CN102277453B - Loop-mediated isothermal amplification (LAMP) detection kit and LAMP detection method for macrobrachium rosenbergii bicistronic virus - Google Patents
Loop-mediated isothermal amplification (LAMP) detection kit and LAMP detection method for macrobrachium rosenbergii bicistronic virus Download PDFInfo
- Publication number
- CN102277453B CN102277453B CN 201110239776 CN201110239776A CN102277453B CN 102277453 B CN102277453 B CN 102277453B CN 201110239776 CN201110239776 CN 201110239776 CN 201110239776 A CN201110239776 A CN 201110239776A CN 102277453 B CN102277453 B CN 102277453B
- Authority
- CN
- China
- Prior art keywords
- primer
- mrdv
- lamp
- seq
- macrobrachium rosenbergii
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP detection kit and an LAMP detection method for macrobrachium rosenbergii bicistronic virus, which belongs to the technical field of target DNA segments. The detection kit comprises an RNA extraction reagent and a reverse transcription (RT)-LAMP reaction reagent. The detection method comprises: 1) extracting RNA of macrobrachium rosenbergii; 2) performing the RT-LAMP amplification of the macrobrachium rosenbergii bicistronic virus; and 3) performing color developing detection. The detection kit has high specificity and sensitivity, the detection method is convenient, sensitive, accurate and quick, and thus, a foundation is laid for the prevention of syndrome in larvae of macrobrachium rosenbergii.
Description
Technical field
The invention belongs to the detection technique field of target DNA segment, be specifically related to a kind of used test kit and detection method of ring mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) technology rapid detection Macrobrachium rosenbergii bicistronic mRNA virus of utilizing.
Background technology
Macrobrachium rosenbergii bicistronic mRNA virus (
Macrobrachium rosenbergii dicistrovirus, MRDV) be cause the Macrobrachium rosenbergii larvae syndromes (
Macrobrachium rosenbergiiLarval Syndrome, MRLS) main pathogen, very harmful to the Macrobrachium rosenbergii breeding industry.MRDV is single positive chain RNA virus, is classified as the bicistronic mRNA Viraceae.This virus does not have report on the document at home and abroad, and its genome sequence only discloses 900 bases.This virus was in 2009 and caused the disease of China's Macrobrachium rosenbergii larvae in 2010, cause Macrobrachium rosenbergii mortality to occur at larval stage, particularly particularly serious in the death of young 6-9 age in days, mortality ratio is generally 80-90%, serious reaches 100%, and nearly financial loss that caused in 2 years can't be estimated.Since being found, because lacking detection method, seriously hindered the prevention work that this virus causes disease, so the research of the exploitation of this virus detection kit and detection technique seemed particularly important.
RT-LAMP is a kind of novel nucleic acid isothermal amplification technique, this technology is for 6 special primers of 6 zone design of target gene, utilize AMV reversed transcriptive enzyme and archaeal dna polymerase to act on simultaneously, so that viral cDNA is synthetic and nucleic acid amplification carries out simultaneously, and archaeal dna polymerase is that a kind of strand displacement archaeal dna polymerase (Bst DNA polymerase) can be finished nucleic acid amplification reaction under constant temperature, amplifies LAMP characteristic scalariform band.The RT-LAMP technology has further strengthened the specificity of reaction and has shortened detection time on the basis that keeps the round pcr advantage; Particularly it need not use expensive thermal cycler, just can make reverse transcription and nucleic acid amplification finish simultaneously reaction under isothermal condition, and amplified production with the naked eye can observe, and can be used for the field quick detection of pathogenic micro-organism.
Summary of the invention
Problem for the prior art existence, the object of the invention is to design RT-LAMP detection kit that Macrobrachium rosenbergii bicistronic mRNA virus is provided and the technical scheme of detection method, this test kit high specificity, susceptibility is high, the method is convenient, sensitive, accurately, fast, for the prevention of Macrobrachium rosenbergii larvae syndromes lays the foundation.
The LAMP detection kit of described Macrobrachium rosenbergii bicistronic mRNA virus is characterized in that comprising that RNA extracts reagent and RT-LAMP reaction reagent,
Described RNA extract reagent contain Trizol reagent, chloroform, Virahol, without 70% ethanol and the DEPC water of RNase;
Described RT-LAMP reaction reagent contains:
1) RT-LAMP pre-reaction liquid: 20～25mM pH is 8.2～9.0 Tris-HC1,6～10mM sal epsom, 10～12mM Repone K, 8～12mM ammonium sulfate, 0.l～0.2% Triton X-100 or Tween 20,1～1.6 mM dNTP, 0.6～1.0 M trimethyl-glycine, 1.5～2.2 μ M primer MRDV-FIP, 1.5～2.2 μ M primer MRDV-BIP, 0.15～0.3 μ M primer MRDV-F3,0.15～0.3 μ M primer MRDV-B3
Primer MRDV-FIP nucleotide sequence shown in SEQ No.1,
Primer MRDV-BIP nucleotide sequence shown in SEQ No.2,
Primer MRDV-F3 nucleotide sequence shown in SEQ No.3,
Primer MRDV-B3 nucleotide sequence is shown in SEQ No.4;
2) reversed transcriptive enzyme: every microlitre contains the AMV reversed transcriptive enzyme of 10 activity units;
3) polysaccharase: every microlitre contains the Bst archaeal dna polymerase of 8 activity units;
4) RT-LAMP stable reaction liquid: formed by mineral oil or Witco 70;
5) RT-LAMP reaction solution liquid: the fluorescence dye that contains 10 % SYBR Green I.
The LAMP detection kit of described Macrobrachium rosenbergii bicistronic mRNA virus is characterized in that it is 8.2～9.0 Tris-HC1,7～9mM sal epsom, 11～12mM Repone K, 9～11mM ammonium sulfate, 0.l～0.2% Triton X-100 or Tween 20,1.2～1.4 mM dNTP, 0.7～0.9 M trimethyl-glycine, 1.6～2.0 μ M primer MRDV-FIP, 1.6～2.0 μ M primer MRDV-BIP, 0.2～0.25 μ M primer MRDV-F3,0.2～0.25 μ M primer MRDV-B3 that described RT-LAMP pre-reaction liquid contains 21～24mM pH.
The LAMP detection kit of described Macrobrachium rosenbergii bicistronic mRNA virus is characterized in that also containing in the described RT-LAMP pre-reaction liquid 0.6～1.2 μ M primer MRDV-LB and 0.6～1.2 μ M primer MRDV-LF,
Primer MRDV-LF nucleotide sequence shown in SEQ No.5,
Primer MRDV-LB nucleotide sequence is shown in SEQ No.6.
The LAMP detection kit of described Macrobrachium rosenbergii bicistronic mRNA virus, it is characterized in that detection kit also has positive control sample and negative control sample, described positive control sample is Macrobrachium rosenbergii bicistronic mRNA virus genome RNA, and described negative control sample is the free nucleic acid deionized water.
The LAMP detection kit of described Macrobrachium rosenbergii bicistronic mRNA virus is characterized in that also containing in the described RT-LAMP pre-reaction liquid 0.8～1.0 μ M primer MRDV-LB and 0.8～1.2 μ M primer MRDV-LF.
The LAMP detection method of described Macrobrachium rosenbergii bicistronic mRNA virus is characterized in that may further comprise the steps:
1) Macrobrachium rosenbergii RNA extracting: utilize RNA to extract reagent extracting Macrobrachium rosenbergii RNA;
2) RT-LAMP of Macrobrachium rosenbergii bicistronic mRNA virus amplification:
A) according to the number of detected sample, required RT-LAMP reaction tubes is set counts N, N=sample number+2, wherein l manages positive contrast, and l manages negative contrast;
B) volume of absorption RT-LAMP pre-reaction liquid is N * 22.5 μ L, add in the 1. 5mL centrifuge tubes, then add N μ L Bst archaeal dna polymerase and N/2 μ L AMV reversed transcriptive enzyme, mix, 1500～2000 rev/mins centrifugal 10 seconds, get the mixed solution of supernatant;
C) in N reaction tubes of above-mentioned setting, add respectively the mixed solution of 24 u L step b) gained, and in N reaction tubes, add respectively successively in order each l μ L of negative control, template ribonucleic acid to be checked and positive control RNA;
D) add respectively 30 u L RT-LAMP stable reaction liquid in each reaction tubes again, cover tightly the pipe lid and carry out mark, 2000 rev/mins centrifugal 5 seconds;
E). 61 ℃～67 ℃ lower isothermal reactions 40～70 minutes;
3) color developing detection:
Take out the RT-LAMP reaction tubes, be cooled to room temperature, 2000 rev/mins centrifugal 5 seconds, add respectively successively l μ L RT-LAMP reaction solution liquid according to the order of negative control, sample to be checked and positive control, mixing gently, colour-change directly detects by an unaided eye.
The LAMP detection method of described Macrobrachium rosenbergii bicistronic mRNA virus, it is characterized in that described step 1) Macrobrachium rosenbergii RNA extraction may further comprise the steps: get the Macrobrachium rosenbergii larvae cephalothorax or become the shrimp 0.1～0.2g of gill tissue, after grinding with grinding rod on ice, adding 300 μ L Trizol, continue to add Trizol to 1mL after the grinding fully, vortex concussion 1 minute, room temperature 5 minutes adds 200 μ L chloroforms, vortex concussion 30 seconds, room temperature left standstill 3 minutes, centrifugal 10 minutes of 12000g; Get the upper strata water in new EP pipe, add 500 μ L Virahols, room temperature was placed after 10 minutes, the centrifugal 10min of 12000g; Remove supernatant, precipitation is with 70% washing with alcohol 2 times, and is resuspended with the deionized water of DEPC processing behind drying at room temperature 5～10min, obtains Macrobrachium rosenbergii RNA to be measured.
Primer of the present invention is to get according to online software PrimerExplorer V4 (http://primerexplorer.jp/e/) design and manual the modification, eight different loci of these six primers energy specific recognition target sequences, increase the specificity of amplification, and in reaction, produced loop-stem structure.
Primer MRDV-FIP nucleotide sequence (SEQ No.1) is among the present invention: TCACGCAACACAAATTCTCGCTTTTTTCCACCTCCTTATCGCTCT;
Primer MRDV-BIP nucleotide sequence (SEQ No.2) is GGTTGCTCCATTGGCCAAGAACATTTTGCAACAACGCTTCCTGTG;
Primer MRDV-F3 nucleotide sequence (SEQ No.3) is CTGATGAAACAAAGAGTGGGTC;
Primer MRDV-B3 nucleotide sequence (SEQ No.4) is TTCAAACGAAGCAATCCGTG;
Primer MRDV-LF nucleotide sequence (SEQ No.5) is TTAGAAACGACACTTCAGACAA;
Primer MRDV-LB nucleotide sequence (SEQ No.6) is CGATTGAAGATATGTGTATGTGG.
Compared with prior art, the present invention has following advantage:
(1) the present invention has designed the detection of Macrobrachium rosenbergii bicistronic mRNA virus according to target-gene sequence and has used primer sets, and this target-gene sequence is shown in SEQ No.7.Eight isolated areas on the primer sets energy specific recognition target sequence that designs among the present invention, under the effect of BstDNA polysaccharase, start the endless chain replacement(metathesis)reaction, start complementary strand in target cDNA district synthetic, the complementary sequence stem one circular DNA mixture of the Cauliflower structure that is formed with a lot of rings that goes round and begins again on same chain, because the LAMP technology is only in the situation that four primers are identified six lands of target sequence fully could carry out smoothly, so primer sets of the present invention has reduced the background influence of amplified reaction to a great extent, greatly strengthened the specificity that Macrobrachium rosenbergii bicistronic mRNA virus detects;
(2) adopt primer sets of the present invention that Macrobrachium rosenbergii bicistronic mRNA virus is detected, because specificity is high, so the existence that can just can judge target gene according to whether increasing whether;
(3) quick diagnosis reagent kit of the present invention is to utilize reverse transcription loop-mediated isothermal amplification technique rapid detection Macrobrachium rosenbergii bicistronic mRNA virus, and detection sensitivity is high, and amplification template only needs 20 copies;
(4) not only reaction conditions is gentle for quick diagnosis reagent kit of the present invention, and required instrument is simple, does not also need special reagent, overcome normal PCR intrinsic detection time long, easily pollute and the shortcoming such as testing cost height;
(5) quick diagnosis reagent kit amplification of the present invention is quick and efficient, can finish amplification less than 1h, and productive rate is high;
(6) quick diagnosis reagent kit of the present invention is identified easy, be combined from the Mg2+ of pyrophosphate ion with reaction soln that dNTP separates out, produce by product---the magnesium pyrophosphate precipitation, can identify by visual inspection, and behind the adding nitrite ion, yin and yang attribute as a result colour development difference is remarkable, and the checking rate is high, and is more obviously reliable;
(7) quick diagnosis reagent kit of the present invention is simple to operate, and is lower to testing staff's technical quality requirement, can set up rapid screening system with low cost, realizes on-the-spot high-throughput rapid detection;
(8) quick diagnosis reagent kit of the present invention has been set up the reverse transcription loop-mediated isothermal amplification system of a cover through optimizing, not only so that Macrobrachium rosenbergii bicistronic mRNA virus qualitative detection is easier fast, specificity is high, highly sensitive, and this test kit is first test kit that detects Macrobrachium rosenbergii bicistronic mRNA virus, fill up the breach of Macrobrachium rosenbergii bicistronic mRNA virus without detection method, had very high scientific research and economic worth.
Description of drawings
Fig. 1 primer specificity test pattern;
M. 100bp DNA Marker; 1. the Macrobrachium rosenbergii bicistronic mRNA is viral; 2. M.rosenbergii Nodavirus (MRNV); 3. white spot syndrome virus (WSSV) (WSSV); Prawn infectious subcutaneous and hematopoietic tissue necrosis virus (IHHNV); 5. negative control.
Fig. 2 susceptibility detects figure;
M. 100bp DNA Marker; 1. 1.5 * 10
5Copies; 2. 1.5 * 10
4Copies; 3. 1.5 * 10
3Copies; 4.1.5 * 10
2Copies; 5.1.5 * 10
1Copies; 6.1.5 copies; 7. negative control.
Embodiment
Further specify the present invention below in conjunction with specific embodiment.
1) extract reagent extracting RNA (it is conventional reagent of the prior art that RNA extracts reagent, it contains Trizol reagent, chloroform, Virahol, without 70% ethanol and the DEPC water of RNase) with RNA:
Get the Macrobrachium rosenbergii larvae cephalothorax or become shrimp gill tissue 0.1,0.15 or 0.2g, after grinding with grinding rod on ice, adding 300 μ L Trizol, add Trizol to 1mL after continuing to grind fully, vortex concussion 1 minute, room temperature 5 minutes, add 200 μ L chloroforms, vortex concussion 30 seconds, room temperature left standstill 3 minutes, centrifugal 10 minutes of 12000g, get the upper strata water in new EP pipe, add 500 μ L Virahols, room temperature was placed after 10 minutes, the centrifugal 10min of 12000g; Remove supernatant, precipitation is with 70% washing with alcohol 2 times, drying at room temperature 5,8 or 10min after resuspended with the deionized water of DEPC processing, packing obtains carrying Macrobrachium rosenbergii RNA, puts-80 ℃ of preservations.
2) reverse transcription ring mediated isothermal amplification Macrobrachium rosenbergii bicistronic mRNA virus specific gene district
A) according to the number of detected sample, required RT-LAMP reaction tubes is set counts N(N more than or equal to 1), N=sample number+l pipe positive control+l manages negative control;
B) (it is 8.2～9.0 Tris-HC1 that RT-LAMP pre-reaction liquid contains 20～25mM pH to draw RT-LAMP pre-reaction liquid, 6～10mM sal epsom, 10～12mM Repone K, 8～12mM ammonium sulfate, 0.l～0.2% Triton X-100 or Tween 20,1～1.6 mM dNTP, 0.6～1.0 M trimethyl-glycines, 1.5～2.2 μ M primer MRDV-FIP, 1.5～2.2 μ M primer MRDV-BIP, 0.15～0.3 μ M primer MRDV-F3,0.15～0.3 μ M primer MRDV-B3, primer MRDV-FIP nucleotide sequence is shown in SEQ No.1, primer MRDV-BIP nucleotide sequence is shown in SEQ No.2, primer MRDV-F3 nucleotide sequence is shown in SEQ No.3, primer MRDV-B3 nucleotide sequence is shown in SEQ No.4) volume be N * 22.5 μ L, add in the 1. 5mL centrifuge tubes of a cleaning, then add N μ L Bst archaeal dna polymerase (every microlitre contains the Bst archaeal dna polymerase of 8 activity units) and N/2 μ L AMV reversed transcriptive enzyme (every microlitre contains the AMV reversed transcriptive enzyme of 10 activity units), mix, 1500,1800 or 2000 rev/mins centrifugal 10 seconds, get the mixed solution of supernatant;
C) in N the reaction tubes of setting, add respectively the above-mentioned mixed solution of 24 μ L, in above-mentioned N PCR reaction tubes, add respectively successively in order each l μ L of negative control (free nucleic acid deionized water), template ribonucleic acid to be checked and positive control (Macrobrachium rosenbergii bicistronic mRNA virus genome RNA) again;
D) then in above-mentioned each reaction tubes, add respectively again 30 μ L PT-LAMP stable reaction liquid (being formed by mineral oil or Witco 70), 2000 rev/mins centrifugal 5 seconds, cover tightly pipe lid and carry out mark;
E) 61 ℃, 63 ℃, 65 ℃ or 67 ℃ of lower isothermal reactions 40,50,60 or 70 minutes, then at 80 ℃ of deactivation 5min.
3) take out the RT-LAMP reaction tubes, be cooled to room temperature, 2000 rev/mins centrifugal 5 seconds, order according to negative control, sample to be checked and positive control adds respectively l μ LPT-LAMP reaction solution liquid (fluorescence dye that contains 10 % SYBR Green I) successively, mixing gently, the colour-change that directly detects by an unaided eye or carry out using ethidium bromide staining behind the electrophoresis with 1.5% sepharose.
RT-LAMP pre-reaction liquid electrophoresis result is observed under uv analyzer, can find stair-stepping expansion band, and Macrobrachium rosenbergii bicistronic mRNA virus is arranged in the interpret sample.
Also can to adopt 21～24mM pH be 8.2～9.0 Tris-HC1,7～9mM sal epsom, 11～12mM Repone K, 9～11mM ammonium sulfate, 0.l～0.2% Triton X-100 or Tween 20,1.2～1.4 mM dNTP, 0.7～0.9 M trimethyl-glycine, 1.6～2.0 μ M primer MRDV-FIP, 1.6～2.0 μ M primer MRDV-BIP, 0.2～0.25 μ M primer MRDV-F3,0.2～0.25 μ M primer MRDV-B3 to RT-LAMP pre-reaction liquid among the embodiment 1;
Or to adopt 20～25mM pH be 8.2～9.0 Tris-HC1,6～10mM sal epsom, 10～12mM Repone K, 8～12mM ammonium sulfate, 0.l～0.2% Triton X-100 or Tween 20,1～1.6 mM dNTP, 0.6～1.0 M trimethyl-glycines, 1.5～2.2 μ M primer MRDV-FIP, 1.5～2.2 μ M primer MRDV-BIP, 0.15～0.3 μ M primer MRDV-F3,0.15～0.3 μ M primer MRDV-B3,0.6～1.2 μ M primer MRDV-LB and 0.6～1.2 μ M primer MRDV-LF, primer MRDV-LF nucleotide sequence is shown in SEQ No.5, and primer MRDV-LB nucleotide sequence is shown in SEQ No.6.
Adopt above-mentioned quick diagnosis reagent kit and method to carry out RT-LAMP and detect Macrobrachium rosenbergii bicistronic mRNA virus-specific and susceptibility test-results shown in attached Fig. 1 and 2.
Fig. 1 primer species specificity test pattern, shown in 1 figure, only Macrobrachium rosenbergii bicistronic mRNA virus can amplify stair-stepping expansion band, and other virus shows other virus without intersecting amplification property without stair-stepping expansion band.
Fig. 2 Macrobrachium rosenbergii bicistronic mRNA virus susceptibility detects figure, as shown in the figure, the expansion band of the Macrobrachium rosenbergii bicistronic mRNA viral RNA serial dilution after Real-time PCR is quantitative shows, adds the RNA of 15 virus copies in reaction system, just can amplify the feature band.
The present invention utilizes reverse transcription loop-mediated isothermal amplification technique rapid detection Macrobrachium rosenbergii bicistronic mRNA Detecting method, detects in tested 4 kinds of viruses not of the same race, and the result can both reach the technique effect identical with embodiment 1.
SEQUENCE LISTING
＜110〉Zhejiang Institute of Fresh Water Aquatic Products
＜120〉LAMP detection kit and the detection method of Macrobrachium rosenbergii bicistronic mRNA virus
<130> 1
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 45
<212> DNA
＜213〉artificial sequence
<400> 1
tcacgcaaca caaattctcg cttttttcca cctccttatc gctct 45
<210> 2
<211> 45
<212> DNA
＜213〉artificial sequence
<400> 2
ggttgctcca ttggccaaga acattttgca acaacgcttc ctgtg 45
<210> 3
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 3
ctgatgaaac aaagagtggg tc 22
<210> 4
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 4
ttcaaacgaa gcaatccgtg 20
<210> 5
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 5
ttagaaacga cacttcagac aa 22
<210> 6
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 6
cgattgaaga tatgtgtatg tgg 23
<210> 7
<211> 203
<212> DNA
＜213〉Macrobrachium rosenbergii bicistronic mRNA virus
<400> 7
ctgatgaaac aaagagtggg tctccacctc cttatcgctc tttgtctgaa gtgtcgtttc 60
taaagcgaga atttgtgttg cgtgattcat tttgggttgc tccattggcc aagaacacga 120
ttgaagatat gtgtatgtgg agtaggaaga atattgaacc acaggaagcg ttgttgcaaa 180
caacacggat tgcttcgttt gaa 203
Claims (6)
1. the LAMP detection kit of Macrobrachium rosenbergii bicistronic mRNA virus is characterized in that comprising that RNA extracts reagent and RT-LAMP reaction reagent,
Described RNA extract reagent contain Trizol, chloroform, Virahol, without 70% ethanol and the DEPC water of RNase;
Described RT-LAMP reaction reagent contains:
1) RT-LAMP pre-reaction liquid: 20～25mM pH is 8.2～9.0 Tris-HC1,6～10mM sal epsom, 10～12mM Repone K, 8～12mM ammonium sulfate, 0.l～0.2% Triton X-100,1～1.6 mM dNTP, 0.6～1.0 M trimethyl-glycines, 1.5～2.2 μ M primer MRDV-FIP, 1.5～2.2 μ M primer MRDV-BIP, 0.15～0.3 μ M primer MRDV-F3,0.15～0.3 μ M primer MRDV-B3,0.6～1.2 μ M primer MRDV-LB and 0.6～1.2 μ M primer MRDV-LF
Primer MRDV-FIP nucleotide sequence shown in SEQ No.1,
Primer MRDV-BIP nucleotide sequence shown in SEQ No.2,
Primer MRDV-F3 nucleotide sequence shown in SEQ No.3,
Primer MRDV-B3 nucleotide sequence shown in SEQ No.4,
Primer MRDV-LF nucleotide sequence shown in SEQ No.5,
Primer MRDV-LB nucleotide sequence is shown in SEQ No.6;
2) reversed transcriptive enzyme: every microlitre contains the AMV reversed transcriptive enzyme of 10 activity units;
3) polysaccharase: every microlitre contains the Bst archaeal dna polymerase of 8 activity units;
4) RT-LAMP stable reaction liquid: formed by mineral oil or Witco 70;
5) RT-LAMP reaction solution liquid: the fluorescence dye that contains 10 % SYBR Green I.
2. the LAMP detection kit of Macrobrachium rosenbergii bicistronic mRNA virus as claimed in claim 1 is characterized in that it is 8.2～9.0 Tris-HC1 that described RT-LAMP pre-reaction liquid contains 21～24mM pH, 7～9mM sal epsom, 11～12mM Repone K, 9～11mM ammonium sulfate, 0.l～0.2% Triton X-100,1.2～1.4 mM dNTP, 0.7～0.9 M trimethyl-glycine, 1.6～2.0 μ M primer MRDV-FIP, 1.6～2.0 μ M primer MRDV-BIP, 0.2～0.25 μ M primer MRDV-F3,0.2～0.25 μ M primer MRDV-B3,0.8～1.0 μ M primer MRDV-LB and 0.8～1.2 μ M primer MRDV-LF.
3. the LAMP detection kit of Macrobrachium rosenbergii bicistronic mRNA virus as claimed in claim 1 or 2, it is characterized in that detection kit also has positive control sample and negative control sample, described positive control sample is Macrobrachium rosenbergii bicistronic mRNA virus genome RNA, and described negative control sample is the free nucleic acid deionized water.
4. the LAMP detection kit of Macrobrachium rosenbergii bicistronic mRNA virus is characterized in that comprising that RNA extracts reagent and RT-LAMP reaction reagent,
Described RNA extract reagent contain Trizol, chloroform, Virahol, without 70% ethanol and the DEPC water of RNase;
Described RT-LAMP reaction reagent contains:
1) RT-LAMP pre-reaction liquid: 20～25mM pH is 8.2～9.0 Tris-HC1,6～10mM sal epsom, 10～12mM Repone K, 8～12mM ammonium sulfate, 0.l～0.2% Tween 20,1～1.6 mM dNTP, 0.6～1.0 M trimethyl-glycines, 1.5～2.2 μ M primer MRDV-FIP, 1.5～2.2 μ M primer MRDV-BIP, 0.15～0.3 μ M primer MRDV-F3,0.15～0.3 μ M primer MRDV-B3,0.6～1.2 μ M primer MRDV-LB and 0.6～1.2 μ M primer MRDV-LF
Primer MRDV-FIP nucleotide sequence shown in SEQ No.1,
Primer MRDV-BIP nucleotide sequence shown in SEQ No.2,
Primer MRDV-F3 nucleotide sequence shown in SEQ No.3,
Primer MRDV-B3 nucleotide sequence shown in SEQ No.4,
Primer MRDV-LF nucleotide sequence shown in SEQ No.5,
Primer MRDV-LB nucleotide sequence is shown in SEQ No.6;
2) reversed transcriptive enzyme: every microlitre contains the AMV reversed transcriptive enzyme of 10 activity units;
3) polysaccharase: every microlitre contains the Bst archaeal dna polymerase of 8 activity units;
4) RT-LAMP stable reaction liquid: formed by mineral oil or Witco 70;
5) RT-LAMP reaction solution liquid: the fluorescence dye that contains 10 % SYBR Green I.
5. the LAMP detection kit of Macrobrachium rosenbergii bicistronic mRNA virus as claimed in claim 4 is characterized in that it is 8.2～9.0 Tris-HC1 that described RT-LAMP pre-reaction liquid contains 21～24mM pH, 7～9mM sal epsom, 11～12mM Repone K, 9～11mM ammonium sulfate, 0.l～0.2% Tween 20,1.2～1.4 mM dNTP, 0.7～0.9 M trimethyl-glycine, 1.6～2.0 μ M primer MRDV-FIP, 1.6～2.0 μ M primer MRDV-BIP, 0.2～0.25 μ M primer MRDV-F3,0.2～0.25 μ M primer MRDV-B3,0.8～1.0 μ M primer MRDV-LB and 0.8～1.2 μ M primer MRDV-LF.
6. such as the LAMP detection kit of claim 4 or 5 described Macrobrachium rosenbergii bicistronic mRNA viruses, it is characterized in that detection kit also has positive control sample and negative control sample, described positive control sample is Macrobrachium rosenbergii bicistronic mRNA virus genome RNA, and described negative control sample is the free nucleic acid deionized water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110239776 CN102277453B (en) | 2011-08-19 | 2011-08-19 | Loop-mediated isothermal amplification (LAMP) detection kit and LAMP detection method for macrobrachium rosenbergii bicistronic virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110239776 CN102277453B (en) | 2011-08-19 | 2011-08-19 | Loop-mediated isothermal amplification (LAMP) detection kit and LAMP detection method for macrobrachium rosenbergii bicistronic virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102277453A CN102277453A (en) | 2011-12-14 |
| CN102277453B true CN102277453B (en) | 2013-04-03 |
Family
ID=45103180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110239776 Active CN102277453B (en) | 2011-08-19 | 2011-08-19 | Loop-mediated isothermal amplification (LAMP) detection kit and LAMP detection method for macrobrachium rosenbergii bicistronic virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102277453B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102796829B (en) * | 2012-08-24 | 2014-04-16 | 浙江省淡水水产研究所 | LAMP detection kit for macrobrachium rosenbergii nudivirus and detection method thereof |
| CN105803115A (en) * | 2016-04-28 | 2016-07-27 | 中国科学院南海海洋研究所 | Novel and practical litopenaeus vannamei RNA (ribonucleic acid) virus fast detection kit and detection method |
| CN107058587A (en) * | 2017-06-08 | 2017-08-18 | 浙江省淡水水产研究所 | A kind of sub- worm visualization quick detection kit of Macrobrachium rosenbergii micella and its detection method |
| CN107254527B (en) * | 2017-06-26 | 2021-03-26 | 浙江省淡水水产研究所 | Visual rapid detection kit and method for macrobrachium rosenbergii spiroplasma |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009183228A (en) * | 2008-02-07 | 2009-08-20 | Univ Of Miyazaki | Method for detecting pathogenic virus of crustacean by lamp method and detection reagent kit |
| CN101418352B (en) * | 2008-12-09 | 2012-09-05 | 苏州大学 | Shrimp white spot syndrome virus detection reagent kit |
| CN101418351B (en) * | 2008-12-09 | 2011-08-31 | 苏州大学 | Shrimp white spot syndrome virus detection reagent kit and detecting method |
| CN101838677B (en) * | 2010-06-09 | 2013-06-12 | 苏州大学 | Preparation method of shrimp white spot syndrome virus disease nucleic acid sample and shrimp white spot syndrome virus detection method |
-
2011
- 2011-08-19 CN CN 201110239776 patent/CN102277453B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102277453A (en) | 2011-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102277453B (en) | Loop-mediated isothermal amplification (LAMP) detection kit and LAMP detection method for macrobrachium rosenbergii bicistronic virus | |
| CN102559935A (en) | M-gene based fluorescent RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection method of Nipah virus | |
| CN104450961A (en) | Kit for detecting grass carp reovirus types I, II and III based on RT-LAMP visualization technology and method for detecting grass carp reovirus types I, II and III | |
| CN102796829B (en) | LAMP detection kit for macrobrachium rosenbergii nudivirus and detection method thereof | |
| CN110592268A (en) | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) | |
| CN103509880A (en) | LAMP detection kit of highly-pathogenic porcine reproductive and respiratory syndrome viruses | |
| CN102382903B (en) | Real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent and detection method for lupulus masking virus | |
| CN102071263B (en) | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection reagent for avian influenza virus (AIV) H5 subtype and detection kit | |
| CN102277445A (en) | PRRS RT-LAMP detection method and detection kit | |
| CN104419713A (en) | Loop-mediated isothermal amplification based human respiratory syncytial virus detection kit | |
| CN101748197A (en) | Target sequence for detection of yersinia enterocolitica and kit | |
| CN102618666A (en) | Multiplex polymerase chain reaction (PCR) detection primers for simultaneously detecting canine distemper virus, canine parvovirus, type I canine adenovirus and type II canine adenovirus | |
| CN101348835A (en) | Reagent kit for detecting vibrio vulnificus by loop-mediated isothermal amplification technology | |
| CN103184298A (en) | Primer for detecting infectious bronchitis viruses, detection method and kit | |
| CN103397108A (en) | HCLV (hog cholera lapinized virus) fluorescent quantitation RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN110714096A (en) | Kit for simultaneously detecting 4 dengue fever virus types | |
| CN105331746A (en) | Duck flavivirus RT-LAMP detection kit | |
| CN110592269A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type 2 virus (GCRV-2) | |
| CN104975109A (en) | Elsinoe ampelina LAMP (loop-mediated isothermal amplification) detection primer set and detection method thereof | |
| CN114381551A (en) | Real-time fluorescent RAA primer, probe and kit for detecting iridovirus of micropterus salmoides | |
| CN110894546A (en) | RAA constant temperature fluorescence detection method and reagent for fish viral nervous necrosis disease virus (VNNV) | |
| CN110592274A (en) | RAA constant temperature fluorescence detection method and reagent for Large Yellow Croaker Iridovirus (LYCIV) | |
| CN107227380A (en) | The primer sequence and method of a kind of synchronous detection PCV2 and PRV infection | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |