CN107419034A - Five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and its application - Google Patents
Five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and its application Download PDFInfo
- Publication number
- CN107419034A CN107419034A CN201710534310.5A CN201710534310A CN107419034A CN 107419034 A CN107419034 A CN 107419034A CN 201710534310 A CN201710534310 A CN 201710534310A CN 107419034 A CN107419034 A CN 107419034A
- Authority
- CN
- China
- Prior art keywords
- pcr
- diarrhea virus
- pcv2
- gcr
- pedv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses five boar diarrhea virus multiplex PCR quick diagnosis reagent kits, including 5 pairs of PCR primers, in addition to PCR reaction solutions, PCR standard items, positive reference substance, negative controls.The present invention further simultaneously discloses application of the mentioned reagent box at the same time in the boar diarrhea virus infection of specific detection five, and this five boars diarrhea virus is TGEV, GAR, GCR, PEDV and PCV2.
Description
Technical field
The invention belongs to viral nucleic acid detection field, and in particular to a kind of five boar diarrhea virus multiplex PCR quick diagnosis
Kit, Porcine epidemic diarrhea virus (Porcine epidemic diarrhea can be detected simultaneously in same reaction tube
Virus, PEDV), transmissible gastro-enteritis virus (Transmissible gastroenteritis virus, TGEV), pig wheel
Shape virus type A (Porcine group A rotaviruses, GAR), porcine rotavirus c-type (Porcine group C
Rotaviruses, GCR), porcine circovirus 2 type (Porcine circovirus 2, PCV2) five boars virus, suitable for facing
To the quick detection of five boars virus in bed and scientific research.
Background technology
In recent years, as pig industry develops to scale and intensive direction, swinery occur more cause of disease mixed infections and after
The situation for sending out infection is more and more common.Infect Porcine epidemic diarrhea virus (PEDV), transmissible gastro-enteritis virus (TGEV), pig
Rotavirus A types (GAR), porcine rotavirus c-type (GCR), porcine circovirus 2 type (PCV2) this several disease are clinically presented
Go out similar symptom of diarrhea, and they are in usually mixed infection, and also above-mentioned disease makes to Other diseases as breathed
Diagnosis with breeding difficulty becomes complicated and difficult, and the death rate is very high, and heavy losses are caused to pig industry.
Pig epidemic diarrhea (Porcine epidemic diarrhea, PED) is by Porcine epidemic diarrhea virus
(Porcine epidemic diarrhea virus, PEDV) causes a kind of to vomit, suffer from diarrhoea and be dehydrated as principal character of pig
Enteric infectious disease.For the disease based on piglet morbidity within 7 ages in days, the course of disease is short, propagation is rapid, the piglet death rate is high, reachable
100%.1978, Belgium and Britain reported PEDV epidemic situations first, and 1984, China confirmed the sick presence.In 2010-
There is the report that PEDV breaks out greatly deifferent regions.China in 2012, causes suckling pig mortality, has had a strong impact on that China is supported
The sound development of pig industry.
Transmissible gastro-enteritis virus (TGEV) category coronaviridae, coronavirus genus, genome be single-stranded positive regardless of
The RNA of section, total length 28.5kb.Small intestine is caused to damage, produces digestion and malabsorption, diarrhoea and dehydration is ultimately resulted in, draws
Rise suckling pig it is dead (Tuboly et al., 2000；Nan Wenjin and Lous are brilliant, and 2010).The viral infection rate is high, caused by
Piglet death rate height (Wang Li etc., 2015).
Rotavirus (RV) belongs to Reoviridae family, no coating, and genome is the double-stranded RNA of 11 segmentations of one
(Estes and Cohen,1989).RV is caused including the mankind and an important factor for other animal diarrheas, at present colyliform disease
Poison is divided into 8 kinds with VP6 genes, and wherein A, B, C, E and H (GAR, GBR, GCR, GER and GHR) has been detected on pig
(Matthijnssens et al.,2012；Saif et al.,1980；Wakuda et al.,2011).GAR was in head in 1975
Secondary report, it is considered as a main pathogen (Amimo the et al., 2013a of diarrhea of pigs always；Ciarlet et al.,
2002；Ciarlet et al.,1995；Miyazaki et al.,2011,2012).GCR was detected first in 1979,
It is difficult to carry out cell culture (Amimo et al., 2013b；Marthaler et al.,2013；Saif et al.,1988；
Saif et al.,1996；Tsunemitsu et al.,1991).GCR can cause Severe gastrointestinal to infect and easily cause sporadic
Propagate or great outburst (Bohl et al., 1982；Collins et al.,2008；Saif et al.,1980).General GAR quilts
It is considered to cause the first because and GBR, GCR effect are less big of diarrhea of pigs.Douglas marthaler etc. apply RT-PCR
The research of 7508 parts of diarrhea of pigs samples of detection finds that GAR positive rate is also very high (53%) for 62%, GCR infection rates, and GCR is main
Infect 1-20 days piglets, more than 21 days piglets of GAR main infections.Think detect GAR, GCR (Marthaler et simultaneously
al.,2014)。
Porcine circovirus 2 type (PCV2) category PCV-II section Circovirus, newly report swine disease is malicious in recent years, and being can be in lactation
Zooblast autonomous replication minimum single stranded circle DNA virus, includes 4 ORFs (ORF)：ORF1-4(Murphy,
1995).One of porcine circovirus associated diseases (PCVAD) symptom is to trigger enteritis.PCV2 can be by individually infecting or mixing
Infection trigger enteritis (Kim et al., 2004；Zhang et al.,2013).PCV2 has very strong appeal to pig, and each age is all
It can infect, and the immune system for encroaching on pig produces immunosupress and other pathogenic microorganism scabies secondary infections.
