CN111534634A - Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof - Google Patents
Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof Download PDFInfo
- Publication number
- CN111534634A CN111534634A CN202010095654.2A CN202010095654A CN111534634A CN 111534634 A CN111534634 A CN 111534634A CN 202010095654 A CN202010095654 A CN 202010095654A CN 111534634 A CN111534634 A CN 111534634A
- Authority
- CN
- China
- Prior art keywords
- type
- canine adenovirus
- detected
- detecting
- reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a visualized isothermal amplification detection reagent for type II canine adenovirus (CAV-2), relating to the technical field of virus detection, wherein a specific LAMP primer is designed and synthesized according to a CAV-2 gene conserved region, and comprises an upstream inner primer FIP, a downstream inner primer BIP, an upstream outer primer F3 and a downstream outer primer B3, and the detection reagent further comprises the following components of 10 × reaction buffer solution, dNTPs and Mg2+Bst DNA polymerase, deionized water, a color reagent and the primer. The detection reagent provided by the invention has the advantages of strong specificity, high sensitivity, simple and convenient operation, low cost and the like when being applied.
Description
Technical Field
The invention relates to the technical field of virus detection, in particular to a visual isothermal amplification detection reagent for type II canine adenovirus and application thereof.
Background
Canine Adenovirus (CAV) is one of the members of the adenovirus genus of mammalian belonging to the family adenoviridae, and is a capsule-free particle with a diameter of 80-110nm, and the capsid protein of the particle is in a 20-hedral structure. CAV-2 infection is widely prevalent in canines, mainly causing infectious laryngotracheitis and enteritis in canines, with the highest rate of infection in canines from three months to one year old. Due to this age, the level of maternal antibodies in puppies drops, coupled with environmental pollution and untimely prevention, and once infected, can cause significant damage to the body. After infection, it is often manifested as high fever, cough, serous to myxoid rhinorrhea, tonsillitis, laryngotracheitis and pneumonia. The pathological changes of the liver are manifested by atelectasis of lung, congestion, bleeding spots, liver pathological changes of different degrees, hepatomegaly, cellulosic exudates, congestion of bronchial lymph nodes and blood stasis. When CAV-2 is mixed with Canine Distemper Virus (CDV) or other viral diseases, secondary symptoms are easily caused, and the death risk of a host is increased. The CAV-2 virus infection animal model is used for researching the effect of virus important genes in the virus infection process and screening strains, and provides important basis for researching the pathogenesis of the II type canine adenovirus disease and evaluating and predicting the curative effect of antiviral drugs.
Nucleic acid amplification is one of the most commonly used methods in genetic diagnosis technology, and the current methods for nucleic acid amplification include Polymerase Chain Reaction (PCR), nucleic acid sequence dependent amplification (NASBA), self-sustained Sequence Replication (SR), and strand displacement technology (SDA), all of which can rapidly amplify a micro-sample, but have disadvantages in terms of specificity, simplicity, temperature, and requirements for reagents and instruments. The prior art has the defects of low efficiency, difficult operation, high cost and difficult popularization in practical production in the common detection of II type canine adenovirus research.
Disclosure of Invention
The invention aims to provide a visual isothermal amplification detection reagent for type II canine adenovirus and application thereof, which shortens the detection time, improves the specificity and sensitivity, improves the convenience of operation and reduces the cost.
In particular, the invention provides a visualized isothermal amplification primer set for detecting canine adenovirus type II, wherein the primer set consists of the following primers:
an upstream inner primer FIP:
CGAGGGCATTGTAGGCGGTG-GAATTC-GGGTACCCTAGACAGAGGC；
the downstream inner primer BIP:
CCAAGGCCGGGGCTAACAAC-GGCACCTGGGCTAAAGTG；
the upstream outer primer F3: GCTGGACATGGCCAGTAC, respectively;
downstream outer primer B3: TCACAGTTATGGCACCTGC, respectively;
accelerating upstream circular primer LF1: CCGCTGTAAGGCTTGAAGGAG
Accelerating the downstream circular primer LB1: CTTTTTAATGGACAGGGTGCCAATA.
A visualized isothermal amplification detection reagent for type II canine adenovirus is a visualized isothermal detection reagent for type II canine adenovirus, and comprises the primer group.
Preferably, the reagent also comprises the following components of 10 × reaction buffer solution, dNTPs and Mg2+BstDNA polymerase, deionized water, template DNA and a color reagent.
Preferably, Mg in said reagent2+Has a concentration of 6 mmol. L-1。
Preferably, the concentration of dNTPs in the reagent is 1.5 mmol.L-1(ii) a Preferably, the color reagent in the reagent is a mixed indicator of phenol red and cresol red.
Preferably, the reagent further comprises a positive control.
A visual isothermal amplification detection kit for type II canine adenovirus is a visual isothermal amplification detection kit for type II canine adenovirus, and is characterized in that: the kit comprises any one of the preferable visual isothermal amplification detection reagents.
The use of the detection reagent according to any one of the above or the detection kit according to any one of the following conditions:
firstly, detecting or detecting the type II canine adenovirus without the aim of diagnosing and treating diseases;
secondly, preparing a product for detecting or assisting in detecting the type II canine adenovirus;
thirdly, detecting or assisting to detect whether the animal sample to be detected is infected with the type II canine adenovirus or not by taking the diagnosis and treatment of the disease as the aim;
fourthly, preparing a product for detecting or assisting in detecting whether the animal sample to be detected is infected with the type II canine adenovirus;
fifthly, detecting whether the virus to be detected is the type II canine adenovirus without aiming at the diagnosis and treatment of diseases;
and sixthly, preparing a product for detecting or assisting in detecting whether the virus to be detected is the type II canine adenovirus.
A method for detecting or assisting in detecting whether a sample of an animal to be detected is infected with canine adenovirus type II, which is not aimed at the diagnosis and treatment of diseases, comprises the following steps:
the reaction steps are as follows: extracting genome DNA from a swab sample of anus, saliva or lacrimal gland secretion of an animal to be detected as a template, and carrying out loop-mediated isothermal amplification by adopting the detection reagent or the detection kit to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: keeping the temperature at 63 ℃ and reacting for 40 min;
a confirmation step: determining whether the animal sample to be tested is infected with the canine adenovirus II according to any one of the following methods:
A. if the amplified product is orange yellow, the animal sample to be detected is infected with the type II canine adenovirus; if the amplification product presents purple red, the animal sample to be detected is not infected with the type II canine adenovirus;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and then the animal sample to be detected is infected with the type II canine adenovirus; only one primer strip is present, so that the animal sample to be detected is not infected with the type II canine adenovirus.
A method for detecting or assisting in detecting canine adenovirus type II as a virus to be detected, which is not aimed at diagnosis and treatment of diseases, comprises the following steps:
the reaction steps are as follows: extracting genome DNA from a virus to be detected as a template, and performing loop-mediated isothermal amplification by using the detection reagent or the detection kit to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: keeping the temperature at 63 ℃ and reacting for 40 min;
a confirmation step: determining whether the virus to be detected is canine adenovirus type II according to any one of the following methods:
A. if the amplification product is orange yellow, the virus to be detected is the type II canine adenovirus; if the amplification product presents purple red, the virus to be detected is not the II type canine adenovirus;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and the animal virus to be detected is type II canine adenovirus; only one primer strip is present, the virus to be detected is not the type II canine adenovirus.
The invention provides a visual isothermal amplification detection reagent for type II canine adenovirus and application thereof, and the visual isothermal amplification detection reagent mainly has the following beneficial effects:
1. the invention uses two pairs of specific primers and four recognition regions, and has higher specificity compared with the existing detection method.
2. The loop-mediated isothermal kit for detecting the type II canine adenovirus has high sensitivity: after 10 times of progressive dilution is carried out on extracted canine adenovirus II DNA to be used as an LAMP reaction template, the same template concentration is used for detection by a PCR method, and the result shows that: the LAMP method is at least 10 times higher than the conventional PCR amplification method. Therefore, the LAMP method has higher sensitivity.
3. The loop-mediated isothermal kit for detecting the type II canine adenovirus has high specificity: the clinically common canine viral diseases are: CPV (canine parvovirus) and CACV (canine circovirus), CDV (canine distemper virus), CRCoV (canine coronavirus) and CBOV (canine bocavirus) are respectively used as detection objects, and only CAV-2 is positive and has high specificity when the detection is carried out by using the method provided by the invention.
4. The loop-mediated isothermal reagent for detecting the type II canine adenovirus has the advantages of rapidness: compared with the reaction time and the detection time of a plurality of hours of the common PCR reaction, the detection method can complete the whole reaction and result judgment only by 1 hour.
5. The loop-mediated isothermal reagent for detecting the type II canine adenovirus has the operability: compared with the conventional PCR, the loop-mediated isothermal amplification detection kit for the type II canine adenovirus does not need an expensive PCR instrument, and can complete the reaction only by a simple constant-temperature water bath; and the detection of the result can be directly judged by naked eyes without special instruments such as gel electrophoresis and the like, so the kit has stronger operability.
6. The detection method is easy to operate, low in cost and widely applicable.
The above and other objects, advantages and features of the present invention will become more apparent to those skilled in the art from the following detailed description of specific embodiments thereof, taken in conjunction with the accompanying drawings.
Drawings
Some specific embodiments of the invention will be described in detail hereinafter, by way of illustration and not limitation, with reference to the accompanying drawings. The same reference numbers in the drawings identify the same or similar elements or components. Those skilled in the art will appreciate that the drawings are not necessarily drawn to scale. In the drawings:
FIG. 1 shows the result of the color change of the LAMP-amplified nucleic acid dye in the conserved CAV-2 gene region (the dye is added before reaction), a and b respectively show that the result of LAMP amplification can be observed by naked eyes, the positive tube of a is orange yellow under natural light, and the negative tube of b keeps purple red.
FIG. 2 is a diagram showing CAV-2LAMP reaction specificity test.
FIG. 3 is a restriction enzyme analysis result diagram of CAV-2LAMP reaction product.
FIG. 4 is a diagram showing CAV-2LAMP reaction sensitivity test.
FIG. 5 is a diagram of a sensitivity test of CAV-2 conventional PCR reaction.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples are commercially available unless otherwise specified.
The loop-mediated isothermal amplification technology related to the research can amplify DNA fragments with very low copy number to 10 within 1h under the isothermal condition of a water bath environment9And (4) copying. During the reaction, due to Mg in the reaction solution2+The reaction product is combined with pyrophosphate ions precipitated from dNTP to produce a white precipitate of magnesium pyrophosphate as a by-product, so that the result can be judged only by visual observation or turbidity detection by a turbidimeter, and the turbidimeter can also quantify the starting template. The loop-mediated isothermal amplification technology is characterized in that 2 pairs of special primers (outer primers F3, B3; inner primers FIP, BIP) corresponding to 6 gene segments in a target sequence are respectively used, the strand displacement activity of BstDNApolymerase during DNA extension is utilized to carry out strand displacement amplification on a target segment, the pre-denaturation and annealing of a double-stranded DNA template and a complicated cyclic temperature change process are not needed, the nucleic acid amplification can be completed in dozens of minutes under the constant temperature condition (about 61-63 ℃) in the whole reaction, and the amplification efficiency is generally as high as 109-1010The large number of nucleic acid products allows the reaction results to be directly observed by naked eyes by adding a nucleic acid dye to the final product.
1. Reagent related materials
Virus genome DNA/RNA extraction kit (Beijing Quanjin Biotechnology limited), Betaine (SIGMA corporation), BstDNA polymerase and 10 × reaction buffer (Biolabs Inc.), dNTP (Clontech corporation), Mg2+And DL2000 (TAKARA). The color reagent is 0.025 mmol.L-1Phenol Red and 0.08 mmol. L-1Cresol red mixed staining solutions, all purchased from Solarbio, inc.
2. Design and synthesis of LAMP primers
Referring to the currently published CAV-2 sequence, aiming at the conserved region of the CAV-2 virus, 4 primers (F1c and B1c are respectively reverse-complementary to the F1 region and the B1 region at the downstream of amplification to facilitate the loop formation and strand displacement reaction) are respectively designed by using online design software Primer Explorer V4, wherein the primers comprise an upstream inner Primer FIP (FIP is composed of F1c, F2 and GAATTC (EcoRI cleavage site sequence) as a linker), a downstream inner Primer BIP (BIP is composed of B1c and B2), and the sequences of the upstream outer Primer F3 and the downstream outer Primer B3 are respectively as follows:
an upstream inner primer FIP:
CGAGGGCATTGTAGGCGGTG-GAATTC-GGGTACCCTAGACAGAGGC；
the downstream inner primer BIP:
CCAAGGCCGGGGCTAACAAC-GGCACCTGGGCTAAAGTG；
the upstream outer primer F3: GCTGGACATGGCCAGTAC, respectively;
downstream outer primer B3: TCACAGTTATGGCACCTGC, respectively;
accelerating upstream circular primer LF1: CCGCTGTAAGGCTTGAAGGAG
Accelerating downstream circular primer LB1: CTTTTTAATGGACAGGGTGCCAATA
Wherein:
FIP consists of F1c and F2 and GAATTC (EcoRI cleavage site sequence);
BIP consists of B1c and B2.
F1c：CGAGGGCATTGTAGGCGGTG；
F2：GGGTACCCTAGACAGAGGC
B1c：CCAAGGCCGGGGCTAACAAC；
B2：GGCACCTGGGCTAAAGTG。
TABLE 1 primers for LAMP detection of CAV-2 (Canine adenovirus type II)
The designed primer was synthesized by Beijing Olympic bioengineering company, and the synthesized primer was diluted with ultrapure water to a solution of 10mmol/mL and stored at-20 ℃.
3. Viral genome extraction
Viral genome DNA/RNA extraction kit of Beijing Quanji biotechnology limited is used to extract viral genome DNA of cell culture type II canine adenovirus liquid, diseased animal tissue sample suspected of being infected by type II canine adenovirus and specific control virus sample.
4. Establishment of LAMP reaction system of canine adenovirus type II
The reagent for detecting the canine adenovirus II comprises the following components (M ═ mol. L)-1)：
Wherein, the positive control is the genome DNA of the canine adenovirus II sample.
Mixing the above components, and placing in PCR instrument or water bath at constant temperature of 63 deg.C for 40 min; after the reaction is finished, the amplification product can be detected by electrophoresis of 2% agarose gel (containing 0.5 mu g/mL ethidium bromide) under the electrophoresis conditions of 80V and 30 min; the color change of the product can be directly observed by naked eyes, and the two judgment results are consistent. When observed by naked eyes, a positive result is displayed as orange yellow, and a negative result is displayed as purple red.
The LAMP detection result is shown in FIG. 1, and a and b in FIG. 1 respectively show that the LAMP amplification result can be observed by naked eyes, the positive tube is orange yellow under natural light, and the negative tube keeps purple red.
FIG. 1 is a graph showing the result of color change of LAMP with a nucleic acid dye added before the reaction. Wherein a: a positive amplification product; b: and (5) negative control.
5. Optimization of LAMP detection method conditions of type II canine adenovirus
5.1 reaction time optimization
Preparing a reaction system, setting 3 times of samples under each time condition for repetition, respectively reacting in a constant-temperature water bath kettle for 30min, 40min, 50min and 60min, then taking out, respectively taking 5 mu L of products after all reaction products are taken out, and detecting the reaction products by electrophoresis of 2% agarose gel (containing 0.5 mu g/mL ethidium bromide).
5.2 optimization of the reaction temperature
Configuring a reaction system, setting 3 times of repetition for each temperature condition sample, respectively reacting for 40min at five reaction temperatures of 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃ and 63 ℃, and after the reaction is finished, respectively taking 5 mu L of products to carry out electrophoresis detection on 2% agarose gel (containing 0.5 mu g/mL ethidium bromide).
5.3 optimization of the concentration of the important Components in the reaction
In a 25 mu L reaction system, the concentration of the primer, the enzyme unit required by the reaction and the concentration of the template are unchanged, and the component MgSO is changed4Concentration of (2), groping MgSO4Effect of concentration on amplification efficiency, the addition amounts were 7mM, 6mM, 5mM, 4mM, 3mM, 2mM, 1mM, 0mM in this order, and 3 replicates were set for each concentration gradient. After all the concentration gradient reactions are finished, carrying out 2% agarose gel electrophoresis detection; reaction system optimization to set up different dNTPs concentration, its gradient is set up as 1.8mM, 1.5mM, 1.2mM, 0.9mM, 0.6mM, all group reactions are set up as negative control with deionized water as template, each concentration gradient is set up 3 times. And (5) after all the concentration gradient reactions are finished, carrying out 2% agarose gel electrophoresis detection.
6. Optimization result of LAMP detection method for canine adenovirus type II
6.1 reaction time optimization results: when the reaction time is different, electrophoresis bands become more and more obvious along with the time extension, and the result is optimal when the electrophoresis bands are reacted in a constant-temperature water bath kettle for 60 min.
6.2 reaction temperature optimization results: when the reaction temperature is different, the difference of the electrophoresis band brightness can occur, and the effect is best when the reaction is carried out at 63 ℃.
6.3 optimization results of the concentrations of each important component in the reaction:
when MgSO4When the concentration is different, the brightness difference of electrophoresis bands appears, and when MgSO is different4The effect is best when the concentration is 6 mM.
When the concentration of dNTPs is different, the difference of the brightness of an electrophoresis band can appear, and when the concentration of dNTPs is 1.5mM, the effect is best.
6.4 optimization of the System and conditions
Through the optimization of the conditions, the finally optimized system of the visual isothermal amplification detection kit for the type II canine adenovirus is as follows:
the reaction condition of the loop-mediated isothermal amplification is that the reaction is carried out for 1h at 63 ℃.
The kit for detecting the II type canine adenovirus visual isothermal amplification of the 6.225 mu L detection system comprises the following components:
7. specificity test of LAMP
Clinically common canine viral diseases: DNA obtained from Canine Parvovirus (CPV), Canine Distemper Virus (CDV), canine adenovirus I (CAV-1), canine circovirus (CACV) and Canine Bocavirus (CBOV) or cDNA obtained by reverse transcription are used as detection objects, LAMP detection is carried out by using CAV-2 primers to verify the specificity of the reaction, positive control is set, and the result is shown in figure 2.
The LAMP detection reaction system comprises the following components:
wherein the II-type canine adenovirus template DNA is II-type canine adenovirus genome DNA extracted by using a virus DNA/RNA extraction kit.
The amplification result shows that only the positive control has a diffuse band, and other 5 viruses do not appear, which indicates that no positive amplification exists when other viruses are taken as templates, and the CAV-2LAMP primer designed by the invention has high specificity.
FIG. 2 is a diagram showing CAV-2LAMP reaction specificity test. Wherein M: DNA molecular weight standard DL 2000; lanes 1-6 show the results of detection of Canine Parvovirus (CPV), Canine Distemper Virus (CDV), canine adenovirus I (CAV-1), canine circovirus (CACV), Canine Bocavirus (CBOV) and CAV-2 by CAV-2LAMP specific primers, respectively.
7.1 enzyme digestion identification of amplification products
In order to further verify the specificity of the amplification reaction, the product after LAMP reaction is subjected to enzyme digestion identification, the following components are added into a 20-mu-L reaction system, and the positive LAMP product is digested by EcoRI.
After the reaction products are mixed evenly, the reaction is carried out for 2h at 37 ℃, 5 mu L of the products are taken out after the reaction, and the enzyme digestion products are detected by 2% agarose gel (containing 0.5 mu g/mL ethidium bromide).
As a result: in theoretical calculation, after the CAV-2 amplification product is digested by the endonuclease EcoRI, three main bands with the sizes of 75bp, 139bp and 162bp respectively are formed. The results in FIG. 3 are completely consistent with the theoretical values, which shows that the detection method established by the invention has good specificity.
FIG. 3 is a restriction enzyme analysis result diagram of CAV-2LAMP reaction product. Wherein M: DNA molecular weight standard DL 2000; 1: CAV-2LAMP end product; 2: results after digestion with the endonuclease EcoRI.
8. Sensitivity assay for LAMP
Taking the extracted virus liquid DNA product to carry out 10-fold progressive dilution to 10-7And is divided into two parts, one part is detected by the optimized LAMP method, and the sensitivity of the method is measured; the other part was tested by conventional PCR method and the results of the two tests were compared, see FIGS. 4 and 5, to verify the sensitivity of the reaction.
The results show that: the LAMP method is at least 10 times higher than the conventional PCR amplification method. Therefore, the LAMP method has higher sensitivity.
FIG. 4 is a diagram of CAV-2LAMP reaction sensitivity test in which M: DNA molecular weight standard DL 2000; 1-6 in FIGS. 4 and 5 are template dilutions to 10-1、10-2、10-3、10-4、10-5、10-6And 7 is a negative control.
9. Compliance for practical applications of LAMP
Clinically collecting suspected canine adenovirus II infected tissue disease samples, extracting sample genomes, detecting by utilizing an established LAMP detection method and a conventional PCR and fluorescent quantitative PCR method, and comparing detection results in practical application of the three methods to verify LAMP compliance.
The results show that: the loop-mediated isothermal amplification detection kit for the canine adenovirus II, the conventional PCR and the fluorescent quantitative PCR are used for detecting the obtained sample, the detection rate of LAMP is found to be remarkably higher than that of the traditional PCR method, the detection rate of LAMP is similar to that of the fluorescent quantitative PCR method, and the positive samples detected by the traditional PCR and the fluorescent quantitative PCR can be detected by the LAMP method.
Thus, it should be appreciated by those skilled in the art that while a number of exemplary embodiments of the invention have been illustrated and described in detail herein, many other variations or modifications consistent with the principles of the invention may be directly determined or derived from the disclosure of the present invention without departing from the spirit and scope of the invention. Accordingly, the scope of the invention should be understood and interpreted to cover all such other variations or modifications.
Claims (10)
1. The visible isothermal amplification primer group for detecting the canine adenovirus II is characterized by consisting of the following primers:
an upstream inner primer FIP:
CGAGGGCATTGTAGGCGGTG-GAATTC-GGGTACCCTAGACAGAGGC；
the downstream inner primer BIP:
CCAAGGCCGGGGCTAACAAC-GGCACCTGGGCTAAAGTG；
the upstream outer primer F3: GCTGGACATGGCCAGTAC, respectively;
downstream outer primer B3: TCACAGTTATGGCACCTGC, respectively;
accelerating upstream circular primer LF1: CCGCTGTAAGGCTTGAAGGAG
Accelerating the downstream circular primer LB1: CTTTTTAATGGACAGGGTGCCAATA.
2. A reagent for the visual isothermal amplification detection of canine adenovirus type II, which is a reagent for the visual isothermal amplification detection of canine adenovirus type II, and which comprises the primer set defined in claim 1.
3. The visualized isothermal amplification detection reagent according to claim 2, wherein the reagent further comprises 10 × reaction buffer, dNTPs and Mg2+Bst DNA polymerase, deionized water, template DNA and a color reagent.
4. The visualized isothermal amplification detection reagent according to claim 3, wherein Mg in the reagent is Mg2+Has a concentration of 6 mmol. L-1。
5. The visualized isothermal amplification detection reagent according to claim 3, wherein the concentration of dNTPs in the reagent is 1.5 mmol-L-1(ii) a Preferably, the color reagent in the reagent is a mixed indicator of phenol red and cresol red.
6. The visualized isothermal amplification detection reagent of claim 3, wherein the reagent further comprises a positive control.
7. A visual isothermal amplification detection kit for type II canine adenovirus is a visual isothermal amplification detection kit for type II canine adenovirus, and is characterized in that: the kit comprises the visualized isothermal amplification detection reagent of any one of claims 2-6.
8. Use of the detection reagent of any one of claims 2 to 6 or the detection kit of claim 7 under any one of the following conditions:
firstly, detecting or detecting the type II canine adenovirus without the aim of diagnosing and treating diseases;
secondly, preparing a product for detecting or assisting in detecting the type II canine adenovirus;
thirdly, detecting or assisting to detect whether the animal sample to be detected is infected with the type II canine adenovirus or not by taking the diagnosis and treatment of the disease as the aim;
fourthly, preparing a product for detecting or assisting in detecting whether the animal sample to be detected is infected with the type II canine adenovirus;
fifthly, detecting whether the virus to be detected is the type II canine adenovirus without aiming at the diagnosis and treatment of diseases;
and sixthly, preparing a product for detecting or assisting in detecting whether the virus to be detected is the type II canine adenovirus.
9. A method for detecting or assisting in detecting whether a test animal sample is infected with canine adenovirus type II, which is not aimed at disease diagnosis and treatment, comprising the steps of:
the reaction steps are as follows: extracting genome DNA from a swab sample of anus, saliva or lacrimal gland secretion of an animal to be detected as a template, and carrying out loop-mediated isothermal amplification by using the detection reagent of any one of claims 2-6 or the detection kit of claim 7 to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: keeping the temperature at 63 ℃ and reacting for 40 min;
a confirmation step: determining whether the animal sample to be tested is infected with the canine adenovirus II according to any one of the following methods:
A. if the amplified product is orange yellow, the animal sample to be detected is infected with the type II canine adenovirus; if the amplification product presents purple red, the animal sample to be detected is not infected with the type II canine adenovirus;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and then the animal sample to be detected is infected with the type II canine adenovirus; only one primer strip is present, so that the animal sample to be detected is not infected with the type II canine adenovirus.
10. A method for detecting or assisting in detecting canine adenovirus type II as a virus to be detected, which does not aim at the diagnosis and treatment of diseases, and is characterized by comprising the following steps:
the reaction steps are as follows: extracting genome DNA from a virus to be detected as a template, and carrying out loop-mediated isothermal amplification by using the detection reagent according to any one of claims 2 to 6 or the detection kit according to claim 7 to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: keeping the temperature at 63 ℃ and reacting for 40 min;
a confirmation step: determining whether the virus to be detected is canine adenovirus type II according to any one of the following methods:
A. if the amplification product is orange yellow, the virus to be detected is the type II canine adenovirus; if the amplification product presents purple red, the virus to be detected is not the II type canine adenovirus;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and the animal virus to be detected is type II canine adenovirus; only one primer strip is present, the virus to be detected is not the type II canine adenovirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010095654.2A CN111534634A (en) | 2020-07-07 | 2020-07-07 | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010095654.2A CN111534634A (en) | 2020-07-07 | 2020-07-07 | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111534634A true CN111534634A (en) | 2020-08-14 |
Family
ID=71971073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010095654.2A Pending CN111534634A (en) | 2020-07-07 | 2020-07-07 | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111534634A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385100A (en) * | 2023-10-09 | 2024-01-12 | 华中农业大学 | Fluorescence quantitative PCR detection kit for canine respiratory coronavirus |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150275294A1 (en) * | 2012-10-18 | 2015-10-01 | Idexx Laboratories, Inc. | Nucleic Acid Amplification Controls and Kits and Methods of Use Thereof |
| CN110499393A (en) * | 2019-08-30 | 2019-11-26 | 金宇保灵生物药品有限公司 | The real-time fluorescence quantitative PCR detection of hepatitis infectiosa canis virus, hepatitis infectiosa canis virus I type and hepatitis infectiosa canis virus II type and diagnostic primers and probe |
| CN111304365A (en) * | 2020-03-02 | 2020-06-19 | 南阳师范学院 | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof |
| CN111334613A (en) * | 2020-04-16 | 2020-06-26 | 广东省实验动物监测所 | RPA primer pair, probe, kit and detection method for detecting canine adenovirus |
-
2020
- 2020-07-07 CN CN202010095654.2A patent/CN111534634A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150275294A1 (en) * | 2012-10-18 | 2015-10-01 | Idexx Laboratories, Inc. | Nucleic Acid Amplification Controls and Kits and Methods of Use Thereof |
| CN110499393A (en) * | 2019-08-30 | 2019-11-26 | 金宇保灵生物药品有限公司 | The real-time fluorescence quantitative PCR detection of hepatitis infectiosa canis virus, hepatitis infectiosa canis virus I type and hepatitis infectiosa canis virus II type and diagnostic primers and probe |
| CN111304365A (en) * | 2020-03-02 | 2020-06-19 | 南阳师范学院 | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof |
| CN111334613A (en) * | 2020-04-16 | 2020-06-26 | 广东省实验动物监测所 | RPA primer pair, probe, kit and detection method for detecting canine adenovirus |
Non-Patent Citations (4)
| Title |
|---|
| VIKAS GUPTA ET AL.: "Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA：Pubmed，LAMP canine adenovirus", 《ARCH VIROL》 * |
| VIKAS GUPTA ET AL.: "Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA：Pubmed，LAMP canine adenovirus", 《ARCH VIROL》, 27 March 2017 (2017-03-27), pages 1 - 7 * |
| 曹丙蕾 等: "LAMP 快速检测犬传染性肝炎方法的建立及应用", 《中国动物检疫》, vol. 31, no. 8, 31 December 2014 (2014-12-31), pages 1 - 2 * |
| 谭贵良等: "《现代分子生物学及组学技术在食品安全检测中的应用》", vol. 1, 中山大学出版社, pages: 141 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385100A (en) * | 2023-10-09 | 2024-01-12 | 华中农业大学 | Fluorescence quantitative PCR detection kit for canine respiratory coronavirus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106906211B (en) | Molecular joint and application thereof | |
| CN108060269B (en) | DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof | |
| CN111321249A (en) | Loop-mediated isothermal amplification detection primer group, kit and method for SARS-CoV-2 | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| CN113308519B (en) | Primer and probe for detecting single base mutation site and detection method | |
| CN111304365A (en) | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof | |
| CN112094944A (en) | Kit for quantitatively detecting copy number of novel coronavirus | |
| CN114774565A (en) | Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system | |
| CN110724762B (en) | LAMP detection primer and detection method for African swine fever virus | |
| CN111534634A (en) | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof | |
| CN116162734B (en) | Specific primer, probe and kit for rapidly detecting African swine fever wild strain and gene deletion strain | |
| CN116254371A (en) | Primer molecular beacon combination for wild type and mutant molecular typing of monkey pox virus and application thereof | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| CN110592269A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type 2 virus (GCRV-2) | |
| CN114959081A (en) | Primer and probe for detecting mycoplasma gallisepticum by LAMP-Taqman and application of primer and probe | |
| CN111500768B (en) | Primer probe for identifying novel coronavirus and application of primer probe in dual-digital PCR | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) | |
| CN117344061B (en) | Method, kit, primer and probe for simultaneously detecting five human viruses EBV, HBV, HCV, HIV, HPV and application of method | |
| CN110656186B (en) | Kit and method for rapidly identifying walnut black spot aphids | |
| CN115747218A (en) | CrRNA and kit for detecting simian pox virus nucleic acid | |
| CN118086590A (en) | Dual real-time fluorescent PCR primer probe combination for detecting canine parvovirus and canine adenovirus and application thereof | |
| CN117265185A (en) | Adenovirus rapid detection method based on One-Tube RPA-CRISPR/Cas12a | |
| CN116200545A (en) | Taqman fluorescent quantitative PCR kit and method for detecting 3 viruses | |
| CN118256657A (en) | Triple real-time fluorescent RT-PCR primer probe combination of canine distemper virus, canine coronavirus and canine parainfluenza virus and application | |
| CN117106980A (en) | Primer group, kit and method for detecting Infectious Spleen and Kidney Necrosis Virus (ISKNV) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |