CN105483294A - Digital PCR absolute quantification detection kit for American classical strains with PRRSV - Google Patents
Digital PCR absolute quantification detection kit for American classical strains with PRRSV Download PDFInfo
- Publication number
- CN105483294A CN105483294A CN201610069032.6A CN201610069032A CN105483294A CN 105483294 A CN105483294 A CN 105483294A CN 201610069032 A CN201610069032 A CN 201610069032A CN 105483294 A CN105483294 A CN 105483294A
- Authority
- CN
- China
- Prior art keywords
- probe
- droplet
- pcr
- test kit
- ddpcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention provides a specific primer and probe assembly used for detecting American classical strains with porcine reproductive and respiratory syndrome viruses (PRRSV). The specific primer and probe assembly comprises a pair of specific primers and a specific probe used in cooperation with the primers. The invention further provides a detection kit for the American classical strains with the PRRSV. The detection kit has the advantages of being quick, efficient, easy and convenient to operate, high in specificity and sensitivity, capable of achieving quantification directly without a standard curve and the like, and can facilitate determination of an epidemic early before breakout of the epidemic to take prevention measures and control the epidemic from source.
Description
Technical field
The present invention relates to test kit detection technique field, relate to the classical strain digital pcr absolute quantitation detection method of a kind of porcine reproductive and respiratory syndrome virus american type and detection kit specifically.
Background technology
Porcine reproductive and respiratory syndrome (Porcinereproductiveandrespiratorysyndrome, PRRS) be a kind ofly having difficulty in breathing as the high degree in contact sexually transmitted disease of feature with farrowing sow breeding difficulty, especially sucking piglets of being caused by porcine reproductive and respiratory syndrome virus (Porcinereproductiveandrespiratorysyndromevirus, PRRSV).This disease was broken out in the U.S. first in 1987, in succession occurred subsequently in Canada, Europe and Asia, worldwide popular at present, caused huge financial loss every year.There is PRRS in nineteen ninety-five in China, subsequently rapid spread first.Within 2006, to have broken out in China that fever, sickness rate are high, the high pig " hyperpyrexia disease " for main clinical characteristics of mortality ratio comprehensively, and cause the cause of disease of this disease be comparatively before the highly pathogenic PRRSV (highlypathogenicPRRS, HP-PRRS) that morphs of classical PRRSV popular at home.So far, PRRSV has two profiles, Europe class and american type, and american type is divided into two kinds of hypotypes, the strain of classical America and the strain of highly pathogenic America, and there is some difference in gene order for three kinds of hypotype strains.The domestic Major Epidemic of China be american type strain, and European strain is also even is at home found, therefore need clinically a kind of can the detection method of the classical strain of quick diagnosis PRRSV american type.
Traditional PRRSV detection method mainly comprises viral Isolation and ldentification, immunoperoxidase Monolayer Assay (IPMA), indirect immunofluorescence experiment (IFA) and Immunofluorescent antibody experiment (indirect ELISA) etc.Current the most frequently used nucleic acid detection method has reverse transcription-polymerase chain reaction to test the experiment such as (RT-PCR) and fluorescence RT-PCR (RealtimeRT-PCR).Traditional PRRSV detection method exists to be needed to use high cost plant and instrument, and test required time is longer waits deficiency.Although RT-PCR and RealtimeRT-PCR as compared with the past method to have specificity stronger, highly sensitive, reproducible, and level of automation high, but aforesaid method all can only realize the detection of quantitative and semi-quantitative, accurate quantification cannot be carried out to viral nucleic acid, sensitivity and Sensitivity Specificity still have some limitations.
Digitizing PCR (DigitalPCR, dPCR) concept was just adopted by BertVogelstein as far back as 1999 and delivers pertinent literature, its original intention is the mutant cell in order to detect trace from a large amount of normal somatic cell of clinical sample (as urine, lymph liquid, blood plasma, ight soil etc.), but because the consumptive material that can be used for dilute sample is at that time 384 orifice plates, the core concept of digital pcr therefore very well can't be embodied---" infinite dilution " (terminaldilution).A sample can be divided into 20 by the droplet technology of the QX200 system core of Bio-Rad company, 000 receive upgrading droplet, in essence traditional quantitative PCR test is become 20,000 test, substantially increase sensitivity and the precision of nucleotide sequence detection, be deduce to the perfection of " infinite dilution " this concept, its Method And Principle can be described as droplet type digitizing PCR (DropletDigitalPCR, ddPCR).QX200ddPCR system comprises two instruments: drop generator and droplet analyser, and relevant consumptive material.Each sample is divided into 20 by drop generator, receives upgrading droplet uniformly for 000, wherein each droplet or not containing nucleic acid target molecule to be checked, or containing one to several nucleic acid target molecule to be checked.Each droplet is as an independently PCR reactor.Droplet is transferred in 96 hole PCR plate subsequently, carries out terminal pcr amplification.Droplet analyser (dropletreader) is adopted to detect each droplet one by one, the droplet interpretation of fluorescent signal is had to be 1, the droplet interpretation of fluorescent signal is not had to be 0, finally according to the ratio of Poisson's distribution principle and positive droplet, analysis software can calculate the concentration or copy number that provide target molecule to be checked.Compared with traditional quantitative PCR, tolerance range and the sensitivity of digital pcr are better.Utilize droplet type digital pcr technology, researchist can detect rare mutation, and Accurate Measurement copy number makes a variation, and carries out absolute quantitation to genetic expression.Cancer related mutation is lower because of concentration, often escapes from detection.By means of the highly sensitive of QX200 system, nowadays researchist can be low to moderate 1/1 by detectable level, 000, the target molecule of 000.
Summary of the invention
The object of this invention is to provide and a kind of there is highly sensitive, high specific, split hair caccuracy, pinpoint accuracy, the digital pcr detection method that can realize accurate quantification and digital pcr detection kit, for accurately detecting fast of the classical strain of porcine reproductive and respiratory syndrome virus american type.
First technical purpose of the present invention is to provide Auele Specific Primer for detecting the classical strain of porcine reproductive and respiratory syndrome virus american type and probe combinations, comprise 1 pair of Auele Specific Primer and 1 and primer pair with the use of specific probe, its nucleotide sequence is respectively:
F：TGGTTTCTCTCTGGCTTTTAGGTC
R：GTAGGTTCCATCTGGTGCGGT
P：FAM-TTGCTGGTCTCGTCACCCCCTAT-BHQ1。
The invention provides above-mentioned Auele Specific Primer and probe combinations and prepare the application in the classical strain detection kit of porcine reproductive and respiratory syndrome virus american type or detection reagent.
The invention provides a kind of test kit containing above-mentioned Auele Specific Primer and probe combinations.Described test kit is preferably droplet digital pcr absolute quantitation detection kit.
Another technical purpose of the present invention is the detection kit providing the classical strain of a kind of that have highly sensitive, high specific, split hair caccuracy and tolerance range, simple to operate detection porcine reproductive and respiratory syndrome virus american type, wherein comprise 1 pair of Auele Specific Primer and 1 and primer pair with the use of specific probe, its nucleotide sequence is respectively:
F：TGGTTTCTCTCTGGCTTTTAGGTC
R：GTAGGTTCCATCTGGTGCGGT
P：FAM-TTGCTGGTCTCGTCACCCCCTAT-BHQ1。
Also comprise virus total RNA and extract reagent and detection reagent; Described detection reagent comprises the distilled water without RNA enzyme, single stage method ddPCR probe method premixed liquid, and oil occurs probe method ddPCR droplet, control liquid, negative control and positive control.
Described virus total RNA is extracted reagent and is contained TRIzoL, chloroform or primary isoamyl alcohol, Virahol.The formula of described its 900 μ l of single stage method ddPCR probe method premixed liquid is: the 2XOne-stepRT-ddPCRSupermixforprobes of 500 μ L, upstream and downstream primer is respectively 90 μ L, specific probe is 40 μ L, the concentration of primer and probe is 10 μMs, and without RNase enzyme distilled water 180 μ L.
Described positive control is the extracting solution containing the classical strain virus geneome RNA of pig blue-ear disease american type, and negative control is without RNA enzyme distilled water.
Its principle of work of test kit of the present invention adopts droplet type digitizing PCR (ddPCR), and the working routine of described test kit is:
(1) ddPCR reaction solution is prepared; DdPCR reaction solution 20 μ l formula is: single stage method ddPCR probe method premixed liquid 18 μ l, and testing sample RNA template is 2 μ l;
(2) prepare droplet, then droplet is proceeded to PCR plate, increase in PCR instrument;
(3) PCR plate completing pcr amplification is put into droplet analyser, detect droplet, analytical data, display detected result.
In one embodiment of the invention, the method preparing droplet adopts the drop generator in the QX200 system of Bio-Rad company, and operation is carried out droplet and prepared to specifications.
Wherein, in step (2), the amplification program of PCR is 50 DEG C of reverse transcription 10min; 95 DEG C of denaturation 10min; 94 DEG C of sex change 30sec, 57 ~ 60 DEG C of annealing 60sec, totally 40 circulations; 98 DEG C of 10min terminate reaction, often walk the cooling rate all arranging 2.5 DEG C/sec.
The application of test kit provided by the invention in schweineseuche disease detects and prevents also belongs to protection scope of the present invention.
The decision method of test kit detected result of the present invention is: (1) positive control: 20 ± 2 copies; (2) negative control: <1 copy; Sample to be tested result judges: (1) is positive: detection result of specimen >=1 copy.(2) negative: detection result of specimen <1 copies.
The present invention has groped the concentration of primer and probe, have found the suitableeest primer of droplet type digital pcr and the working concentration of probe.Grope warming and cooling rate the suitableeest in PCR reaction process, to improve the amplification efficiency of digital pcr, the inventive method has been combined with the QX200 system of BIO-RAD company.
Test kit of the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, can direct quantitative, without the need to typical curve, the advantage such as easy and simple to handle, can be convenient to determine epidemic disease in early days before epidemic situation breaks out in advance, carry out prevention, from Sources controlling epidemic situation.Be in particular in:
(1) high specific: the present invention is Auele Specific Primer and specific probe according to pig blue-ear disease american type classical strain virus capsid protein gene group sequences Design, its specificity is high, and it is highly stable, ensure that carrying out smoothly of reaction, guarantee the specificity that the classical strain of porcine reproductive and respiratory syndrome virus american type detects further;
(2) highly sensitive: detectable level is low to moderate 1/1, the target molecule of 000,000; Can copy number in direct quantitative sample to be tested;
(3) low template: because the sensitivity detected is very high, can detect low-abundance goal gene, so can reduce template consumption, dilution template concentrations, precious for some, rare sample can have more research.
(4) can direct quantitative, without the need to typical curve: compared with traditional PRRSV detection method, this test kit can direct quantitative, without the need to typical curve, easy and simple to handle, accurate, the effectively large-scale outbreak of prevention schweineseuche disease.
Embodiment
Following examples further illustrate content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition or replacement, all belong to scope of the present invention.
If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.
The design of embodiment 1 primer and probe and screening
1, primer of the present invention, probe design: the pig blue-ear disease american type classical strain virus genome sequence KP771778.1 that the classical strain virus of the pig blue-ear disease american type delivered according to Genbank has been delivered according to Genbank, N capsid protein is selected to be target gene, that carries out being applicable to the Auele Specific Primer of ddPCR and probe is designed to target gene, carry out being applicable to ddPCR Auele Specific Primer and design.
This gives the process of screening best primer, what selection software design went out wherein severally screens alternative primer, and alternative primer is as follows, in table 1.
Table 1
| Title | Sequence |
| F1 | CGCACCAGATGGRACCTACTT(SEQ ID NO.4) |
| R1 | ACGGTGTTCAGTGAGGGCTTT(SEQ ID NO.5) |
| P1 | FAM-CCAGTCAACGCAGCG-BHQ1(SEQ ID NO.6) |
| F2 | TGGTTTCTCTCTGGCTTTTAGGTC(SEQ ID NO.1) |
| R2 | GTAGGTTCCATCTGGTGCGGT(SEQ ID NO.2) |
| P2 | FAM-TTGCTGGTCTCGTCACCCCCTAT-BHQ1(SEQ ID NO.3) |
2, the screening of primer
(1) primer is joined at random is four right: F1R1, F1R2, F2R1, F2R2;
(2) then do quantitative fluorescent PCR with dye method, PCR system formula: 2Xone-stepSYBRGreenSupermix10 μ L, upstream primer, downstream primer is respectively 1 μ L, RNaseFreedH
2o3 μ L, positive template 5 μ L.The amplification program of PCR is 50 DEG C of reverse transcription 10min; 95 DEG C of denaturation 10min; 94 DEG C of sex change 30sec, 60 DEG C of annealing 60sec, totally 40 circulations; 65 DEG C-95 DEG C raise 0.5 DEG C of solubility curve in every 5 seconds, terminate reaction.
(3) interpretation of result, selects the primer pair F2R2 not having non-specific amplification.
3, the screening of probe
(1) being combined as of primed probe: 1, F2R2+P1,2, F2R2+P2
(2) then on ddPCR platform, ddPCR system formulation: 2XOne-stepRT-ddPCRSupermix10 μ L, upstream primer, downstream primer is respectively 1 μ L, probe 0.5 μ L, RNaseFreedH
2o3.5 μ L, positive template 4 μ L, cumulative volume 20 μ L (concentration of primer and probe is 10 μMs).Then droplet is generated.
(3) upper PCR instrument amplification, is 50 DEG C of reverse transcription 10min; 95 DEG C of denaturation 10min; 94 DEG C of sex change 30sec, 60 DEG C of annealing 60sec, totally 40 circulations; 98 DEG C of 10min terminate reaction.Upper droplet digital pcr detector detects.
(4) analytical results: experimentally result selects the combination of F2R2+P2 primed probe.
Embodiment 2 detects the optimization of the PCR method annealing temperature of the classical strain virus of pig blue-ear disease american type on ddPCR platform.
1, being combined as of primed probe is selected: F2R2+P2.
2, then on ddPCR platform, ddPCR system formulation: 2XOne-stepRT-ddPCRSupermix10 μ L, upstream primer, downstream primer is respectively 1 μ L, probe 0.5 μ L, RNaseFreedH
2o3.5 μ L, positive template 4 μ L, cumulative volume 20 μ L (concentration of primer and probe is 10 μMs).Do 8 multiple holes, then generate droplet.
3, upper PCR instrument amplification, is 50 DEG C of reverse transcription 10min; 95 DEG C of denaturation 10min; 94 DEG C of sex change 30sec, 50 ~ 60 DEG C (instruments automatically distribute 8 thermogrades) anneal 60sec, totally 40 circulations; 98 DEG C of 10min terminate reaction.Upper droplet digital pcr detector detects.
4, analytical results: experimentally result selects the annealing temperature of 57 ~ 60 DEG C.
The optimization experiment of embodiment 3 primer, concentration and probe concentration
Design primed probe concentration is 10 μMs, and be combined as F2R2P2, system configurations method is in table 2.
Table 2
Then on ddPCR platform, generate droplet, transfer in 96 orifice plates, envelope aluminium film.
Upper PCR instrument amplification, the amplification program of PCR is 50 DEG C of reverse transcription 10min; 95 DEG C of denaturation 10min; 94 DEG C of sex change 30sec, 60 DEG C of annealing 60sec, totally 40 circulations; 98 DEG C of 10min terminate reaction.Upper droplet digital pcr detector detects.
Analytical results: experimentally result selects F2R2+P2 primed probe formula, select primer to be respectively 1.8 μ L, probe is 0.8 μ L.
The optimization experiment of embodiment 4PCR amplification warming and cooling rate
1, then on ddPCR platform, primed probe combination F2R2+P2 (concentration is 10 μMs), uses ddPCR system formulation: 2XOne-stepRT-ddPCRSupermixforprobes10 μ L, upstream primer, downstream primer is respectively 1.8 μ L, and probe is 0.8 μ L, RNaseFreedH
2o3.6 μ L, positive template 2 μ L, cumulative volume 20 μ L.Every platform instrument does 4 multiple holes.Then generate droplet, transfer in PCR tubule.
2, increasing on two same PCR instrument platforms, is 50 DEG C of reverse transcription 10min; 95 DEG C of denaturation 10min; 94 DEG C of sex change 30sec, 58 DEG C of annealing 60sec, totally 40 circulations; 98 DEG C of 10min terminate reaction, and one arranges warming and cooling rate and is set to 5 DEG C/sec, another platform is arranged warming and cooling rate and is set to 2.5 DEG C/sec, after amplification terminates, intratubular for PCR amplified production is transferred in same 96 orifice plate, and envelope aluminium film, upper droplet digital pcr detector detects.
3, analytical results: experimentally interpretation of result finds, much faster than warming and cooling rate of the droplet number of the last detection that warming and cooling rate is slow, amplification efficiency is high, what the distance between the negative droplet that warming and cooling rate is slow and positive particulate was divided opens very much, be easy to distinguish, what the distance between the negative droplet that warming and cooling rate is fast and positive particulate was divided does not open, and is not easy to distinguish, therefore selects 2.5 DEG C/sec warming and cooling rate.
Embodiment 5 viral RNA extracts
Get 100 μ L tissue sample grinding supernatant liquors to put in 1.5mLeppendorf pipe, add 500 μ L solution A, mixing, room temperature concuss 15s, room temperature leaves standstill 5min.Add 120 μ L solution B, carefully cover cap, room temperature concuss 15s, room temperature places 5min.12,000rpm, 4 DEG C, centrifugal 15min, is divided into three layers as seen, and upper strata aqueous phase is containing RNA.The new eppendorf pipe of transfer aqueous phase to, add equivalent solution C (about 500 μ L), mixing, room temperature places 15min.12,000rpm, 4 DEG C, centrifugal 10min, has glue sample RNA to precipitate at eppendorf tube edge and bottom after centrifugal as seen.Wash RNA: abandon supernatant, add 1000 μ L75% ethanol (using front solution D to add dehydrated alcohol configuration to form ,-20 DEG C of precoolings) rinsing precipitation, 12000rpm, 4 DEG C, centrifugal 5min, abandons supernatant.The abundant dry RNA precipitation of room temperature.Add 15 μ LRNaseFreedH2O, namely can be used for pcr amplification.Can-20 DEG C save backup.
Embodiment 6 detects the foundation of the ddPCR method of the classical strain virus of pig blue-ear disease american type
1, the assembling of droplet digital pcr absolute quantitation detection kit
Following reagent is packed, label (indicating title, lot number, date manufactured, validity period etc.) with suitable external packing box.
Solution A (RNaseFreedH
2o) 1,1mL; Solution B (single stage method ddPCR probe method premixed liquid) one, 900 μ L; Solution C (oil occurs probe method ddPCR droplet) one, 7mL; Solution D is ddPCR probe method control liquid, 3.5mL; Solution E (positive control) one, 40 μ L; Solution F (negative control) one, 40 μ L; Use geneome RNA is positive template, uses the rear freezen protective of Tris-EDTA damping fluid (0.01MpH8.0) dilution.By the positive control preparation that is up to the standards by 400 μ L quantitative separatings.Use RNaseFreedH
2o is negative control.
The formula of above-mentioned its 900 μ L of single stage method ddPCR probe method premixed liquid is: the 2XOne-stepRT-ddPCRSupermixforprobes of 500 μ L, and upstream and downstream primer is respectively 90 μ L, and specific probe is 40 μ L, and the concentration of primer and probe is 10 μMs.RNaseFreedH
2O180μL。
During use, in the ddPCR probe method premixed liquid of 18 μ L, add the RNA template of 2 μ L, obtain the ddPCR reaction solution of 20 μ L, for the preparation of droplet.
2, the foundation of ddPCR method
(1) ddPCR reaction solution is prepared, cumulative volume 20 μ L.Following reactants is added in pcr amplification pipe:
| Single reaction system formulation | Single stage method ddPCR probe method premixed liquid | 18μL |
| Template | RNA | 2μL |
Blank: with RNaseFreedH
2o replaces template, increases under similarity condition.
(2) getting droplet is placed in Kato fixing, 20 μ L reaction solutions being joined droplet occurs in 8 holes of a row in the middle of card, supply by 20 μ L1 × solution D less than during 8 samples, the suggestion use 8 passage 20 μ L volley of rifle fire and 20 μ L rifle heads (can not 200uL rifle head be used), rifle head access hole one side bottom during application of sample, be about 15 ° of angles with sidewall, slowly get liquid, slowly promote rifle head position after getting a part and get remaining liquid again, not by rifle by more than the first file location in case introduce bubble.
(3) in next row 8 holes, the droplet card most end, respectively add 70 μ L droplets and generate oil, empty hole can not be had equally.
(4) cover rubber cushion, notice that the aperture on both sides all wants hook jail.
(5) above Kato is steadily positioned in droplet instrument for generating lightly, starts to generate droplet, note LED status on instrument, complete within general 2 minutes.
(6) droplet is created in one round of droplet generation card the top, the suggestion use 8 passage volley of rifle fire and 200 μ L rifle heads are carefully slowly drawn, adjustment volume aspirated is 40 μ L, is set level by Kato, and rifle head is being that 30 ~ 45° angle is put into hole wall, touch at the bottom of hole, within about 5 seconds, draw 40uL, then squeeze into (about 5 seconds) in 96 holes, orifice plate corresponding position equally lentamente, rifle head is pressed close at the bottom of hole wall access hole, note sealing up lid with grease proofing volatilization, discard used droplet at every turn and card and rubber cushion occur.
(7), after transfer oil droplet enters and completes in 96 orifice plates, seal instrument with preheated PX1 and carry out sealer (film is bright to face up, and dark face is downward) to it, the working procedure of recommendation is: 180 DEG C, 10s, generally without the need to inverted orientation secondary sealer;
PCR reaction should be carried out in 30 minutes after sealing film, or be put in 4 DEG C of refrigerators within 4 hours and carry out PCR, can complete in any 96 hole PCR instrument, note warming and cooling rate≤2.5 DEG C/s.Recommendation response condition:
(8) 96 orifice plates completing PCR are before put into plateholder to assemble, note orientation, plate oblique angle, after assembling, steadily put into droplet reader lightly.
(9) open QuantaSoft software, before each experiment of suggestion, do primary system cleaning, if within more than one week, do not use suggestion first to do once filling oil circuit do cleaning systems again.Arrange sample message in 96 orifice plates afterwards, mainly provide Experiment name, experiment type and detecting probe information etc., can run instrument after completing, terminating rear result can be analyzed automatically, and manually examines rear saving result.
4, interpretation of result and judgement
The decision method of test kit detected result of the present invention is: (1) positive control: 20 ± 2 copies; (2) negative control: <1 copy; Sample to be tested result judges: (1) is positive: detection result of specimen >=1 copy.(2) negative: detection result of specimen <1 copies.
Embodiment 7 specific assay
Detect pig healthy cell culture respectively, pig circular ring virus, pseudorabies virus, pig parvoviral, each 10 parts of transmissible gastro-enteritis virus with the test kit of preparation, result is negative entirely; Detect tissue and each 10 parts of the cell culture of the classical strain virus infection of pig pig blue-ear disease american type, result is positive entirely.
Above detected result demonstrate test kit specificity of the present invention good, highly sensitive, can direct quantitative, quick, result easy to detect is accurately and reliably.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the technology of the present invention principle; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (10)
1., for detecting Auele Specific Primer and the probe combinations of the classical strain of porcine reproductive and respiratory syndrome virus american type, it is characterized in that, comprise 1 pair of Auele Specific Primer and 1 and primer pair with the use of specific probe, its nucleotide sequence is respectively:
F：TGGTTTCTCTCTGGCTTTTAGGTC
R：GTAGGTTCCATCTGGTGCGGT
P：FAM-TTGCTGGTCTCGTCACCCCCTAT-BHQ1。
2. Auele Specific Primer according to claim 1 and probe combinations are preparing the application in the classical strain detection kit of porcine reproductive and respiratory syndrome virus american type or detection reagent.
3. one kind contains the test kit of Auele Specific Primer and probe combinations described in claim 1.
4. test kit as claimed in claim 3, it is droplet digital pcr absolute quantitation detection kit.
5. test kit as claimed in claim 4, detection reagent comprises the distilled water without RNA enzyme, single stage method ddPCR probe method premixed liquid, and oil occurs probe method ddPCR droplet, control liquid, negative control and positive control.
6. test kit as claimed in claim 5, is characterized in that, described positive control is the extracting solution containing the classical strain virus geneome RNA of pig blue-ear disease american type, and negative control is without RNA enzyme distilled water.
7. test kit as claimed in claim 5, it is characterized in that, the formula of described its 900 μ l of single stage method ddPCR probe method premixed liquid is: the 2XOne-stepRT-ddPCRSupermixforprobes of 500 μ L, upstream and downstream primer is respectively 90 μ L, specific probe is 40 μ L, the concentration of primer and probe is 10 μMs, and without RNase enzyme distilled water 180 μ L.
8. the test kit as described in as arbitrary in claim 4-7, it is characterized in that, the working routine of described test kit is:
(1) ddPCR reaction solution is prepared; DdPCR reaction solution 20 μ l formula is: single stage method ddPCR probe method premixed liquid 18 μ l, and testing sample RNA template is 2 μ l;
(2) prepare droplet, then droplet is proceeded to PCR plate, increase in PCR instrument;
(3) PCR plate completing pcr amplification is put into droplet analyser, detect droplet, analytical data, display detected result.
9. test kit as claimed in claim 8, is characterized in that, in step (2), the amplification program of PCR is 50 DEG C of reverse transcription 10min; 95 DEG C of denaturation 10min; 94 DEG C of sex change 30sec, 57 ~ 60 DEG C of annealing 60sec, totally 40 circulations; 98 DEG C of 10min terminate reaction, often walk the cooling rate all arranging 2.5 DEG C/sec.
10. the application of the arbitrary described test kit of claim 3-9 in schweineseuche disease detects and prevents.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610069032.6A CN105483294A (en) | 2016-02-01 | 2016-02-01 | Digital PCR absolute quantification detection kit for American classical strains with PRRSV |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610069032.6A CN105483294A (en) | 2016-02-01 | 2016-02-01 | Digital PCR absolute quantification detection kit for American classical strains with PRRSV |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105483294A true CN105483294A (en) | 2016-04-13 |
Family
ID=55670565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610069032.6A Pending CN105483294A (en) | 2016-02-01 | 2016-02-01 | Digital PCR absolute quantification detection kit for American classical strains with PRRSV |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105483294A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834539A (en) * | 2017-01-20 | 2017-06-13 | 北京市动物疫病预防控制中心 | Highly pathogenic PRRSV and CSFV simultaneous quantitative detection kit |
| CN107267664A (en) * | 2017-05-19 | 2017-10-20 | 河南大学 | A kind of ddPCR methods, primer and its application and kit that porcine reproductive and respiratory syndrome virus is detected for absolute quantitation |
| CN107447055A (en) * | 2017-09-19 | 2017-12-08 | 中国动物疫病预防控制中心 | Pig parvoviral droplet digital pcr absolute quantitation detection kit |
| CN108913792A (en) * | 2018-08-03 | 2018-11-30 | 暨南大学 | Primer and probe and its kit and method based on digital pcr technology detection Streptococcus suis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101935716A (en) * | 2010-09-10 | 2011-01-05 | 南京农业大学 | Double detection method of porcine reproductive and respiratory syndrome virus and bovine viral diarrhea virus from pig |
| CN102277445A (en) * | 2010-12-10 | 2011-12-14 | 中华人民共和国珠海出入境检验检疫局 | PRRS RT-LAMP detection method and detection kit |
| CN104745726A (en) * | 2015-03-24 | 2015-07-01 | 北京佰鸥创投生物科技有限公司 | Triplet fluorescence quantitative detection kit for PRRSV (Porcine reproductive and respiratory syndrome virus), HP-PRRSV (Highly pathogenic porcine reproductive and respiratory syndrome virus) and CSFV (Classical Swine Fever Virus) |
-
2016
- 2016-02-01 CN CN201610069032.6A patent/CN105483294A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101935716A (en) * | 2010-09-10 | 2011-01-05 | 南京农业大学 | Double detection method of porcine reproductive and respiratory syndrome virus and bovine viral diarrhea virus from pig |
| CN102277445A (en) * | 2010-12-10 | 2011-12-14 | 中华人民共和国珠海出入境检验检疫局 | PRRS RT-LAMP detection method and detection kit |
| CN104745726A (en) * | 2015-03-24 | 2015-07-01 | 北京佰鸥创投生物科技有限公司 | Triplet fluorescence quantitative detection kit for PRRSV (Porcine reproductive and respiratory syndrome virus), HP-PRRSV (Highly pathogenic porcine reproductive and respiratory syndrome virus) and CSFV (Classical Swine Fever Virus) |
Non-Patent Citations (1)
| Title |
|---|
| SHAN ZHAO等: "Sensitive detection of Porcine circovirus-2 by droplet digital polymerase chain reaction", 《JOURNAL OF VETERINARY DIAGNOSTIC INVESTIGATION》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834539A (en) * | 2017-01-20 | 2017-06-13 | 北京市动物疫病预防控制中心 | Highly pathogenic PRRSV and CSFV simultaneous quantitative detection kit |
| CN107267664A (en) * | 2017-05-19 | 2017-10-20 | 河南大学 | A kind of ddPCR methods, primer and its application and kit that porcine reproductive and respiratory syndrome virus is detected for absolute quantitation |
| CN107447055A (en) * | 2017-09-19 | 2017-12-08 | 中国动物疫病预防控制中心 | Pig parvoviral droplet digital pcr absolute quantitation detection kit |
| CN108913792A (en) * | 2018-08-03 | 2018-11-30 | 暨南大学 | Primer and probe and its kit and method based on digital pcr technology detection Streptococcus suis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Böger et al. | Systematic review with meta-analysis of the accuracy of diagnostic tests for COVID-19 | |
| van Kasteren et al. | Comparison of seven commercial RT-PCR diagnostic kits for COVID-19 | |
| CN103509877B (en) | A kind of PCR kit for fluorescence quantitative for detecting PRV and application thereof | |
| CN105543416A (en) | Double microdroplet digital PCR (Polymerase Chain Reaction) absolute quantitative detection kit for porcine epidemic diarrhea virus and transmissible gastroenteritis virus | |
| Go et al. | Evaluation and clinical validation of two field–deployable reverse transcription-insulated isothermal pcr assays for the detection of the middle east respiratory syndrome–coronavirus | |
| Nicolás‐Párraga et al. | Differential HPV16 variant distribution in squamous cell carcinoma, adenocarcinoma and adenosquamous cell carcinoma | |
| CN111500776A (en) | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method | |
| CN105483294A (en) | Digital PCR absolute quantification detection kit for American classical strains with PRRSV | |
| Lu et al. | Circulating Epstein‐Barr virus microRNAs BART7‐3p and BART13‐3p as novel biomarkers in nasopharyngeal carcinoma | |
| CN104561374A (en) | Detection reagent and method for identifying porcine pseudorabies virus vaccine strain and wild strain | |
| Tu et al. | Development of a fluorescent probe‐based real‐time reverse transcription recombinase‐aided amplification assay for the rapid detection of classical swine fever virus | |
| CN110229932A (en) | African swine fever virus nucleic acid is hands-free to take fluorescence isothermal amplification detection kit | |
| Yang et al. | The development of a sensitive droplet digital PCR for quantitative detection of porcine reproductive and respiratory syndrome virus | |
| CN105861641A (en) | Primer, kit and method for detecting CHO cell DNA residues | |
| CN105624329A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 | |
| CN103725794B (en) | Detect fluorescent quantitation RT PCR primers, probe and its method for PRRSV | |
| CN110218819A (en) | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease | |
| CN106435039A (en) | Primers, probe, kit and method for detecting PRRS (porcine reproductive and respiratory syndrome) NADC-30 strain | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| Qiu et al. | Simultaneous detection of classical PRRSV, highly pathogenic PRRSV and NADC30-like PRRSV by TaqMan probe real-time PCR | |
| CN108977529A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
| Cao et al. | The diagnostic accuracy of Xpert Xpress to SARS-CoV-2: a systematic review | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| Mukherjee et al. | Ravaging SARS-CoV-2: rudimentary diagnosis and puzzling immunological responses | |
| CN107083448A (en) | Highly pathogenic PRRSV RT PCR absolute quantitation detection kits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Chuanbin Inventor after: Liu Yingdie Inventor after: Zi Zhanchao Inventor after: Xu Qi Inventor after: Li Shuo Inventor after: Wang Jing Inventor after: Ma Fukun Inventor after: Yuan Lin Inventor after: Chen Chen Inventor after: Di Xinyan Inventor after: Wu Jiajun Inventor after: Zhang Shuo Inventor after: Han Dao Inventor after: Zhou Zhi Inventor after: Ni Jianqiang Inventor before: Chen Chen Inventor before: Zi Zhanchao Inventor before: Xu Qi Inventor before: Li Shuo Inventor before: Wang Jing Inventor before: Ma Fukun Inventor before: Di Xinyan Inventor before: Wu Jiajun Inventor before: Yuan Lin Inventor before: Zhang Shuo Inventor before: Han Dao Inventor before: Zhou Zhi Inventor before: Ni Jianqiang Inventor before: Liu Yingdie |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160413 |