Conventional aetology and Serologic detection is difficult by these above-mentioned diseases while is distinguished by identifying, while is existed again
It is cumbersome, waste time and energy, the defect, especially a variety of pathogen infections such as susceptibility is low when, it is difficult to effectively carry out early detection, hold
It is also easy to produce erroneous judgement misjudgement.And multiple PCR technique once can detect multiple pathogens simultaneously, and there is high specific and sensitivity
Property, the advantage such as detection time is short, testing cost is low, are a kind of ideal detection methods.Therefore, develop a kind of while special
The multiplex PCR quick diagnosis reagent kit of the different a variety of diarrhea of pigs virus infection of detection, helps to lift diarrhea of pigs Viral diagnosis level,
There is important application prospect in medical diagnosis on disease and preventing and treating and food security etc..
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and
It is applied.
In order to solve the above-mentioned technical problem, the present invention provides a kind of five boar diarrhea virus multiplex PCR fast diagnosis reagents
Box：
Including following 5 pairs of PCR primers (for five kinds of virus specific primers)：
TGEV-F：GTGGTGTTAGGTGATTATTTTCC,
TGEV-R：TATGGTTTAACCTGCACTCACTA；
GAR-F：TATGCAATACCAGTAGGACCAG,
GAR-R：GCTCTACGTAGCGAGTATGAAATC；
PEDV-F：AACACGGCGACTACTCAGC,
PEDV-R：GCCTTCTTTAGCAACCCAG；
GCR-F：TGTTGCATCCGTGAAGAGAATGGT；
GCR-R：GCATTAGCCCCTACGCAAGC；；
PCV2-F：AAGAAGCGGACCCCAAC,
PCV2-R：AGGTGGCCCCACAATGA.
Improvement as the five boar diarrhea virus multiplex PCR quick diagnosis reagent kits of the present invention：
The kit includes：A) multi-PRC reaction liquid, b) primer (virus specific primers), c) positive reference substance, d)
Negative controls and e) PCR standard items；
A), the PCR reaction solutions (that is, multi-PRC reaction mixed liquor) include PCR reaction buffers and heat-resistant dna polymerize
Enzyme；The PCR reaction buffers include buffer solution, magnesium chloride and triphosphate deoxyribose nucleotide mixture；
B), the primer is five kinds of virus specific primers；
C), the positive reference substance is：Containing five kinds of viral positive plasmid melanges of TGEV, GAR, GCR, PEDV and PCV2
(every kind of virus concentration is about 300ng/ μ l)；
D), the negative controls are：Pyrocarbonic acid diethyl ester processing water (DEPC-H after sterilizing2O)；
E), the PCR standard items by following 5 kinds of standard item groups into：PEDV standard items, TGEV standard items, GAR standard items,
GCR standard items, PCV2 standard items.
Remarks explanation：
Above-mentioned 5 kinds of Virus Standard product sequence such as SEQ ID NO:11~SEQ ID NO:Described in 15.
Further improvement as the five boar virus multiple PCR quick diagnosis reagent kits of the present invention：
The same tube packaging of upstream and downstream primer of five kinds of viral specific primers.
The diagnostic kit of the present invention, it can be used to detect Porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis of swine disease
Malicious (TGEV), porcine rotavirus A types (GAR), porcine rotavirus c-type (GCR), porcine circovirus 2 type (PCV2).
Quick diagnosis reagent kit provided by the invention, it is kept in dark place in -20 DEG C, reduces multigelation as far as possible.
Designed multiple PCR primer in table 1, the present invention
The application method of kit of the present invention specifically can be as follows：
Detection sets up negative control and positive control according to particular condition in use every time；
Standard items are diluted to 1.0 × 10 with aseptic double-distilled water1~1.0 × 108Copies/μl。
RNA/DNA viral samples are extracted：According to products instruction, with viral RNA/DNA extraction agent boxes
MiniBEST Viral RNA/DNA Extraction Kit Ver.4.0 (TAKARA) from cell line, it is fresh or freezing sample
This extraction viral nucleic acid.
Reverse transcription reaction：Total serum IgE/DNA moulds of previous step preparation are sequentially added in the 0.2ml PCR pipes without RNase
The μ l of plate 1, RT-PCR reactions are carried out using TaKaRa RNA PCR Kit (AMV) Ver.3.0 (Code No.RR019A), wherein 10
× RT PCR Buffer 1 μ l, 25mM MgCl2μ l, the 40U/ μ l RNase of 2 μ l, 10mM dNTP Mixture 1
μ l, the RNase Free dH of 0.25 0.5 9 mers of μ l, Random of μ l, 5U/ μ l AMV RTase XL of Inhibitor 0.52O
It is 10 μ l to cumulative volume, after record reaction to be reversed terminates, gained reaction solution is cDNA/DNA templates.
The detection of nucleic acid：CDNA/DNA prepared by 1 μ l is taken to carry out multiple fluorescence PCR reaction, wherein multiplex PCR for template
The μ l of reaction solution 19, primer mixture 1 μ l, ddH2O 4μl；Response procedures are first 95 DEG C of denaturation 3min；The reaction bar of 40 circulations
Part is 95 DEG C of denaturation 20s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；Last 72 DEG C of 5min.PCR primer with 2% Ago-Gel
Electrophoresis is detected, and post analysis are imaged through gel imager.
As a result report：According to the presence or absence of TGEV, GAR, GCR, PEDV and PCV2 gene target fragment, to whether having this five kinds
Diarrhea of pigs virus is identified.
Advantages of the present invention：With multiple PCR technique, five kinds of viral spies of TGEV, GAR, GCR, PEDV and PCV2 are designed
Specific primer, the boar diarrhea virus multiplex PCR quick diagnosis reagent kit of one kind five developed can by a PCR reaction
To detect that TGEV, GAR, GCR, PEDV and PCV2 be single or hybrid infection viruses simultaneously from sample, specificity is high, than tradition
Regular-PCR method is easier, time saving and cost is lower.Kit provided by the invention can distinguish diarrhea of pigs virus infection, be
The detection of the viral infection of diarrhea of pigs provides fast and convenient instrument, so as to realize clinical early diagnosis and formulate treatment side in time
Case, reduce the swinery death rate and economic loss.
Brief description of the drawings
The embodiment of the present invention is described in further detail below in conjunction with the accompanying drawings.
The boar diarrhea viruses of Fig. 1 five correspond to the specific detection of primer.Swimming lane is followed successively by from left to right：M:DL2000 DNA
Marker；1:GCR；2:GAR；3:TGEV；4:PEDV；5:PCV2；6:GCR, GAR, TGEV, PEDV and PCV2；7:GCR and
TGEV；8:GAR and PEDV；9:TGEV and PCV2；10:GCR and PCV2；11:GCR, GAR and TGEV；12：TGEV, PEDV and
PCV2；13:GCR, TGEV and PCV2；14:GCR, TGEV, PEDV and PCV2；15：GAR, TGEV, PEDV and PCV2；16：It is negative
Control；17:Non-target template.
Fig. 2 present invention detects to the sensitivity of five boar diarrhea viruses.Swimming lane 1-9 is followed successively by from left to right：1:5×105；
2:5×104；3:5×103；4:5×102；5:5×101；6:5×100；7:5×10-1；8:5×10-2Copies/ μ L standard items
Mixture；9:Negative control.
Embodiment
The invention will be further described with specific embodiment below in conjunction with the accompanying drawings, but protection scope of the present invention and not only
It is limited to this.
Embodiment 1, reagent cartridge configuration
A kind of five boar virus multiple real-time fluorescence quantitative PCR quick diagnosis reagent kits, by multi-PRC reaction mixed liquor,
Viral primer, TGEV Virus Standards product, GAR Virus Standards product, GCR Virus Standards product, PEDV viruses, PCV2 Virus Standards product,
Positive reference substance, negative controls and box body composition.
Cell therefor hole is provided with box body, for place respectively quantitative PCR reaction liquid pipe, five kinds of viral primer pipes,
TGEV Virus Standards QC, GAR Virus Standards QC, GCR Virus Standards QC, PEDV Virus Standards QC, PCV2 virus marks
Quasi- QC, positive control QC and negative control QC.
Wherein multi-PRC reaction mixed liquor includes PCR reaction buffers (magnesium chloride containing and triphosphate deoxyribose nucleotide
Mixture etc.) and hot resistant DNA polymerase；Viral primer is that five kinds of viral primer upstream and downstream primers fill with pipe；Positive reference substance is
Positive plasmid melange viral five kinds of TGEV, GAR, GCR, PEDV and PCV2 (every kind of virus concentration is about 300ng/ μ l)；It is cloudy
Property reference substance handle water (DEPC-H for pyrocarbonic acid diethyl ester after sterilizing2O)。
Embodiment 2, the present invention detect five kinds of virus-specific experiments
The first step：Primer synthesizes
By 5 kinds of viral primer sequences (being shown in Table 1) designed by the present invention by the technological service of Chinese Shanghai Sheng Gong biotech firms
Company's synthetic primer, synthetic quantity are per primer 3OD.
Second step：Multiplex PCR system specific detection
According to multi-PRC reaction system, 17 parts of identical PCR reaction premixed liquids (that is, μ of multi-PRC reaction mixed liquor 19 are taken
L and 5 kinds of viral μ l of primer mixture 1), it is separately added into 1 μ L positive cDNA/DNA templates 1:GCR；2:GAR；3:TGEV；4:
PEDV；5:PCV2；6:GCR, GAR, TGEV, PEDV and PCV2；7:GCR and TGEV；8:GAR and PEDV；9:TGEV and PCV2；
10:GCR and PCV2；11:GCR, GAR and TGEV；12：TGEV, PEDV and PCV2；13:GCR, TGEV and PCV2；14:GCR、
TGEV, PEDV and PCV2；15：GAR, TGEV, PEDV and PCV2；16：Deionized water negative control；17:Non-target template, adds
ddH2O to reaction system cumulative volume be 25 μ L.Reaction is carried out in Bio-Rad S1000 PCR amplification instruments, and response parameter is：First 95
DEG C denaturation 3min；The reaction condition of 40 circulations is 95 DEG C of denaturation 20s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；Last 72 DEG C
5min.Take 5 μ L PCR primers, with 1 μ L Loading Buffer mix after, point sample in 2% agarose gel electrophoresis plate hole,
120V voltages, electrophoresis 30min, judgement of being taken pictures under Ultraluminescence Cheng Xiangyi, as a result referring to Fig. 1, corresponding PCR primer size and table
GCR, GAR, TGEV, PEDV and PCV2 are respectively 126bp, 242bp, 319bp, 394bp and 508bp completely the same in 1, it is seen that this
The diarrhea of pigs virus multiple PCR reaction systems specificity built in invention is preferably.
Embodiment 3, the present invention detect five kinds of viral susceptibility experiments
The first step：Primer synthesizes
With the first step in embodiment 2.
Second step：Sensitivity Detection
Multiplex PCR sensitivity Detection system is as follows：19 μ L PCR reaction solutions (multi-PRC reaction mixed liquor), 10 μM
The μ L of TGEV, GAR, GCR, PEDV and PCV2 upstream and downstream primer mixed liquor 1, TGEV, GAR that 1 μ L 10 are serially diluted again, GCR,
PEDV and PCV2 plasmid standards (5.0 × 108~5.0 × 101Copies/ μ L) template, add ddH2O is to reaction system cumulative volume
For 25 μ L；Reaction is carried out in Bio-Rad S1000 PCR amplification instruments, and response parameter is 95 DEG C of denaturation 3min；The 95 of 40 circulations
DEG C denaturation 20s, 55 DEG C annealing 30s, 72 DEG C extension 30s；Last 72 DEG C of 5min.5 μ L PCR primers are taken, with 1 μ L Loading
After Buffer is mixed, the detection of 2% agarose electrophoresis.
Conventional substance PCR sensitivity Detection reaction systems：10 × PCR buffer 2.5 μ L, 25mM MgCl22.5 μ L,
2.5m Μ dNTP 2 μ L, Taq DNA Polymerase (Shanghai life work) 1.25U, every kind of diarrhea virus described in table 1 draw
Thing, upstream and downstream primer final concentration are 0.2 μM, 10 times of every kind of virus particle standard items (5.0 × 10 being serially diluted8~5.0 ×
101Copies/ μ L) template, add ddH2O to reaction system cumulative volume be 25 μ L；Reaction is in Bio-Rad S1000 PCR amplification instruments
Carry out, amplified reaction parameter is：95℃5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, 40 circulations, 72 DEG C of 10min.Take 5 μ L
Amplified production carries out 1% agarose electrophoresis detection.
Result of the test shows that multi-PRC reaction is to five kinds of viral limits of identification of GCR, GAR, TGEV, PEDV and PCV2
It is 50copies, as a result referring to Fig. 2.And substance PCR reactions GCR limit of identification is 5 × 102Copies, GAR be 5 ×
103Copies, TGEV are 5 × 102Copies, PEDV are 5 × 102Copies, PCV2 are 5 × 102copies。
The high sensitivity of multiplex PCR detection diarrhea virus of the present invention is in substance PCR 10-100 times, Er Qiexian as can be seen here
Write four kinds of diarrhea virus multiplex PCRs inspection higher than the report such as Zhao (2013, Journal of Virological Methods)
Surveying sensitivity, (GAR is 1.26 × 104Copies, TGEV are 1.74 × 104Copies, PEDV are 2.1 × 103Copies, PCV2
For 2.17 × 103Copies), it is high about 250-40 times.
Embodiment 4, the experiment of the boar diarrhea virus of clinical detection of the present invention five
The first step：Primer synthesizes
With the first step in embodiment 2.
Second step：Sample collection
Serum sample amounts to 78 parts, wherein gathering 53 parts of excrement in Zhejiang area, organizes 25 parts of pathological material of disease.
3rd step：STb gene/RNA is extracted in a small amount
According to products instruction, with viral RNA/DNA extraction agent box MiniBEST Viral RNA/DNA
Viral nucleic acid is extracted in the sample that Extraction Kit Ver.4.0 (TAKARA) gather from fresh or freezing second step.
4th step：Reverse transcription synthesizes cDNA/DNA：
Reverse transcription reaction：Total serum IgE/DNA moulds of previous step preparation are sequentially added in the 0.2ml PCR pipes without RNase
The μ l of plate 2, according to TaKaRa One Step RNA PCR Kit (AMV) (Code No.RR024A) operational manual, carry out
RT-PCR reacts, and after record reaction to be reversed terminates, gained reaction solution is cDNA/DNA templates.
5th step：Regular-PCR detects and multiplex PCR
1st, regular-PCR detects：PCR reaction systems (μ l of total reaction volume 25)：10 × PCR buffer 2.5 μ l, 25mM
MgCl2μ l, Taq the archaeal dna polymerase 1.25U of 2.5 μ l, 2.5m Μ dNTP 2, final concentration is to be synthesized in 0.2 μM of the first step
Five kinds of viral primers, to synthesize cDNA/DNA (about 100ng) in the 4th step as template, add ddH2O is to reaction system cumulative volume
25μL.Reaction is carried out in Bio-Rad S1000 PCR amplification instruments, and response parameter is：95℃3min；94 DEG C of 30s, 55 DEG C of 30s, 72
DEG C 30s, 40 circulations, 72 DEG C of 10min.5 μ L amplified productions are taken to carry out 1% agarose electrophoresis detection.
2nd, multiplex PCR detection architecture is as follows：19 μ L PCR reaction solutions (that is, multi-PRC reaction mixed liquor), 10 μM
The cDNA/DNA templates synthesized in μ L, 1 μ L the 4th steps of TGEV, GAR, GCR, PEDV and PCV2 upstream and downstream primer mixed liquor 1, add
ddH2O to reaction system cumulative volume be 25 μ L；Response parameter is 95 DEG C of denaturation 3min；40 circulation 95 DEG C denaturation 20s, 55 DEG C
Anneal 30s, 72 DEG C of extension 30s；Last 72 DEG C of 5min.5 μ L PCR primers are taken, after being mixed with 1 μ L Loading Buffer, 2%
Agarose electrophoresis detects.
6th step：Testing result
The detection of regular-PCR method is as follows with testing result of the present invention：Regular-PCR detects 38 parts of PEDV, and the present invention detects
46 parts；Regular-PCR detects 31 parts of PCV2, and the present invention detects 39 parts of positives；Regular-PCR detects 7 parts of GCR, the present invention
Detect 7 parts of positives；Regular-PCR detects 3 parts of TGEV, and the present invention detects 4 parts of positives；Regular-PCR detects 1 part of GAR,
The present invention detects 3 parts of positives；Wherein, the present invention detects 12 parts of PEDV and PCV2 mixed infections, and regular-PCR detects PEDV
With 9 parts of PCV2 mixed infections；Invention detects 2 parts of PEDV and GCR mixed infections, and regular-PCR detects PEDV and PCV2 mixing
1 part of infection；Invention detects 1 part of TGEV and PCV2 mixed infections, and regular-PCR detects 0 part of TGEV and PCV2 mixed infections.
Detection results of the present invention are significantly better than substance PCR Detection results, it is possible to reduce the generation of false negative, while once may be used
To detect mixed infection, reduce secondary PCR checking and do not need PCR amplification subsequent treatments, greatly save time and reagent material
Expect cost, improve operating efficiency.
Confirmatory experiment：According to the best fluorescence quantitative PCR method of the accuracy of detection recognized by the industry to above-mentioned 78 parts of samples
Checked, acquired results are completely the same as the present invention.
Comparative example 1, make primer corresponding to GCR into following primer pair：
Sense primer GCR-F:5 '-TGCATCCGTGAAGAGAATGGTGTT,
Anti-sense primer GCR-R:5’-TGCATCCGTGAAGAGAATGGTATGC；
Remaining is equal to embodiment 3.
Result of the test is that multi-PRC reaction is to GCR, GAR, TGEV, PEDV and PCV2 five kinds of viral limits of identification point
Wei 5 × 103、5×102、5×101、5×102、5×101With 5 × 101copies。
Comparative example 2, make primer corresponding to PEDV into following primer pair：
Sense primer PEDV-F:5 '-CACGGCGACTACTCAGCTG,
Anti-sense primer PEDV-R:5’-CTTCTTTAGCAACCCAGAA；
Remaining is equal to embodiment 3.
Result of the test is that multi-PRC reaction is to GCR, GAR, TGEV, PEDV and PCV2 five kinds of viral limits of identification point
Wei 5 × 101、5×102、5×101、5×101、5×102With 5 × 101copies。
Comparative example 3, make primer corresponding to PCV2 into following primer pair：
Sense primer PCV2-F:5 '-GAAGCGGACCCCAACCAC,
Anti-sense primer PCV2-R:5’-ACCCAGGTGGCCCCACAAT；
Remaining is equal to embodiment 3.
Result of the test is that multi-PRC reaction is to GCR, GAR, TGEV, PEDV and PCV2 five kinds of viral limits of identification point
Wei 5 × 101、5×101、5×102、5×101、5×101With 5 × 102copies。
Finally, it is also necessary to it is noted that listed above is only several specific embodiments of the invention.Obviously, this hair
It is bright to be not limited to above example, there can also be many deformations.One of ordinary skill in the art can be from present disclosure
All deformations for directly exporting or associating, are considered as protection scope of the present invention.
<110>Institutes Of Technology Of Zhejiang
<120>Five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and its application
<160> 15
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>Primer PEDV-F
<400> 1
aacacggcga ctactcagc 19
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>Primer PEDV-R
<400> 2
gccttcttta gcaacccag 19
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>Primer TGEV-F
<400> 3
gtggtgttag gtgattattt tcc 23
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>Primer TGEV-R
<400> 4
tatggtttaa cctgcactca cta 23
<210> 5
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Primer GAR-F
<400> 5
tatgcaatac cagtaggacc ag 22
<210> 6
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>Primer GAR-R
<400> 6
gctctacgta gcgagtatga aatc 24
<210> 7
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>Primer GCR-F
<400> 7
tgttgcatcc gtgaagagaa tggt 24
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>Primer GCR-R
<400> 8
gcattagccc ctacgcaagc 20
<210> 9
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>Primer PCV2-F
<400> 9
aagaagcgga ccccaac 17
<210> 10
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>Primer PCV2-R
<400> 10
aggtggcccc acaatga 17
<210> 11
<211> 394
<212> DNA
<213>Artificial sequence
<220>
<223>PEDV standard items
<400> 11
aacacggcga ctactcagct gtgagtaatc cgagtgcggt tctcacagat agtgagaaag 60
tgcttcattt agtctaaaca gaaactttat ggcttctgtc agctttcagg atcgtggccg 120
caaacgggtg ccattatccc tctatgcccc tcttagggtt actaatgaca aacccctttc 180
taaggtactc gcaaacaacg ctgtacccac taataagggg aataaggacc agcaaattgg 240
atactggaat gagcaaattc gctggcgcat gcgccgtggt gagcgaattg aacaaccttc 300
caattggcat ttctactacc tcggaacagg acctcacgcc gacctccgtt ataggactcg 360
tactgagggt gttttctggg ttgctaaaga aggc 394
<210> 12
<211> 319
<212> DNA
<213>Artificial sequence
<220>
<223>TGEV standard items
<400> 12
gtggtgttag gtgattattt tcctactgta caaccttggt ttaattgcat tcgcaatgat 60
agtaatgacc tttatgttac actggaaaat cttaaagcat tgtattggga ttatgctaca 120
gaaaatatca cttggaatca cagacaacgg ttaaacgtag tcgttaatgg atacccatac 180
tccatcacag ttacaacaac ccgcaatttt aattctgctg aaggtgctat tatatgcatt 240
tgtaagggct caccacctac taccaccaca gaatctagtt tgacttgcaa ttggggtagt 300
gagtgcaggt taaaccata 319
<210> 13
<211> 242
<212> DNA
<213>Artificial sequence
<220>
<223>GAR standard items
<400> 13
tatgcaatac cagtaggacc agtatttcca ccgggtatga attggacgga attgattacc 60
aattattcac cttcaagaga agataacttg caacgtgttt ttacagtagc ttccattaga 120
agcatgttga ttaagtgagg actaggctaa ctacctggta tccgatctta accaacatgt 180
agctatgtca agtcaatcag actctacaag taagggtatg atttcatact cgctacgtag 240
ag 242
<210> 14
<211> 126
<212> DNA
<213>Artificial sequence
<220>
<223>GCR standard items
<400> 14
tgttgcatcc gtgaagagaa tggtgttgta aagaagctag agatctaaca aatctctatg 60
tggactacgc accatgtagc atgattcacg aatgggttta gtccatgctt gcgtaggggc 120
aaatgc 126
<210> 15
<211> 508
<212> DNA
<213>Artificial sequence
<220>
<223>PCV2 standard items
<400> 15
aagaagcgga ccccaaccac acaaaaggtg ggtgttcacg ttgaataatc cttccgagga 60
cgagcgcaag aaaatacggg agcttccaat ctcccttttt gattatttta ttgttggcga 120
ggagggtaat gaggaaggac gaacacccca cctccagggg ttcgctaatt ttgtgaagaa 180
gcaaacattt aataaagtga aatggtattt cggtgcccgc tgccacatcg agaaagcgaa 240
aggaactgat cagcagaata aagaatattg cagtaaagaa ggcaacttac tgattgaatg 300
tggagctcct agatctcagg gacaacggag tgacctgtct actgctgtga gtaccttgct 360
ggagagcggg agtctggtga ccgttgcaga gcagcaccct gtaacgtttg tcagaaattt 420
ccgcgggctg gctgaacttt tgaaagtgag cgggaaaatg cagaagcgtg attggaagac 480
taatgtacac gtcattgtag ggccacct 508
Claims (9)
1. five boar diarrhea virus multiplex PCR quick diagnosis reagent kits, it is characterised in that：
Including following 5 pairs of PCR primers：
2. five boars diarrhea virus multiplex PCR quick diagnosis reagent kit according to claim 1, it is characterised in that the examination
Agent box includes：
A) PCR reaction solutions, b) PCR standard items, c) positive reference substance, d) negative controls, e) primer.
3. five boars diarrhea virus multiplex PCR quick diagnosis reagent kit according to claim 2, it is characterised in that：
The PCR standard items by following 5 kinds of standard item groups into：PEDV standard items, TGEV standard items, GAR standard items, GCR standards
Product, PCV2 standard items.
4. five boars diarrhea virus multiplex PCR quick diagnosis reagent kit according to claim 2, it is characterised in that：
The PCR reaction solutions include PCR reaction buffers, hot resistant DNA polymerase；
The PCR reaction buffers contain buffer solution, magnesium chloride and triphosphate deoxyribose nucleotide mixture.
5. five boars diarrhea virus multiplex PCR quick diagnosis reagent kit according to claim 2, it is characterised in that：
The positive reference substance is containing five kinds of viral positive plasmid melanges of TGEV, GAR, GCR, PEDV and PCV2；
The negative controls handle water for pyrocarbonic acid diethyl ester after sterilizing.
6. five boars diarrhea virus multiplex PCR quick diagnosis reagent kit according to claim 2, it is characterised in that：
The same tube packaging of upstream and downstream primer of every kind of viral specific primer.
7. five boars diarrhea virus multiplex PCR quick diagnosis reagent kit according to claim 2, it is characterised in that：
Described kit is kept in dark place in -20 DEG C.
8. kit as described in claim 1~7 the is any purposes in the boar diarrhea virus infection of specific detection five at the same time.
9. purposes according to claim 8, it is characterised in that：Five boar diarrhea viruses be TGEV, GAR, GCR, PEDV and
PCV2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710534310.5A CN107419034B (en) | 2017-07-03 | 2017-07-03 | Five-porcine diarrhea virus multiple PCR rapid diagnosis kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710534310.5A CN107419034B (en) | 2017-07-03 | 2017-07-03 | Five-porcine diarrhea virus multiple PCR rapid diagnosis kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107419034A true CN107419034A (en) | 2017-12-01 |
| CN107419034B CN107419034B (en) | 2020-09-29 |
Family
ID=60426909
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710534310.5A Active CN107419034B (en) | 2017-07-03 | 2017-07-03 | Five-porcine diarrhea virus multiple PCR rapid diagnosis kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107419034B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107955839A (en) * | 2017-12-13 | 2018-04-24 | 华南农业大学 | For detecting double PCR primer, detection method and the kit of 3 type of porcine circovirus 2 type and circovirus |
| CN108715906A (en) * | 2018-06-04 | 2018-10-30 | 广西大学 | Five kinds of pig enterovirus multiple RT-PCR quick detection kits and its application |
| CN109097499A (en) * | 2018-09-19 | 2018-12-28 | 浙江农林大学 | It is a kind of for detecting the dual fluorescence quantification RT-PCR detection kit of PEDV-TGEV nucleic acid |
| CN114807437A (en) * | 2022-04-06 | 2022-07-29 | 南京农业大学 | Quadruple fluorescent quantitative PCR detection kit for detecting porcine epidemic diarrhea virus and porcine rotavirus and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561368A (en) * | 2014-09-30 | 2015-04-29 | 浙江理工大学 | Multiple real-time fluorescent quantative PCR rapid diagnosis kit for six porcine viruses |
| CN105385683A (en) * | 2015-06-01 | 2016-03-09 | 蒋春燕 | Multiplex RT-PCR detection kit for porcine epidemic diarrhea viruses |
-
2017
- 2017-07-03 CN CN201710534310.5A patent/CN107419034B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561368A (en) * | 2014-09-30 | 2015-04-29 | 浙江理工大学 | Multiple real-time fluorescent quantative PCR rapid diagnosis kit for six porcine viruses |
| CN105385683A (en) * | 2015-06-01 | 2016-03-09 | 蒋春燕 | Multiplex RT-PCR detection kit for porcine epidemic diarrhea viruses |
Non-Patent Citations (2)
| Title |
|---|
| DOUGLAS MARTHALER等: "Rapid detection and high occurrence of porcine rotavirus A, B, and C by RT-qPCR in diagnostic samples", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| ZHAO J等: "A multiplex RT-PCR assay for rapid and differential diagnosis of four porcine diarrhea associated viruses in field samples from pig farms in East China from 2010 to 2012", 《J VIROL METHODS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107955839A (en) * | 2017-12-13 | 2018-04-24 | 华南农业大学 | For detecting double PCR primer, detection method and the kit of 3 type of porcine circovirus 2 type and circovirus |
| CN108715906A (en) * | 2018-06-04 | 2018-10-30 | 广西大学 | Five kinds of pig enterovirus multiple RT-PCR quick detection kits and its application |
| CN109097499A (en) * | 2018-09-19 | 2018-12-28 | 浙江农林大学 | It is a kind of for detecting the dual fluorescence quantification RT-PCR detection kit of PEDV-TGEV nucleic acid |
| CN114807437A (en) * | 2022-04-06 | 2022-07-29 | 南京农业大学 | Quadruple fluorescent quantitative PCR detection kit for detecting porcine epidemic diarrhea virus and porcine rotavirus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107419034B (en) | 2020-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104263853B (en) | The kit of the main virus of fluorescence quantitative PCR detection pig | |
| CN104561368B (en) | Six boar virus multiple real-time fluorescence quantitative PCR quick diagnosis reagent kits | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN107190104B (en) | Five-porcine diarrhea virus multiplex real-time fluorescent quantitative PCR rapid diagnosis kit and application | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN107419034A (en) | Five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and its application | |
| CN111172321B (en) | Fluorescent PCR detection kit for identifying African swine fever infection and immunity | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN103160615B (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| CN112795704B (en) | RAA primer pair, probe combination and kit for detecting porcine pseudorabies virus | |
| CN108531656A (en) | A kind of the duplex PCR detection primer and kit of quick differentiation porcine circovirus 2 type and 3 types | |
| WO2020034317A1 (en) | Dual real-time fluorescent quantitative pcr detection reagent and reagent kit for seneca virus a and foot-and-mouth disease virus | |
| CN107326099B (en) | Five-porcine diarrhea virus enrichment multiplex PCR (polymerase chain reaction) rapid detection kit and application thereof | |
| CN103276103A (en) | Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit | |
| CN107699635A (en) | Porcine epidemic diarrhea virus fluorescence RPA detection methods | |
| CN110592278A (en) | Multiplex RT-PCR kit for PRoV, PoSaV and PAStV | |
| CN108342510B (en) | Multiple RT-PCR kit for BTV-11 type, 17 type, 20 type, 23 type and 24 type genotype typing identification and detection method thereof | |
| CN107385077B (en) | Specific primer for detecting salmonella pullorum, kit containing primer and application of kit | |
| CN106834500B (en) | Specific primer for detecting salmonella pullorum, kit containing primer and application of kit | |
| Oem et al. | Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| CN104263852B (en) | Fluorescence quantitative PCR detection pig breathes breeding difficulty disease association virus kit | |
| CN103276104A (en) | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications | |
| CN113186359B (en) | Multiplex PCR rapid diagnosis kit for detecting and parting pig astrovirus | |
| CN116024387A (en) | Quadruple fluorescence PCR detection kit for porcine viral diarrhea pathogen and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 310018 No. 2, No. 452, No. 6 street, Xiasha, Xiasha, Hangzhou economic and Technological Development Zone, Hangzhou, Zhejiang Province, A2018 Applicant after: HANGZHOU HONGQIAO ZHONGKE GENE TECHNOLOGY Co.,Ltd. Applicant after: Zhejiang University of Technology Address before: 310018 No. 2, No. 452, No. 6 street, Xiasha, Xiasha, Hangzhou economic and Technological Development Zone, Hangzhou, Zhejiang Province, A2018 Applicant before: HANGZHOU HONGQIAO BIOTECHNOLOGY Co.,Ltd. Applicant before: Zhejiang University of Technology |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |