CN111304365A - Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof - Google Patents
Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof Download PDFInfo
- Publication number
- CN111304365A CN111304365A CN202010134515.6A CN202010134515A CN111304365A CN 111304365 A CN111304365 A CN 111304365A CN 202010134515 A CN202010134515 A CN 202010134515A CN 111304365 A CN111304365 A CN 111304365A
- Authority
- CN
- China
- Prior art keywords
- novel
- gosling
- gout
- astrovirus
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention provides a novel one-step loop-mediated isothermal detection reagent for gosling gout virus (N-GoAstV) and application thereof, and relates to the technical field of virus detection. The invention designs and synthesizes specific LAMP primers according to a conserved region of an N-GoAstV gene, and the specific LAMP primers comprise an upstream inner primer FIP, a downstream inner primer BIP, an upstream outer primer F3, a downstream outer primer B3, an upstream annular primer LF and a downstream annular primer LB, wherein a detection reagent comprises the following components: 10 × reaction buffer solution, dNTPs, MgSO4Bst3.0DNA polymerase, deionized water, a color reagent and the primer. The detection reagent provided by the invention has the advantages of strong specificity, high sensitivity, simple and convenient operation, low cost and the like when being applied.
Description
Technical Field
The invention relates to the technical field of virus detection, in particular to a novel one-step loop-mediated isothermal detection reagent for gosling gout viruses and application thereof.
Background
The gout-causing novel gosling star virus (Goose Astrovirus, N-GoAstV) belongs to one of the members of the astroviridae, and the species is not determined due to the short discovery time. The novel gosling star virus causing gout is a spherical particle without a capsule membrane and with the diameter of 28-30nm, and the capsid protein of the particle is in a 20-face structure. N-GoAstV infection is widely spread in goslings, mainly causes enteritis and nephritis of the goslings, and has the highest infection rate of 9-12 days old. Due to the age, the level of maternal antibodies in the gosling body is reduced, and once the gosling is infected, the body is greatly damaged due to the untimely environmental pollution and prevention. After infection, it is usually manifested as high fever, diarrhea, spotted kidney and white thin feces. The pathological changes of the kidney are shown in that a plurality of internal organs have a large amount of urate deposition, and kidney cells have hemorrhage, renal tubular epithelial cell necrosis and urate particle deposition; hepatocyte urate particle deposition and vacuolar degeneration; splenocytes have hemorrhage and necrosis with varying degrees of pathological changes. When N-GoAstV is mixed with Goose Parvovirus (GPV) or other viral diseases for infection, secondary diseases are easily caused, and the death risk of a host is increased. The N-GoAstV virus infection animal model is used for researching the effect of virus important genes in the virus infection process and screening strains. So as to provide important basis for researching pathogenesis of the novel gosling astrovirus induced gout and evaluating and predicting curative effect of the antiviral drug.
Nucleic acid amplification is one of the most commonly used methods in genetic diagnosis technology, and the current methods for nucleic acid amplification include Polymerase Chain Reaction (PCR), nucleic acid sequence dependent amplification (NASBA), self-sustained Sequence Replication (SR), and strand displacement technology (SDA), all of which can rapidly amplify a micro-sample, but have disadvantages in terms of specificity, simplicity, temperature, and requirements for reagents and instruments.
Disclosure of Invention
The invention aims to provide a novel one-step loop-mediated isothermal detection reagent for gosling gout viruses and application thereof, which shorten the detection time, improve the specificity and sensitivity, improve the convenience of operation and reduce the cost.
In particular, the invention provides a one-step loop-mediated isothermal amplification primer group for a novel gosling gout virus, which consists of the following primers:
an upstream inner primer FIP:
TGACGACATTCGYGTCRTAATTAAT-GATAATGTCACCATGATTTGCT；
the downstream inner primer BIP:
TGTGGGTTAAACCAGAAAATGTCA-GAATTC-CGTAAGACCACAGAAAGTCAT；
the upstream outer primer F3: CGACGCTCARTTACTYAGG, respectively;
downstream outer primer B3: ACCATCACTCCTTTTAAYCAA, respectively;
upstream loop primer LF: CCTTCCTTATTGACACAAGCCTAT
Downstream loop primer LB: AGGTCTCTGATGATATTGAGGGT are provided.
According to another aspect of the invention, the reagent for the one-step loop-mediated isothermal amplification detection of the novel gosling gout virus is an isothermal detection reagent for gout causing novel gosling astrovirus, and the reagent comprises the primer set.
Preferably, the reagent further comprises the following components: 10 times reaction buffer solution, dNTPs and Mg2+Bst3.0DNA polymerase, deionized water, template RNA and a color reagent.
Preferably, Mg in said reagent2+Has a concentration of 6 mmol. L-1。
Preferably, the concentration of dNTPs in the reagent is 1.5mmol·L-1(ii) a Preferably, the color reagent in the reagent is a mixed indicator of phenol red and cresol red.
Preferably, the reagent further comprises a positive control.
According to another aspect of the invention, a kit and a one-step loop-mediated isothermal amplification detection kit for the novel gosling gout virus are obtained from reagents, wherein the kit is an isothermal detection kit for the gout-causing novel gosling astrovirus, and the kit comprises the loop-mediated isothermal amplification detection reagent as described in any one of the above.
Use of a detection reagent according to any of the above or the detection kit under any of the following conditions:
firstly, detecting or assisting in detecting novel gosling astrovirus causing gout without the aim of diagnosis and treatment of diseases;
secondly, preparing a product for detecting or assisting in detecting the novel gosling astrovirus causing gout;
thirdly, detecting or assisting to detect whether the animal sample to be detected is infected with the novel gosling astrovirus for gout or not with the aim of diagnosing and treating diseases;
fourthly, preparing a product for detecting or assisting in detecting whether the animal sample to be detected is infected with the novel gosling astrovirus with gout;
fifthly, detecting whether the virus to be detected is the novel gosling astrovirus causing gout or not with the aim of disease diagnosis and treatment;
and sixthly, preparing a product for detecting or assisting in detecting whether the virus to be detected is the novel gosling astrovirus causing gout.
For detecting animal samples, the method for detecting or assisting to detect whether the animal samples to be detected are infected with the novel gosling astrovirus causing gout or not does not aim at diagnosis and treatment of diseases and comprises the following steps:
the reaction steps are as follows: extracting genome RNA from an animal tissue sample to be detected as a template, and carrying out loop-mediated isothermal amplification by using the detection reagent of any one of claims 2-6 or the detection kit of claim 7 to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: reacting for 30 minutes at the constant temperature of 61 ℃;
a confirmation step: determining whether the animal sample to be tested is infected with the novel gosling astrovirus with gout according to any one of the following methods:
A. if the amplification product is yellow, the animal sample to be detected is infected with the novel gosling astrovirus for gout; if the amplification product is purple red, the animal sample to be detected is not infected with the novel gosling astrovirus for gout;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and then the animal sample to be detected is infected with the novel gosling astrovirus with gout; only one primer electrophoresis strip is provided, so that the animal sample to be detected is not infected with the novel gosling astrovirus for gout.
For detecting the virus per se, the method for detecting or assisting in detecting the virus to be detected as the novel gosling star virus causing gout does not aim at diagnosis and treatment of diseases and comprises the following steps:
the reaction steps are as follows: extracting RNA of a genome from a sample to be detected as a template, and performing one-step reverse transcription loop-mediated isothermal amplification by using the detection reagent according to any one of claims 2 to 6 or the detection kit according to claim 7 to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: keeping the temperature at 61 ℃ and reacting for 30 minutes;
a confirmation step: determining whether the virus to be detected is the novel gosling astrovirus causing gout according to any one of the following methods:
A. if the amplification product is yellow, the pathogen to be detected is a novel gosling astrovirus causing gout; if the amplification product presents mauve color, the virus to be detected is not the novel gosling astrovirus causing gout;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and the animal virus to be detected is the novel gosling astrovirus causing gout; only one primer electrophoresis strip is provided, so that the virus to be detected is not the novel gosling astrovirus causing gout.
The invention provides a one-step reverse transcription loop-mediated isothermal amplification detection reagent for novel gosling astrovirus induced gout and application thereof, and the reagent mainly has the following beneficial effects:
1. the invention uses three pairs of specific primers and six recognition regions, and has higher specificity compared with the existing detection method.
2. The loop-mediated isothermal kit for detecting the novel gosling astrovirus causing gout has high sensitivity: after 10-fold progressive dilution is carried out on the standard plasmid of the ORF1b sequence, the standard plasmid is used as a LAMP reaction template, and the detection is carried out by a PCR method according to the same template concentration, and the result shows that: the LAMP method has the same detection sensitivity as the method of quantitative PCR amplification. Therefore, the LAMP method has high sensitivity.
3. The loop-mediated isothermal kit for detecting the novel gosling astrovirus causing gout has high specificity: the goose viral diseases which are common clinically are as follows: GPV (goose parvovirus), NDHV (novel duck hepatitis virus) (synthetic sequences of goose astrovirus FLX and AHDY), GREV (goose reovirus), TBSV (tembusu virus) and GHPV (goose hemorrhagic polyoma virus) are respectively used as detection objects, and the detection is carried out by using the method disclosed by the invention, only N-GoAstV is positive, and the high specificity is realized.
4. The loop-mediated isothermal reagent for detecting the novel gosling astrovirus causing gout has the advantages of rapidity: compared with the reaction time and the detection time of a plurality of hours of the common PCR reaction, the detection method can complete the whole reaction and result judgment within 1 hour.
5. The loop-mediated isothermal reagent for detecting the novel gosling star virus causing gout has the operability: compared with the conventional PCR, the novel goose star-like virus loop-mediated isothermal amplification detection kit for gout does not need an expensive PCR instrument, and can complete the reaction only by a simple constant-temperature water bath; and the detection of the result can be directly judged by naked eyes without special instruments such as gel electrophoresis and the like, so the kit has stronger operability.
6. The detection method is easy to operate, low in cost and widely applicable.
The above and other objects, advantages and features of the present invention will become more apparent to those skilled in the art from the following detailed description of specific embodiments thereof, taken in conjunction with the accompanying drawings.
Drawings
Some specific embodiments of the invention will be described in detail hereinafter, by way of illustration and not limitation, with reference to the accompanying drawings. The same reference numbers in the drawings identify the same or similar elements or components. Those skilled in the art will appreciate that the drawings are not necessarily drawn to scale. In the drawings:
FIG. 1 is a diagram of one-step RT-LAMP amplification of the conserved region of the N-GoAstV gene.
FIG. 2 is a graph showing the result of color change of LAMP with a nucleic acid dye added before the reaction.
FIG. 3 is a diagram showing the test of RT-LAMP reaction specificity of the N-GoAstV one-step method.
FIG. 4 is a restriction enzyme analysis result diagram of the RT-LAMP reaction product of the N-GoAstV one-step method.
FIG. 5 is a graph showing the sensitivity test of the one-step RT-LAMP and quantitative PCR reactions of N-GoAstV.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples are commercially available unless otherwise specified.
The loop-mediated isothermal amplification (LAMP) technology can amplify RNA fragments with low copy number within 1h under the isothermal condition of a water bath kettle. Before the reaction starts, a pH indicator is added, and after the reaction is finished, the result can be judged only by naked eyes due to the change of the color.
The loop-mediated isothermal amplification technology is characterized in that 3 pairs of special primers (outer primers F3, B3; inner primers FIP, BIP; loop primers LF and LB) corresponding to 8 gene segments in a target sequence are respectively used, the reverse transcription activity of Bst3.0DNA polymerase is utilized, the strand displacement activity is simultaneously utilized when DNA is extended, the strand displacement amplification is carried out on a target segment, the pre-denaturation and annealing of a double-stranded DNA template and the complicated cyclic temperature change process are not needed, and the whole reaction is carried out under the constant temperature condition (about 61-63℃)The reverse transcription and the nucleic acid amplification can be completed by one step within ten minutes, and the amplification efficiency is generally as high as 109-1010By orders of magnitude, the large amount of pyrophosphate product allows the reaction result to be directly observed by naked eyes through a method of adding an acid-base indicator dye into the final product.
1. Reagent related materials
The novel gosling astrovirus causing gout is a strain which is isolated and preserved in a laboratory. Viral genomic DNA/RNA extraction kit (Beijing Quanjin Biotechnology Co., Ltd.), Betaine (SIGMA Co., Ltd.), Bst3.0DNA polymerase and 10 Xreaction buffer (Biolabs Inc.), dNTP (Clontech Co., Ltd.), Mg2+And DL2000 (TAKARA). The color reagent is 0.025 mmol.L-1Phenol Red and 0.08 mmol. L-1Cresol red mixed staining solutions, all purchased from Solarbio, inc.
2. Design and synthesis of LAMP primers
Referring to the currently published N-GoAstV virus sequence, 6 primers (F1c and B1c are respectively reverse-complementary to an F1 region and a B1 region which are amplified downstream respectively to facilitate the looping and strand displacement reaction) are designed by utilizing an online design software Primer Explorer V4 aiming at a conserved region ORF1B of the N-GoAstV virus, wherein the primers comprise an upstream inner Primer FIP (FIP is composed of F1c, F2 and GAATTC (EcoRI cleavage site sequence) as a linker), a downstream inner Primer BIP (BIP is composed of B1c and B2), an upstream loop Primer LF and a downstream loop Primer LB, so that the sequences of the upstream outer Primer F3 and the downstream outer Primer B3 are respectively as follows:
an upstream inner primer FIP:
TGACGACATTCGYGTCRTAATTAAT-GATAATGTCACCATGATTTGCT；
the downstream inner primer BIP:
TGTGGGTTAAACCAGAAAATGTCA-GAATTC-CGTAAGACCACAGAAAGTCAT；
the upstream outer primer F3: CGACGCTCARTTACTYAGG, respectively;
downstream outer primer B3: ACCATCACTCCTTTTAAYCAA, respectively;
upstream loop primer LF: CCTTCCTTATTGACACAAGCCTAT, respectively;
downstream loop primer LB: AGGTCTCTGATGATATTGAGGGT, respectively;
wherein Y is a degenerate base, and Y is C/T; GAATTC is the EcoRI cleavage site.
Wherein:
BIP consists of B1c and B2 and GAATTC (EcoRI cleavage site sequence);
BIP consists of B1c and B2.
F1c：TGACGACATTCGYGTCRTAATTAATGATAATGTCAC；
F2：CATGATTTGCT。
B1c：TGTGGGTTAAACCAGAAAATGTCAGAATTCCGTAAG；
B2：ACCACAGAAAGTCAT。
TABLE 1 primers for LAMP detection of N-GoAstV (gout-causing novel gosling astrovirus)
The designed primer was synthesized by Beijing Olympic bioengineering company, and the synthesized primer was diluted with ultrapure water to a solution of 10mmol/mL and stored at-20 ℃.
3. Viral genome extraction
By using a virus genome DNA/RNA extraction kit of Beijing Quanji biotechnology limited, virus genome DNA/RNA of a novel gosling star virus liquid causing gout, a diseased animal tissue sample suspected to be infected by the novel gosling star virus causing gout and a specific control virus sample in cell culture are extracted.
4. Establishment of novel gosling astrovirus LAMP reaction system causing gout
The novel gosling astrovirus detection reagent for gout comprises the following components (M ═ mol. L)-1)：
Wherein, the positive control is genome RNA of the gout-causing novel gosling astrovirus sample.
Mixing the above components, placing in a PCR instrument or a water bath kettle, and keeping the temperature at 61 deg.C for 30 min; after the reaction is finished, the amplification product can be detected by electrophoresis of 2% agarose gel (containing 0.5 mu g/mL ethidium bromide) under the electrophoresis conditions of 80V and 30 min; the color change of the product can be directly observed by naked eyes, and the two judgment results are consistent. When observed by naked eyes, the positive result is displayed as yellow, and the negative result is displayed as purple red.
The electrophoresis detection result is shown in FIG. 1, the electrophoresis bands are distributed in a ladder shape, which is consistent with the theoretical result, and the amplification result of the negative control only appears as primer dimer.
FIGS. 2 1 and 2 show that the LAMP amplification results are visually observed, and that the tubes 1 which are positive tubes are yellow and the tubes 2 which are negative tubes are purple-red in natural light.
FIG. 1 is the LAMP amplification chart of the conserved region of the N-GoAstV gene. Wherein M: DNA molecular weight standard DL 2000; 1: the amplification result of the N-GoAstV strain; 2: and (5) negative control.
FIG. 2 is a graph showing the result of color change of LAMP with a nucleic acid dye added before the reaction. Wherein 1: a positive amplification product; 2: and (5) negative control.
5. Optimization of conditions of LAMP (loop-mediated isothermal amplification) detection method for novel gosling astrovirus causing gout
5.1 reaction time optimization
Preparing a reaction system, setting 3 times of samples under each time condition for repeating, respectively reacting in a constant-temperature water bath kettle for 10min, 20min, 30min, 40min, 50min and 60min, then taking out, after all reaction products are taken out, respectively taking 5 mu L of products, and detecting the reaction products by electrophoresis of 2% agarose gel (containing 0.5 mu g/mL ethidium bromide).
5.2 optimization of the reaction temperature
Configuring a reaction system, setting 3 times of repetition for each temperature condition sample, respectively reacting for 30 minutes at six reaction temperatures of 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃ and 65 ℃, and then respectively taking 5 mu L of products to carry out electrophoresis detection on 2% agarose gel (containing 0.5 mu g/mL ethidium bromide) after the reaction is finished.
5.3 optimization of the concentration of the important Components in the reaction
In a 25 mu L reaction system, the concentration of the primer, the enzyme unit required by the reaction and the concentration of the template are unchanged, and the component MgSO is changed4Concentration of (2), groping MgSO4Effect of concentration on amplification efficiency, the addition amounts were 7mM, 6mM, 5mM, 4mM, 3mM, 2mM, 1mM, 0mM in this order, and 3 replicates were set for each concentration gradient. After all the concentration gradient reactions are finished, carrying out 2% agarose gel electrophoresis detection; reaction system optimization to set up different dNTPs concentration, its gradient is set up as 1.8mM, 1.5mM, 1.2mM, 0.9mM, 0.6mM, all group reactions are set up as negative control with deionized water as template, each concentration gradient is set up 3 times. And (5) after all the concentration gradient reactions are finished, carrying out 2% agarose gel electrophoresis detection.
6. Optimization result of LAMP (loop-mediated isothermal amplification) detection method for novel gosling astrovirus induced gout
6.1 reaction time optimization results: when the reaction time is different, electrophoresis bands become more and more obvious along with the time extension, and the result is optimal when the electrophoresis bands are reacted in a constant-temperature water bath kettle for 30 min.
6.2 reaction temperature optimization results: when the reaction temperature is different, the difference of the electrophoresis band brightness appears, and the effect is best when the reaction is carried out at 61 ℃.
6.3 optimization results of the concentrations of each important component in the reaction:
when MgSO4When the concentration is different, the brightness difference of electrophoresis bands appears, and when MgSO is different4The effect is best when the concentration is 6 mM.
When the concentration of dNTPs is different, the difference of the brightness of an electrophoresis band can appear, and when the concentration of dNTPs is 1.5mM, the effect is best.
6.4 optimization of the System and conditions
Through the optimization of the conditions, the finally optimized system of the novel gosling astrovirus loop-mediated isothermal amplification detection kit for gout is (M ═ mol. L-1)：
The reaction conditions for the loop-mediated isothermal amplification were 61 ℃ for 30 minutes.
The novel gout-causing goose astrovirus loop-mediated isothermal amplification detection kit of 6.225 mu L detection system comprises the following components (M ═ mol. L)-1)：
7. Specificity test of LAMP
The virus diseases of waterfowl which are common clinically: DNA or RNA obtained from GPV (goose parvovirus), GROV (goose reovirus), TBSV (tembusu virus) and GHPV (goose hemorrhagic multiple tumor disease) and synthetic sequences of goose astrovirus strain FLX and AHDY are used as detection objects, LAMP detection is carried out by using N-GoAstV primers to verify the specificity of the reaction, positive control is set, and the result is shown in figure 3.
The reaction system for LAMP detection comprises the following components (M ═ mol. L)-1)：
Wherein the novel gosling star virus template RNA causing gout is novel gosling star virus genome RNA causing gout extracted by using a virus DNA/RNA extraction kit.
The amplification result shows that only positive control has a diffuse band, and other 6 viruses do not appear, which indicates that no positive amplification exists when other viruses are taken as templates.
FIG. 3 is a diagram showing LAMP reaction specificity test of N-GoAstV. Wherein M: DNA molecular weight standard DL 2000; lanes 1-8 show the results of detection of N-GoAstV, GPV, GREEV, TMUV, GHPV, FLX, AH1G and negative control with the LAMP specific primers for N-GoAstV, respectively.
7.1 enzyme digestion identification of amplification products
In order to further verify the specificity of the amplification reaction, the product after LAMP reaction is subjected to enzyme digestion identification, the following components are added into a 20-mu-L reaction system, and the positive LAMP product is digested by EcoRI.
After the reaction products are mixed evenly, the reaction is carried out for 1h at 37 ℃, 5 mu L of the products are taken out after the reaction, and the enzyme digestion products are detected by 2% agarose gel (containing 0.5 mu g/mL ethidium bromide).
As a result: in theoretical calculation, an N-GoAstV amplification product is digested by an endonuclease EcoRI and then becomes three main bands with the sizes of 234bp, 293bp and 352bp respectively. The results in fig. 4 completely agree with the theoretical values, which indicates that the detection method established in the present invention has good specificity.
FIG. 4 is a diagram showing the restriction enzyme identification result of the LAMP reaction product of N-GoAstV. Wherein M: DNA molecular weight standard DL 2000; 1: N-GoAstV LAMP end product; 2: results after digestion with the endonuclease EcoRI.
8. Sensitivity assay for LAMP
A standard plasmid containing the ORF1b sequence was diluted 10-fold in increments to 5.78X 100One part is detected by an optimized LAMP method, and the sensitivity of the method is determined by direct visual observation after phenol red staining solution is added; the other part was tested by the fluorescent quantitative PCR method, and the results of the two tests were compared, see graphs a, b and c of FIG. 5, to verify the sensitivity of the reaction.
The results show that: the LAMP method is at least 10 times higher than the conventional PCR amplification method. Therefore, the LAMP method has higher sensitivity.
FIG. 5 is a graph of the N-GoAstV LAMP reaction sensitivity test, in which M: DNA molecular weight standard DL 2000; a. b in FIGS. 1 to 7 (yellow color of the positive reaction tube) are respectively diluted to 5.78X 106、5.78×105、5.78×104、5.78×103、5.78×102、5.78×101、5.78×1008 (purple red in color) as the electrophoresis and staining result of the negative control; and c, a graph is a quantitative detection result graph corresponding to the template concentration.
9. Compliance for practical applications of LAMP
Clinically collecting a suspected gout-causing novel gosling astrovirus infected tissue disease sample, extracting a sample genome, detecting by using an established LAMP detection method, virus separation and a fluorescent quantitative PCR method, and verifying the LAMP compliance by comparing detection results in the practical application of the three methods.
The results show that: the obtained sample is detected by utilizing the novel gout-causing gosling star-shaped virus loop-mediated isothermal amplification detection kit, virus separation and fluorescent quantitative PCR, the detection rate of LAMP is found to be consistent with the other two methods, and the positive samples detected by the traditional PCR and the fluorescent quantitative PCR can be detected by the LAMP method.
Thus, it should be appreciated by those skilled in the art that while a number of exemplary embodiments of the invention have been illustrated and described in detail herein, many other variations or modifications consistent with the principles of the invention may be directly determined or derived from the disclosure of the present invention without departing from the spirit and scope of the invention. Accordingly, the scope of the invention should be understood and interpreted to cover all such other variations or modifications.
Claims (10)
1. The one-step loop-mediated isothermal amplification primer group of the novel gosling gout virus is characterized by comprising the following steps: the primer group consists of the following primers:
an upstream inner primer FIP:
TGACGACATTCGYGTCRTAATTAAT-GATAATGTCACCATGATTTGCT；
the downstream inner primer BIP:
TGTGGGTTAAACCAGAAAATGTCA-GAATTC-CGTAAGACCACAGAAAGTCAT；
the upstream outer primer F3: CGACGCTCARTTACTYAGG, respectively;
downstream outer primer B3: ACCATCACTCCTTTTAAYCAA, respectively;
upstream loop primer LF: CCTTCCTTATTGACACAAGCCTAT
Downstream loop primer LB: AGGTCTCTGATGATATTGAGGGT are provided.
2. The novel one-step loop-mediated isothermal amplification detection reagent for the gosling gout virus is characterized by comprising the following components in parts by weight: the reagent comprises the primer set described in claim 1.
3. The loop-mediated isothermal amplification detection reagent according to claim 2, wherein: the reagent also comprises the following components: 10 times reaction buffer solution, dNTPs and Mg2+Bst3.0DNA polymerase, deionized water, template RNA and a color reagent.
4. The loop-mediated isothermal amplification detection reagent according to claim 3, wherein: mg in the reagent2+Has a concentration of 6 mmol. L-1。
5. The loop-mediated isothermal amplification detection reagent according to claim 3, wherein: the concentration of dNTPs in the reagent is 1.5 mmol.L-1(ii) a Preferably, the color reagent in the reagent is a mixed indicator of phenol red and cresol red.
6. The loop-mediated isothermal amplification detection reagent according to claim 3, wherein: the reagent also includes a positive control.
7. The one-step loop-mediated isothermal amplification detection kit for the novel gosling gout virus is characterized by comprising the following steps of: the kit comprises the loop-mediated isothermal amplification detection reagent of any one of claims 2-6.
8. Use of the detection reagent of any one of claims 2 to 6 or the detection kit of claim 7 under any one of the following conditions:
firstly, detecting or assisting in detecting novel gosling astrovirus causing gout without the aim of diagnosis and treatment of diseases;
secondly, preparing a product for detecting or assisting in detecting the novel gosling astrovirus causing gout;
thirdly, detecting or assisting to detect whether the animal sample to be detected is infected with the novel gosling astrovirus for gout or not with the aim of diagnosing and treating diseases;
fourthly, preparing a product for detecting or assisting in detecting whether the animal sample to be detected is infected with the novel gosling astrovirus with gout;
fifthly, detecting whether the virus to be detected is the novel gosling astrovirus causing gout or not with the aim of disease diagnosis and treatment;
and sixthly, preparing a product for detecting or assisting in detecting whether the virus to be detected is the novel gosling astrovirus causing gout.
9. A method for detecting or assisting in detecting whether a sample of an animal to be detected is infected with a novel gosling astrovirus causing gout, which does not aim at the diagnosis and treatment of diseases, is characterized in that: the method comprises the following steps:
the reaction steps are as follows: extracting genome RNA from an animal tissue sample to be detected as a template, and carrying out loop-mediated isothermal amplification by using the detection reagent of any one of claims 2-6 or the detection kit of claim 7 to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: reacting for 30 minutes at the constant temperature of 61 ℃;
a confirmation step: determining whether the animal sample to be tested is infected with the novel gosling astrovirus with gout according to any one of the following methods:
A. if the amplification product is yellow, the animal sample to be detected is infected with the novel gosling astrovirus for gout; if the amplification product is purple red, the animal sample to be detected is not infected with the novel gosling astrovirus for gout;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and then the animal sample to be detected is infected with the novel gosling astrovirus with gout; only one primer electrophoresis strip is provided, so that the animal sample to be detected is not infected with the novel gosling astrovirus for gout.
10. A method for detecting or assisting in detecting a novel gosling star virus causing gout by a virus to be detected, which does not aim at the diagnosis and treatment of diseases, and is characterized by comprising the following steps: the method comprises the following steps:
the reaction steps are as follows: extracting RNA of a genome from a sample to be detected as a template, and performing one-step reverse transcription loop-mediated isothermal amplification by using the detection reagent according to any one of claims 2 to 6 or the detection kit according to claim 7 to obtain an amplification product; preferably, the reaction conditions of the loop-mediated isothermal amplification are as follows: keeping the temperature at 61 ℃ and reacting for 30 minutes;
a confirmation step: determining whether the virus to be detected is the novel gosling astrovirus causing gout according to any one of the following methods:
A. if the amplification product is yellow, the pathogen to be detected is a novel gosling astrovirus causing gout; if the amplification product presents mauve color, the virus to be detected is not the novel gosling astrovirus causing gout;
B. carrying out agarose gel electrophoresis on the amplification product, wherein electrophoresis bands are distributed in a ladder shape, and the animal virus to be detected is the novel gosling astrovirus causing gout; only one primer electrophoresis strip is provided, so that the virus to be detected is not the novel gosling astrovirus causing gout.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010134515.6A CN111304365A (en) | 2020-03-02 | 2020-03-02 | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010134515.6A CN111304365A (en) | 2020-03-02 | 2020-03-02 | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111304365A true CN111304365A (en) | 2020-06-19 |
Family
ID=71152155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010134515.6A Pending CN111304365A (en) | 2020-03-02 | 2020-03-02 | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111304365A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111534634A (en) * | 2020-07-07 | 2020-08-14 | 南阳师范学院 | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof |
| CN111676323A (en) * | 2020-07-01 | 2020-09-18 | 广西壮族自治区兽医研究所 | LAMP primer group and kit for detecting chicken astrovirus, detection method and application |
| CN116042785A (en) * | 2023-03-22 | 2023-05-02 | 翌圣生物科技(上海)股份有限公司 | Buffer for RT-LAMP amplification reagent and RT-LAMP amplification reagent |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109457055A (en) * | 2019-01-03 | 2019-03-12 | 山东省农业科学院家禽研究所 | Detect the primer sets and kit of goose source astrovirus |
| KR20210047715A (en) * | 2019-10-22 | 2021-04-30 | 단국대학교 천안캠퍼스 산학협력단 | Primer set for loop-mediated isothermal amplification reaction for detecting Human Astrovius, and use thereof |
-
2020
- 2020-03-02 CN CN202010134515.6A patent/CN111304365A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109457055A (en) * | 2019-01-03 | 2019-03-12 | 山东省农业科学院家禽研究所 | Detect the primer sets and kit of goose source astrovirus |
| KR20210047715A (en) * | 2019-10-22 | 2021-04-30 | 단국대학교 천안캠퍼스 산학협력단 | Primer set for loop-mediated isothermal amplification reaction for detecting Human Astrovius, and use thereof |
Non-Patent Citations (4)
| Title |
|---|
| JUN JI ET AL.: "Rapid and visual detection of novel astroviruses causing fatal gout in goslings using one-step reverse transcription loop-mediated isothermal amplification", 《POULTRY SCIENCE》, vol. 99, 20 June 2020 (2020-06-20), pages 4259 - 4264 * |
| 姜晓宁 等: "导致雏鹅痛风新型鹅星状病毒的分离鉴定", 《中国兽医学报》 * |
| 姜晓宁 等: "导致雏鹅痛风新型鹅星状病毒的分离鉴定", 《中国兽医学报》, vol. 38, no. 5, 31 May 2018 (2018-05-31), pages 871 - 877 * |
| 谭贵良 等: "《现代分子生物学及组学技术在食品安全检测中的应用》", vol. 1, 中山大学出版社 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111676323A (en) * | 2020-07-01 | 2020-09-18 | 广西壮族自治区兽医研究所 | LAMP primer group and kit for detecting chicken astrovirus, detection method and application |
| CN111676323B (en) * | 2020-07-01 | 2023-07-18 | 广西壮族自治区兽医研究所 | LAMP primer group and kit for detecting chicken astrovirus, detection method and application |
| CN111534634A (en) * | 2020-07-07 | 2020-08-14 | 南阳师范学院 | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof |
| CN116042785A (en) * | 2023-03-22 | 2023-05-02 | 翌圣生物科技(上海)股份有限公司 | Buffer for RT-LAMP amplification reagent and RT-LAMP amplification reagent |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN108060269B (en) | DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof | |
| CN111304365A (en) | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof | |
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| CN111235316A (en) | Primer probe for identifying novel coronavirus and application of primer probe in triple fluorescence RPA | |
| CN110724762B (en) | LAMP detection primer and detection method for African swine fever virus | |
| CN106995841A (en) | A kind of genetically engineered soybean detection multiple PCR reagent kit and detection method | |
| CN107488749A (en) | A kind of LAMP primer and detection method for detecting the type of pig circular ring virus 3 | |
| CN107177700A (en) | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus | |
| CN107164566B (en) | LAMP primer group, kit and detection method for detecting lily mottle virus | |
| CN106987657B (en) | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof | |
| CN110184386B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer for detecting ANRSV (ANRSV), application thereof, detection reagent and detection method | |
| CN111534634A (en) | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof | |
| CN108384892A (en) | A kind of LAMP primer group, kit and the method for detection huichun viremia virus | |
| CN109913583A (en) | A kind of primer and its method of quick detection Koi herpesvirus | |
| CN102108420A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN111500768B (en) | Primer probe for identifying novel coronavirus and application of primer probe in dual-digital PCR | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| CN106701961B (en) | Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pestivirus | |
| CN108754021A (en) | A kind of ring mediated isothermal amplification detection reagent of duck hepatitis B virus | |
| CN111575403A (en) | High-throughput digital PCR kit for detecting RNA virus nucleic acid and detection method | |
| CN106191314B (en) | LAMP detection kit, detection method and application of DNA virus | |
| CN110241185A (en) | A kind of detection method of chIRF3 fluorescence quantitative RT-RCR | |
| CN113234854B (en) | Visible isothermal amplification detection primer and kit for human immunodeficiency virus type I | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |