, easy observation of the reaction result, good specificity, easy popularization and application in large scope and being extremely suitable for export quarantine, food hygiene and on-site detection in animal husbandry.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of RT-LAMP nucleic acid test strip test kit and application that detects porcine reproductive and respiratory syndrome virus.
Background technology
Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome, PRRS), be commonly called as " blue otopathy ", be by porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory syndrome virus, PRRSV) cause a kind of main be the viral infectious of feature with sow breeding difficulty, piglet respiratory symptom and weanling pig high mortality.In addition, also show symptoms such as part rehabilitation oestrus of sow is not true to type, conceptual quotient is low clinically.At first in U.S.'s outburst, very fast worldwide rapid spread caused enormous economic loss to pig industry to this disease subsequently in 1987.International Office of Epizootics is decided to be the category-B transmissible disease with it, and China classifies them as two class transmissible diseases.
In China's Taiwan reported first the generation of this disease was arranged in 1991, it is the epidemic strain of representative that Guo Baoqing in 1996 etc. are separated to CH-1a from domestic swinery first.Heredity and variation along with virus, since summer in 2006, at first the outburst of province, China south with high heat, apocleisis, burnout, be hard and dry, the later stage has loose bowels, flush and clinical symptom such as be short of breath are " porcine hyperthermia " of feature, it is most of regional to spread to the whole nation subsequently.According to the preliminary statistics, these regional pigs sickness rate only reaches more than 50%, and mortality ratio reaches 20% to 100%, has caused enormous economic loss for China's Swine Production.
PRRSV is a kind of sub-thread positive chain RNA virus that cyst membrane, non-segmented negative are arranged, belong to many viraleses of Buddhist nun Arteriviridae Arterivirus, closely related with equine arteritis virus, mouse serum lactic dehydrogenase rising syndrome virus and SHF virus on biological characteristics, structure and heredity, but there is no serological cross reaction between them.According to genome and antigenic difference, people are divided into two serotypes, Europe class and american types with PRRSV.
The method that is usually used in detecting porcine reproductive and respiratory syndrome virus at present comprises Pathogen Isolation evaluation, serological method and RT-PCR, quantitative fluorescent PCR.Pathogen Isolation identifies it is the most traditional detection method, its result accurately and reliably, but its influence factor is many, actually operating is got up quite wastes time and energy, and therefore certain limitation is arranged in clinical application; Susceptibility and the specificity of serological tests such as hemagglutination-inhibition test, complement fixation test (CFT), neutralization test and enzyme linked immunosorbent assay are lower, operate also cumbersome; And RT-PCR, fluorescent quantitative PCR technique need special plant and instrument (as PCR instrument and gel imaging system etc.) to carry out relevant operation with the professional, obviously can't satisfy the demand of basic unit and on-the-spot detection.
Loop-mediated isothermal amplification (LAMP) is by the constant temperature nucleic acid amplification method of Japanese scholar Notomi in a kind of novelty of exploitation in 2000, this technology is utilized 6 specific regions of 4 kinds of different Auele Specific Primer identification target genes, and (Bst DNA polymerase) carries out the efficient rapid amplifying of target sequence under isothermal condition by a kind of strand displacement archaeal dna polymerase.In recent years, this technology is widely used in pathogen detection both at home and abroad.People (Development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus.Clin Microbiol, 2004May such as Hong TC; 42 (5): 1956-61) in 2004 according to the LAMP principle design real-time quantitative RT-LAMP method, with rapid detection SARS-Cov, the sensitivity of RT-LAMP as a result is 100 times of RT-PCR; People (Rapid diagnosis of H5N1avian influenza virus infection by newly developed influenza H5hemagglutinin gene-specific loop-mediated isothermal amplification method.Virol Methods.2007May such as Masaki Imai; 141 (2): 173-80.) set up the RT-LAMP detection architecture of quick diagnosis H5N1 avian influenza virus in 2007.Because the amplified production of LAMP is white magnesium pyrophosphate precipitation, with the naked eye is difficult to observe, Japan has developed the turbidimeter of specially the LAMP product being monitored in real time.But the use of turbidimeter has not only increased expense, and is inconvenient to carry; There is the scholar to utilize to add in the reacted system method of SYBR Green I dyestuff to detect amplified production, but the observation processing of must uncapping again like this, the high efficiency of LAMP amplification and hypersensitivity make and contain a large amount of purpose fragments in the product, uncap and add dyestuff contaminate environment extremely easily.Afterwards, there is research that the LAMP method is further improved, after fluorexon and Manganous chloride tetrahydrate are added in the basis of original LAMP reaction reagent, can derive another more easy visual LAMP, one step can finish LAMP amplification and the result judges, the LAMP product need not to uncap and analyzes the result that can detect by an unaided eye.But this method is not accurate enough to the differentiation of weak positive findings, and can make experimental result be difficult to judge because of the concentration proportioning of fluorexon and mn ion.
Summary of the invention
Primary and foremost purpose of the present invention provides one and has highly sensitive, high specific, visual, RT-LAMP nucleic acid test strip test kit that working method simply detects porcine reproductive and respiratory syndrome virus.
Another object of the present invention is to provide the application of the RT-LAMP nucleic acid test strip test kit of realizing above-mentioned detection porcine reproductive and respiratory syndrome virus.
Purpose of the present invention is achieved through the following technical solutions: a kind of RT-LAMP nucleic acid test strip test kit that detects porcine reproductive and respiratory syndrome virus comprises following primer sets and detection of nucleic acids test strip:
The nucleotide sequence of described primer sets is as follows:
F3：5’-ATAGCACAGCTCCACAGA-3’；
B3：5’-TCTATGGCTGAGTACACTCC-3’；
FIP：5’-GCAGAAGCCCTAGCAGTCGTTACCTACACGCCAGTGA-3’；
BIP：5’-TACCTTCGGGCACATGACATTCAAGAAGTGCAACTACTGCTC-3’；
LoopF：5’-Biotin-GCCGCGACTTACCTTTAGA-3’；
LoopB：5’-FITC-ACTTTGAGAGCACAAATAGGGT-3’；
Described detection of nucleic acids test strip is the universal nucleic acid test strip;
The RT-LAMP nucleic acid test strip test kit of described detection porcine reproductive and respiratory syndrome virus preferably comprises above-mentioned primer sets and full closed target nucleic amplifier fast testing device;
Described full closed target nucleic amplifier fast testing device is Yousida Biological Technology Co., Ltd., Hangzhou's product; This proofing unit obtains in the palm plastics proofing unit for the universal nucleic acid test strip is inserted;
The RT-LAMP nucleic acid test strip test kit of described detection porcine reproductive and respiratory syndrome virus also comprises dNTP mixture solution, MgSO
4Solution, reaction buffer, strand displacement archaeal dna polymerase (Bst DNApolymerase), trimethyl-glycine (Betaine) solution and AMV reversed transcriptive enzyme;
It is that the strand displacement archaeal dna polymerase of 8U/L, the dNTP mixture solution that concentration is 2.5mmol/L, alkali solution of beet, the concentration that concentration is 10mol/L are the MgSO of 100mmol/L that described test kit more preferably comprises AMV reversed transcriptive enzyme, 10 times of reaction buffers (10 * ThermoPol Reaction Buffer), concentration that concentration is 5U/ μ L
4Solution, concentration are that primers F IP, the concentration of 10 μ mol/L is that the primer BIP of 10 μ mol/L, primers F 3, concentration that concentration is 10 μ mol/L are that primer B3, the concentration of 10 μ mol/L is that primer LoopF and the concentration of 10 μ mol/L is the primer LoopB of 10 μ mol/L;
The application of the RT-LAMP nucleic acid test strip test kit of described detection porcine reproductive and respiratory syndrome virus comprises following steps:
(1) preparation RT-LAMP reaction system is pressed final concentration and is calculated, and the AMV reversed transcriptive enzyme is 10
5U/L, 10 times of reaction buffers (10 * ThermoPol Reaction Buffer) are that 1 times (1 *), strand displacement archaeal dna polymerase are that 0.32U/L, dNTP mixture are that 0.4～0.6mmol/L, trimethyl-glycine are 1～2mol/L, MgSO
4Be that 0～3mmol/L, FIP primer are that 1.6 μ mol/L, BIP primer are that 1.6 μ mol/L, F3 primer are that 0.2 μ mol/L, B3 primer are that 0.2 μ mol/L, LoopF primer are that 0.6 μ mol/L, LoopB primer are 0.6 μ mol/L, testing sample RNA is 12ng/ μ L; Isothermal reaction;
(2) reaction: the product after step (1) isothermal reaction is detected the 10min observations with the detection of nucleic acids test strip;
(3) interpretation as a result: directly naked eyes interpretation,
1. negative (-): only a red stripes occurs at Quality Control district (C), the redfree band occurs in detection zone (T), proves that the sample that detects does not have porcine reproductive and respiratory syndrome virus to infect;
2. positive (+): two red stripes occur, one is positioned at detection zone (T), and another is positioned at Quality Control district (C), proves that the sample that detects is that porcine reproductive and respiratory syndrome virus infects;
3. invalid: all redfree band appearance in Quality Control district (C) and the detection zone (T) show that the nucleic acid test strip lost efficacy.
The final concentration of the dNTP mixture described in the step (1) is preferably 0.4mmol/L;
The final concentration of the trimethyl-glycine described in the step (1) is preferably 1mol/L;
MgSO described in the step (1)
4Final concentration be preferably 2mmol/L;
The time of the isothermal reaction described in the step (2) is preferably 10～40min;
The condition optimization of the isothermal reaction described in the step (2) is 61 ℃ of reaction 40min.
Compared with prior art, the present invention has the following advantages and beneficial effect:
(1) RT-LAMP is with low cost, utilizes Bst DNA polymerase to realize isothermal duplication at 61 ℃, does not need complexity and expensive PCR instrument, and therefore, test kit use cost provided by the invention is low.
(2) test kit provided by the present invention is swift in response, and utilizes the AMV ThermoScript II to realize single stage method RT-LAMP, need not to increase by the transcriptive process,reversed of 42 ℃ of 1h, can finish reaction in 40min, can finish in 10min the soonest.
(3) reaction result that obtains of test kit provided by the invention is easy to observe, though producing a large amount of magnesium pyrophosphate precipitations in the DNA cloning process, LAMP make reaction solution present muddiness, after reaction finishes, need not agarose gel electrophoresis can direct visual inspection reaction tubes in muddiness whether judge the positive, but weak positive findings still brings big difficulty to differentiation, if carry out the specific biological mark at primer 5 ' end, and then with the detection of nucleic acids test strip product is detected, both can accurately carry out quick interpretation to the result, and can prevent from again polluting.
(4) test kit specificity provided by the invention is good, to the reaction that all is negative such as Pestivirus suis, circovurus type 2; Highly sensitive, the minimum RNA template that can detect 1pg, consistent with the detectability of RT-LAMP agarose gel electrophoresis, detect 10 times of limits for height than the visual RT-LAMP method of fluorexon and common RT-PCR method.Even several virus particle also can be detected fast and accurately.
(5) RT-LAMP nucleic acid test strip test kit of the present invention can detect porcine reproductive and respiratory syndrome virus fast, delicately, need not expensive instrument, only needs a thermostat water bath can finish reaction.Simple to operate, with low cost, reaction result is easy to observe, and specificity is good, and the scene that is highly suitable for export quarantine, food sanitation and livestock-raising field is detected, and is easy to apply on a large scale.
Description of drawings
Fig. 1 is RT-LAMP reaction system optimization figure as a result, wherein:
A is different dNTP concentration and electrophoresis brightness relationship figure, and swimming lane M is DNA Marker DL2000, and swimming lane 1～6 corresponding dNTP concentration successively is respectively the reaction product that 0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM and 0.6mM obtain;
B is different B etaine concentration and electrophoresis brightness relationship figure, and swimming lane M is DNA Marker DL2000, and swimming lane 1～4 corresponding Betaine concentration successively is respectively the reaction product that 0M, 0.5M, 1.0M and 1.5M obtain;
C is different Mg SO
4Concentration and electrophoresis brightness relationship figure, swimming lane M is DNA Marker DL2000, swimming lane 1～8 is corresponding MgSO successively
4Concentration is respectively the reaction product that 0mM, 0.5mM, 1mM, 2mM, 3mM, 4mM, 5mM and 6mM obtain;
D is inner primer (FIP+BIP) and outer primer (F3+B3) different concns ratio and different concns outer primer (F3+B3) and electrophoresis brightness relationship figure, swimming lane M is DNA Marker DL2000, swimming lane 1～8 corresponding inner primer and outer primer successively is the reaction product that 2:1,4:1,6:1,8:1,10:1,3:1,6:1 and 8:1 obtain by concentration ratio, wherein, swimming lane 1～5 outer primer concentration is 0.2 μ mol/L, and the outer primer concentration of swimming lane 6～8 is 0.4 μ mol/L;
E is different rings primer (LoopF+LoopB) and outer primer (F3+B3) concentration ratio and electrophoresis brightness relationship figure, swimming lane M is DNA Marker DL2000, swimming lane 1～7 corresponding ring primer and outer primer successively is the reaction product that 1:1,2:1,3:1,4:1,5:1,6:1 and 0:1 obtain by concentration ratio, and outer primer concentration is 0.2 μ mol/L.
Fig. 2 is RT-LAMP reaction condition optimization figure as a result, wherein:
A is the electrophoresis brightness relationship figure that reacts under the differing temps, and swimming lane M is DNA Marker DL2000, and swimming lane 1～8 corresponding temperature of reaction successively is the product of 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃ and 66 ℃;
B is DNA Marker DL2000 for the electrophoresis brightness relationship figure under the differential responses time, swimming lane M, and the corresponding reaction times is the product of 10min, 20min, 30min, 40min, 50min and 60min to swimming lane 1～6 successively.
Fig. 3 is the agarose gel electrophoresis figure as a result in the RT-LAMP nucleic acid test strip test kit specificity provided by the invention experiment, wherein:
Swimming lane M is DNA Marker DL2000; Swimming lane 1 is to be the RT-LAMP reaction product of template with the classical strain GD08-2 of PRRSV pnca gene group; Swimming lane 2 is to be the RT-LAMP reaction product of template with PRRSV variant JXA1-R pnca gene group; Swimming lane 3 is to be the RT-LAMP reaction product of template with the CSFV genome; Swimming lane 4 is to be the RT-LAMP reaction product of template with the JEV genome; Swimming lane 5 is to be the LAMP reaction product of template with the PCV-2 genome; Swimming lane 6 is to be the LAMP reaction product of template with the PRV genome; Swimming lane 7 is to be the LAMP reaction product of template with the PPV genome; 8 negative contrasts.
Fig. 4 is the sensitivity detected result figure of RT-LAMP and RT-PCR, wherein:
A is the figure as a result that the fluorexon method detects RT-LAMP product provided by the invention under the ultraviolet condition;
B is that the product that utilizes RT-LAMP nucleic acid test strip test kit provided by the invention to obtain carries out the figure as a result that agarose gel electrophoresis obtains;
C is that the product that utilizes the RT-PCR method to obtain carries out the figure that agarose gel electrophoresis obtains; Be among the figure: 1 template is carried out 10 times of dilutions for PRRSV1ng RNA; 2 template carries out 10 for PRRSV1ng RNA
2Doubly dilution; 3 template carries out 10 for PRRSV1ng RNA
3Doubly dilution; 4 template carries out 10 for PRRSV1ng RNA
4Doubly dilution; 5 template carries out 10 for PRRSV1ng RNA
5Doubly dilution; 6 negative contrasts.
Embodiment
The present invention is described in further detail below in conjunction with embodiment and accompanying drawing, but embodiments of the present invention are not limited thereto.
Primer used in following examples is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; The big fragment of BstDNA polysaccharase is available from New England company; Trimethyl-glycine (Betaine) and MgSO
4Available from Sigma company; Trizol, AMV ThermoScript II, RNA enzyme inhibitors, random primer, Ex-Taq archaeal dna polymerase, dNTP(2.5mM), agarose is available from Takara company; Full closed target nucleic amplifier fast testing device is available from Yousida Biological Technology Co., Ltd., Hangzhou's (article No.: 20120420-32).
One, design of primers
According to LAMP design of primers principle, at PRRSV ORF6 gene conservative regional sequence, according to LAMP primer design principle, use online primer-design software PrimerExporer4.0 design primer three covers, as shown in table 1 (at this moment, LoopF and LoopB do not carry out Biotin and FITC mark), primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, and-20 ℃ keep in Dark Place.This three covers primer is carried out respectively after temperature of reaction optimizes, under peak optimization reaction temperature separately, carry out the optimization in reaction times, and the reaction times optimum result of three cover primers are compared, reaction system is as shown in table 2, and primer uses and respectively to overlap primer corresponding in the primer.The peak optimization reaction temperature of the first cover primer is 61 ℃, and reaction 40min product amount can reach the highest.The peak optimization reaction temperature of the second cover primer is 63 ℃, and the reaction times is that 80min just has product to form.The peak optimization reaction temperature of the 3rd cover primer is 62 ℃, reacts for 90min just has product to form.By screening, obtain the first the shortest cover primer (as shown in table 1) of reaction times, comprise 1 pair of outside primer (F3 and B3), 1 pair of inner primer (FIP and BIP) and 1 pair of ring primer (LoopF and LoopB).FIP is by the complementary sequence of F1c(F1) and the F2 sequence form; BIP is by the complementary sequence of B1c and B2(B2c) form.Respectively 5 ' end of the FIP primer in the first cover primer and LoopF primer is carried out the Biotin(vitamin H by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) mark, respectively 5 ' of BIP primer and LoopB primer held again and carried out the FITC(fluorescein isothiocyanate) mark.FIP and BIP primer mark group and LoopF and LoopB primer mark group are carried out the blank sample test of RT-LAMP respectively, and product detects with the nucleic acid test strip.Found that the blank sample nucleic acid test strip tests positive of FIP and BIP primer mark group, and the blank sample of LoopF and LoopB primer mark group is negative, so select for use 5 ' end of LoopF and LoopB primer to carry out the Biotin(vitamin H respectively) and the FITC(fluorescein isothiocyanate) be labeled as optimum mark mode (as shown in table 1).
Table 1
Below the first cover primer design is described in detail that (following sequence is PRRSV ORF6 Gene Partial sequence, and Genbank number: FJ231467.1): the position of F3 sequence is as follows, and B3 is the complementary sequence of B3c; FIP is by the complementary sequence of F1c(F1) and the F2 sequence form; BIP is by the complementary sequence of B1c and B2(B2c) form; LoopF is the complementary sequence of F4, and LoopB is identical with the B4c sequence.
ATGGGGTCGTCTCTAGACGACTTCTGCAATG
AGGTGCTTTTGGCGTTTTCCA
TGATATATGC
ACCTTTTGATCTTTCTGAATTGTGCTTT
GTGC
CGCGCTCACTATGG
TGG
AACCTGGAAATTCATCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTCGAAAGTGCCGCGGGCTTTCATCCGATTGCGGCAAATGATAACCACGCGTTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTGAAAAGCCTCGTGTTGGGTGGCAGAAAAGCTGTTAAGCAAGGAGTGGTAAACCTTGTTAAATATGCCAAATAA。
Two, RT-LAMP reaction (the first cover primer carries out following test in the use table 1)
1, the extracting of viral RNA:
Get this laboratory preservation porcine reproductive and respiratory syndrome virus GD08-2 strain (pig breeding and breathing syndrome virus strain isolated ORF5 and Nsp2 Gene Sequence Analysis. Agricultural University Of South China's journal, 2010,31 (2): 108-112).Use Trizol Reagent extracting RNA, carry out extracting according to following steps:
(1) 250 μ L liquid samples is added in the 1.5mL centrifuge tube, add the RNAiso Reagent(TaKaRa of 750 μ L ice precooling again);
(2) with behind the violent mixing of sample, leave standstill 5min in room temperature;
(3) add 250 μ L chloroforms, thermal agitation 10s, make the abundant mixing of liquid be milky white shape (no noted phase separation phenomena) after, room temperature leaves standstill 5min again;
(4) under 4 ℃ of conditions, with the centrifugal 15min of 12000r/min;
(5) with in upper water phase transition to the new centrifuge tube, add isopyknic Virahol, the mixing that turns upside down leaves standstill 10～15min then under 4 ℃ of conditions;
(6) under 4 ℃ of conditions, with the centrifugal 15min of 12000r/min, the careful supernatant that also removes as far as possible;
(7) with ethanolic soln washing RNA precipitation and the tube wall of 1mL volume percent 75%, under 4 ℃ of conditions, with the centrifugal 8min of 12000r/min, carefully discard ethanol then;
(8) RNA precipitation is carried out with 10 μ L RNase-free water RNA is dissolved after drying (can not complete drying) handles, add 0.5 μ LRNA enzyme inhibitors (TaKaRa company) (40U), store for future use in-80 ℃ of refrigerators.
2, the foundation of RT-LAMP detection architecture:
With reference to (Notomi such as Notomi, T., Okayama, H., Masubuchi, H., et al.Loop-mediated isothermal amplification of DNA[J] .Nucleic Acids Res, 2000, the method that 28:E63) provides makes up 25 μ L RT-LAMP reaction systems, successively to dNTP, Betaine, MgSO
4, inner and outer ring primer concentration ratio is optimized, the result who obtains carries out sepharose (mass volume ratio 2%) electrophoresis detection.
By dNTP:0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, the 0.6mM that different final concentrations are set, the consumption of other compositions (result is shown in Figure 1A) as shown in table 2; Betaine:0M, 0.5M, 1.0M, the 1.5M of different final concentrations, the consumption of other compositions (result is as shown in Figure 1B) as shown in table 2; The MgSO of different final concentrations
4: 0mM, 0.5mM, 1mM, 2mM, 3mM, 4mM, 5mM, 6mM, the consumption of other compositions (result is shown in Fig. 1 C) as shown in table 2; (inner primer is BIP+FIP to the inside and outside primer concentration ratio of different final concentrations, outer primer is B3+F3) and outer primer concentration: 2:1,4:1,6:1,8:1,10:1,3:1,6:1,8:1, this moment, concrete primer concentration ratio was: 0.4 μ M:0.2 μ M, 0.8 μ M:0.2 μ M, 1.2 μ M:0.2 μ M, 1.6 μ M:0.2 μ M, 2.0 μ M:0.2 μ M, 1.2 μ M:0.4 μ M, 2.4 μ M:0.4 μ M, 3.2 μ M:0.4 μ M, the consumption of other compositions (result is shown in Fig. 1 D) as shown in table 2.Different final concentration ring primers (the ring primer is LoopF+LoopB) and outer primer concentration ratio: 1:1,2:1,3:1,4:1,5:1,6:1,0:1, this moment, concrete primer concentration ratio was: 0.2 μ M:0.2 μ M, 0.4 μ M:0.2 μ M, 0.6 μ M:0.2 μ M, 0.8 μ M:0.2 μ M, 1.0 μ M:0.2 μ M, 0 μ M:0.2 μ M, the consumption of other compositions (result is shown in Fig. 1 E) as shown in table 2.Testing conditions is 61 ℃ of constant temperature 40min.According to the experimental result of gained, final definite detection architecture of optimizing (25 μ L) is as shown in table 2.
The detection architecture that table 2 is optimized
3, the optimization of RT-LAMP testing conditions
In order to obtain optimized temperature of reaction, the LAMP reaction is placed 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃, 66 ℃ respectively, the reaction times is 60min, reaction system is as shown in table 2.From repeatedly determining optimal reaction temperature the revision test, detect by mass volume ratio 2% agarose gel electrophoresis, the result illustrates that optimal reaction temperature is 61 ℃ shown in Fig. 2 A.
With optimal reaction temperature (61 ℃), to increase progressively by 10min, 20min, 30min, 40min, 50min, 60min in the reaction times, reaction system is as shown in table 2, from repeatedly determining optimum reacting time (result is shown in Fig. 2 B) the revision test, the presentation of results optimum reacting time of Fig. 2 B is 40min.Testing conditions after the optimization is 61 ℃ of constant temperature 40min.
4, detection architecture specificity, sensitivity analysis
Use high-pathogenicity porcine reproductive and respiration syndrome living vaccine JXA1-R strain (high-pathogenicity porcine reproductive and respiration syndrome living vaccine, Guangdong Dahuanong Animal Healthcare Product Ltd), porcine reproductive and respiratory syndrome virus GD08-2 strain (pig breeding and breathing syndrome virus strain isolated ORF5 and Nsp2 Gene Sequence Analysis. Agricultural University Of South China's journal, 2010,31 (2): 108-112), Pestivirus suis (CSFV) GXW-07(swine fever virus infection is to the influence of pig T lymphocyte subsets and TNF-α and IFN-γ. Chinese Preventive Veterinary Medicine newspaper, 2011,33(2): 126-129), Bioisystech Co., Ltd before the section of Japanese B encephalitis virus (JEV) vaccine strain SA14-14-2(Wuhan), porcine circovirus 2 type (PCV-2) (porcine circovirus 2 type oil emulsion inactivated vaccine, the sharp bio tech ltd in sea, Shanghai), Pseudorabies virus (PRV) (pseudoabies virus live vaccine, the sharp bio tech ltd in sea, Shanghai), pig parvoviral (PPV) (Inactive Oil-emulsion Porcine Parvovirus Vaccine, the sharp bio tech ltd in sea, Shanghai) genome is the specificity of template detection system, substitutes the nucleic acid-templated negative control that arranges with water simultaneously.Reaction system is as shown in table 2, and reaction conditions is the optimal conditions that step 3 is determined, uses full closed target nucleic amplifier fast testing device and concentration as the agarose gel electrophoresis of mass volume ratio 2% product to be detected.Use full closed target nucleic amplifier fast testing device to detect (seeing the result behind the 10min), the result who obtains is: with the classical strain of PRRSV GD08-2() genome be the RT-LAMP reaction product of template and with PRRSV JXA1-R(variant) genome is the RT-LAMP reaction product of template, two red stripes appear, article one, be positioned at detection zone (T), another is positioned at Quality Control district (C); Be respectively template with CSFV genome, JEV genome, PCV-2 genome, PRV genome, PPV genome and water and obtain the RT-LAMP reaction product, only a red stripes occurs at Quality Control district (C), the redfree band occurs in detection zone (T).Use the detected result (Fig. 3) of agarose gel electrophoresis (taking 40min) as follows: only as the RT-LAMP reaction product of template the goal gene band to be arranged as the RT-LAMP reaction product of template with the classical strain GD08-2 of PRRSV genome with highly pathogenic PRRSV vaccine strain genome.The result shows that the specificity of detection architecture is good, can detect porcine reproductive and respiratory syndrome virus specifically, and detects with the detection of nucleic acids test strip, more convenient operation, saves time.
From 250 μ L porcine reproductive respiratory syndromes virus GD08-2 strain, extract virus total RNA, measure its rna content (100ng/ μ L) at ultraviolet spectrophotometer, and the standard substance of preparation 1ng/ μ L.The RNA standard substance are carried out 10 times of gradient dilutions, and it is as shown in table 2 that the sample after the dilution is carried out the RT-LAMP(reaction system respectively, except template changes; Reaction conditions is the optimal conditions that step 3 is determined), the visual RT-LAMP(of fluorexon method adds fluorexon (Calcein) and MnCl again in the reaction system of table 2
2, final concentration separately is respectively 25 μ mol/L and 0.5mmol/L, and template changes; Reaction conditions is the optimal conditions that step 3 is determined).The employed primer of RT-PCR is
P1：5′-GAGTTTCAGCGGAACAATGG-3′；
P2：5′-GCACAAACGGCATCTGGAG-3′；
Get the RNA solution 10 μ L of 10 times of gradient dilutions, place the centrifuge tube of handling through DEPC, other composition that adds reverse transcription more successively carries out reverse transcription.Concrete reverse transcription system is as shown in table 3:
Table 3
| 5×Buffer | 4μL |
| dNTPs(10mmol/L) | 2μL |
| RNA enzyme inhibitors (40U/ μ L) | 1μL |
| Random primer (50pmol/ μ L) | 2μL |
| AMV(5U/μL) | 1μL |
| RNA solution (100ng/ μ L) | 10μL |
| Amount to | 20μL |
Use LX-100 palm type whizzer instantaneous centrifugal behind the mixing, liquid is concentrated on manage at the end, put in 42 ℃ of water-baths, reacted 1 hour.
Reverse transcription is template with this cDNA after finishing, and P1 and P2 are that primer carries out PCR, and concrete system is as shown in table 4:
Table 4
| ddH 2O | 17.25μL |
| 10×PCR?Buffer | 2.5μL |
| dNTPs(2.5mmol/L) | 2μL |
| P1(10μmol/L) | 0.5μL |
| P2(10μmol/L) | 0.5μL |
| Ex-Taq(5U/μL) | 0.25μL |
| CDNA template (100ng/ μ L) | 2μL |
| Amount to | 25μL |
The PCR program is as follows: 94 ℃ of pre-sex change 2min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 45s are a circulation, move 30 circulations, last 72 ℃ are extended 10min, 4 ℃ of preservations.
The relatively sensitivity of RT-LAMP nucleic acid test strip detection kit, the visual RT-LAMP of fluorexon method, RT-LAMP agarose gel electrophoresis, four kinds of detection methods of RT-PCR agarose gel electrophoresis.The result as shown in Figure 4, RT-LAMP nucleic acid test strip detection kit is consistent with RT-LAMP agarose gel electrophoresis detectability, but than the visual RT-LAMP of fluorexon method and RT-PCR agarose gel electrophoresis method for detecting to 10 times of the detection limits for height of PRRSV geneome RNA, the minimum PRRSVRNA that can detect 1pg.As seen, RT-LAMP nucleic acid test strip test kit provided by the invention is sensitiveer, operates simplyr, and the time spent is shorter, and the result is more directly perceived, is easy to detect, and need not electrophoresis.
4, the result of detection architecture identifies
1. negative (-): only a red stripes occurs at Quality Control district (C), the redfree band occurs in detection zone (T).The sample that proof detects does not have porcine reproductive and respiratory syndrome virus to infect;
2. positive (+): two red stripes occur.Article one, be positioned at detection zone (T), another is positioned at Quality Control district (C).The sample that proof detects is that porcine reproductive and respiratory syndrome virus infects.
3. invalid: all redfree band appearance in Quality Control district (C) and the detection zone (T) show that the nucleic acid test strip lost efficacy.
Above-described embodiment is preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
Claims (7)
1. RT-LAMP nucleic acid test strip test kit that detects porcine reproductive and respiratory syndrome virus is characterized in that comprising following primer sets and detection of nucleic acids test strip:
The nucleotide sequence of described primer sets is as follows:
F3：5’-ATAGCACAGCTCCACAGA-3’；
B3：5’-TCTATGGCTGAGTACACTCC-3’；
FIP：5’-GCAGAAGCCCTAGCAGTCGTTACCTACACGCCAGTGA-3’；
BIP：5’-TACCTTCGGGCACATGACATTCAAGAAGTGCAACTACTGCTC-3’；
LoopF：5’-Biotin-GCCGCGACTTACCTTTAGA-3’；
LoopB：5’-FITC-ACTTTGAGAGCACAAATAGGGT-3’。
2. the RT-LAMP nucleic acid test strip test kit of detection porcine reproductive and respiratory syndrome virus according to claim 1, it is characterized in that: described detection of nucleic acids test strip is the universal nucleic acid test strip.
3. the RT-LAMP nucleic acid test strip test kit of detection porcine reproductive and respiratory syndrome virus according to claim 1 is characterized in that: comprise the described primer sets of full closed target nucleic amplifier fast testing device and claim 1; Full closed target nucleic amplifier fast testing device obtains for the universal nucleic acid test strip is inserted in the palm plastics proofing unit.
4. the RT-LAMP nucleic acid test strip test kit of detection porcine reproductive and respiratory syndrome virus according to claim 1 is characterized in that: also comprise dNTP mixture solution, MgSO
4Solution, reaction buffer, strand displacement archaeal dna polymerase, alkali solution of beet and AMV reversed transcriptive enzyme.
5. the RT-LAMP nucleic acid test strip test kit of detection porcine reproductive and respiratory syndrome virus according to claim 4 is characterized in that: the strand displacement archaeal dna polymerase that is 8U/L that comprises concentration and be the AMV reversed transcriptive enzyme of 5U/ μ L, 10 times of reaction buffer, concentration, the dNTP mixture solution that concentration is 2.5mmol/L, alkali solution of beet, the concentration that concentration is 10mol/L are the MgSO of 100mmol/L
4Solution, concentration are that primers F IP, the concentration of 10 μ mol/L is that the primer BIP of 10 μ mol/L, primers F 3, concentration that concentration is 10 μ mol/L are that primer B3, the concentration of 10 μ mol/L is that primer LoopF and the concentration of 10 μ mol/L is the primer LoopB of 10 μ mol/L.
6. the application of the RT-LAMP nucleic acid test strip test kit of each described detection porcine reproductive and respiratory syndrome virus of claim 1～5 is characterized in that comprising following steps:
(1) preparation RT-LAMP reaction system is pressed final concentration and is calculated, and the AMV reversed transcriptive enzyme is 10
5U/L, 10 times of reaction buffers are that 1 times, strand displacement archaeal dna polymerase are that 0.32U/L, dNTP mixture are that 0.4～0.6mmol/L, trimethyl-glycine are 1～2mol/L, MgSO
4Be that 0～3mmol/L, FIP primer are that 1.6 μ mol/L, BIP primer are that 1.6 μ mol/L, F3 primer are that 0.2 μ mol/L, B3 primer are that 0.2 μ mol/L, LoopF primer are that 0.6 μ mol/L, LoopB primer are 0.6 μ mol/L, testing sample RNA is 12ng/ μ L; Isothermal reaction;
(2) reaction: the product after step (1) isothermal reaction is detected the 10min observations with the detection of nucleic acids test strip;
(3) interpretation as a result: directly naked eyes interpretation,
1. negative: a red stripes only occurs in the Quality Control district, the redfree band occurs in detection zone, proves that the sample that detects does not have porcine reproductive and respiratory syndrome virus to infect;
2. positive: two red stripes occur, one is positioned at detection zone, and another is positioned at the Quality Control district, proves that the sample that detects is that porcine reproductive and respiratory syndrome virus infects;
3. invalid: all redfree band appearance in Quality Control district and the detection zone show that the nucleic acid test strip lost efficacy.
7. the application of the RT-LAMP nucleic acid test strip test kit of detection porcine reproductive and respiratory syndrome virus according to claim 6 is characterized in that:
The final concentration of the dNTP mixture described in the step (1) is 0.4mmol/L;
The final concentration of the trimethyl-glycine described in the step (1) is 1mol/L;
MgSO described in the step (1)
4Final concentration be 2mmol/L;
The time of the isothermal reaction described in the step (2) is 10～40min;
The condition of the isothermal reaction described in the step (2) is 61 ℃ of reaction 40min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310154212.0A CN103276104B (en) | 2013-04-27 | 2013-04-27 | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310154212.0A CN103276104B (en) | 2013-04-27 | 2013-04-27 | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103276104A true CN103276104A (en) | 2013-09-04 |
| CN103276104B CN103276104B (en) | 2014-10-08 |
Family
ID=49058719
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310154212.0A Expired - Fee Related CN103276104B (en) | 2013-04-27 | 2013-04-27 | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103276104B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103602761A (en) * | 2013-11-29 | 2014-02-26 | 华南农业大学 | RT-LAMP nucleic acid test-strip kit for determining hog cholera virus and application |
| CN104651536A (en) * | 2015-03-04 | 2015-05-27 | 广西壮族自治区兽医研究所 | Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof |
| CN104862418A (en) * | 2015-05-29 | 2015-08-26 | 中国农业科学院兰州兽医研究所 | Specific primers for detecting European-type porcine reproductive and respiratory syndrome viruses and corresponding detection kit |
| CN113846092A (en) * | 2020-08-06 | 2021-12-28 | 中国农业科学院深圳农业基因组研究所 | Special primer combination and detection kit for simply determining PRRSV (porcine reproductive and respiratory syndrome virus) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1811447A (en) * | 2006-02-08 | 2006-08-02 | 杭州优思达生物技术有限公司 | Nucleic acid membrane chromatographic fast detecting method and its test paper bar and use thereof |
-
2013
- 2013-04-27 CN CN201310154212.0A patent/CN103276104B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1811447A (en) * | 2006-02-08 | 2006-08-02 | 杭州优思达生物技术有限公司 | Nucleic acid membrane chromatographic fast detecting method and its test paper bar and use thereof |
Non-Patent Citations (4)
| Title |
|---|
| CHEN QIN, ET.AL.,: ""Rapid Detection of Porcine Reproductive and Respiratory Syndrome Virus by Reverse Transcription Loop-Mediated Isothermal Amplification "", 《INTERVIROLOGY》 * |
| 蔡宝祥: "我国高致病性猪繁殖与呼吸综合征研究进展", 《畜牧与兽医》 * |
| 谷元兴等: "反向遗传技术在猪繁殖与呼吸综合征研究中的应用", 《中国农学通报》 * |
| 魏衍全等: "猪繁殖与呼吸综合征检测技术研究进展", 《中国生物工程杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103602761A (en) * | 2013-11-29 | 2014-02-26 | 华南农业大学 | RT-LAMP nucleic acid test-strip kit for determining hog cholera virus and application |
| CN103602761B (en) * | 2013-11-29 | 2015-11-04 | 华南农业大学 | Detect RT-LAMP nucleic acid test-strip kit and the application of Pestivirus suis |
| CN104651536A (en) * | 2015-03-04 | 2015-05-27 | 广西壮族自治区兽医研究所 | Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof |
| CN104862418A (en) * | 2015-05-29 | 2015-08-26 | 中国农业科学院兰州兽医研究所 | Specific primers for detecting European-type porcine reproductive and respiratory syndrome viruses and corresponding detection kit |
| CN113846092A (en) * | 2020-08-06 | 2021-12-28 | 中国农业科学院深圳农业基因组研究所 | Special primer combination and detection kit for simply determining PRRSV (porcine reproductive and respiratory syndrome virus) |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103276104B (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Belák | Molecular diagnosis of viral diseases, present trends and future aspects: A view from the OIE Collaborating Centre for the Application of Polymerase Chain Reaction Methods for Diagnosis of Viral Diseases in Veterinary Medicine | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN103276103B (en) | Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit | |
| CN103160615A (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| CN102399909B (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of kit | |
| CN105018628B (en) | Differentiate the kit of brucella A19 vaccine strains and street strain | |
| Shen et al. | Development of a loop-mediated isothermal amplification method for the rapid detection of Pythium ultimum | |
| CN105755124A (en) | Method for detecting salmonella with fluorescence method on basis of enzymatic remediation isothermal cycle amplification | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN103276104B (en) | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications | |
| CN103276061B (en) | Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof | |
| CN106435033A (en) | Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit | |
| CN103602761A (en) | RT-LAMP nucleic acid test-strip kit for determining hog cholera virus and application | |
| CN101775443B (en) | LAMP kit for detecting PRV and preparation method thereof | |
| CN102925548B (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| Postel et al. | Development of a new LAMP assay for the detection of CSFV strains from Cuba: a proof-of-concept study | |
| CN103333903A (en) | Target sequence, primer and probe for detecting helicobacter pylori and kit thereof | |
| CN101144108B (en) | Primer and probe sequence for detecting high pathogenicity porcine reproductive and respiratory syndrome virus nucleic acid fragment | |
| CN107699635A (en) | Porcine epidemic diarrhea virus fluorescence RPA detection methods | |
| CN107419034A (en) | Five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and its application | |
| CN103509880A (en) | LAMP detection kit of highly-pathogenic porcine reproductive and respiratory syndrome viruses | |
| CN108384893A (en) | Real-time fluorescence quantitative RT-PCR kit for detecting foot and mouth disease virus and Sai Nika paddy viruses and its application | |
| JP5835702B2 (en) | Detection method and detection kit for cryptococcosis-causing bacteria | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| Rathogwa et al. | Development of a real time polymerase chain reaction assay for equine encephalosis virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20200427 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |