CN101948865B

CN101948865B - Dual-promoter inducible secretable shuttle plasmid and construction method thereof

Info

Publication number: CN101948865B
Application number: CN2010102555904A
Authority: CN
Inventors: 乐科易; 张培德
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2010-08-17
Filing date: 2010-08-17
Publication date: 2012-11-14
Anticipated expiration: 2030-08-17
Also published as: CN101948865A

Abstract

The invention belongs to the field of biological genetic engineering, and provides a dual-promoter inducible secretable shuttle plasmid. The shuttle plasmid consists of an enzyme cutting Escherichia coli pET-28a plasmid and an enzyme cutting bacillus subtilis pE194 plasmid, wherein a lysozyme-antibacterial peptide functional fragment and an antibacterial peptide gene are inserted into the enzyme cutting Escherichia coli pET-28a plasmid. The invention also provides a method for constructing the dual-promoter inducible secretable shuttle plasmid. The shuttle plasmid is transferred to a prokaryote to express proteins such as toxalbumin, cecropin and the like in a fusion mode without toxicity to a host. The shuttle plasmid constructed by the method can be induced by IPTG or lactose to improve gene expression level; the shuttle plasmid is also suitable for exocrine expression, and a target protein for the exocrine expression is convenient to process and is not polluted by endotoxin; and because the shuttle plasmid has dual functional promoters, different genes can be inserted in appropriate correct directions for gene expression.

Description

But a kind of double-promoter can be induced secretor type shuttle plasmid and construction process thereof

Technical field:

The present invention relates to bioengineering field, relate in particular to a kind of shuttle plasmid, but particularly a kind of double-promoter can be induced secretor type shuttle plasmid and construction process thereof.

Background technology:

In the bioengineering field,, usually need carry out the structure of expression vector for the effective expression clone gene.Escherichia expression system is the most frequently used a kind of in the genetically engineered research.Though it can not translate post-treatment as eukaryotic system; But its genetic background of intestinal bacteria is clear relatively; Easy and simple to handle, growth cycle is lacked, economic security; Therefore remaining use the most extensively, also is the system that can not be replaced, and in genetically engineered fundamental research and practical application, becomes indispensable important tool.Some important foreign genes have obtained to account for the amount of efficiently expressing more than bacterial protein 30% even 40% in intestinal bacteria.Usually coli expression carrier should satisfy following requirement: 1, the scope of application wants wide; 2, gene expression amount is high; 3, the easy purifying of expressed products; 4, plasmid stability will be got well.Going back the none expression vector up to now can satisfy above-mentioned requirements fully.With regard to the plasmid vector of expressing gene, generally preferably will meet following conditions: 1, expression vector will have multiple copied or high copy property; 2, preferably has derivable strong promoter; 3, strong transcription termination sequence is arranged; 4, the most effectively translation initiation sequence of the best is arranged.Then have more meliority if having secreting, expressing, expressing protein can correctly fold like this, has more biological activity and product is solvable; And expressed proteins is secreted into outside the born of the same parents, can make things convenient for separation and purification.In these systems, Bacillus subtilus just has this function, and Bacillus subtilus still is a kind of non-virulent mikrobe, to the person poultry harmless, so often be applied as expression system by many investigators.But in actual application, the extraction of Bacillus subtilus plasmid and transformation efficiency are obviously not as intestinal bacteria commonly used.If in intestinal bacteria, carry out the dna molecular operation; Seem simple and easy to do; After having accomplished genetic manipulation, in Bacillus subtilus, carry out efficiently expressing of foreign protein again, expression product is secreted outside born of the same parents; Can solve and overcome escherichia coli expression preferably and produce inclusion body, need the loaded down with trivial details operation of sex change renaturation.Become an important selection [industrial microorganism, 1989,19 (1): 1-6 so make up intestinal bacteria-Bacillus subtilus shuttling expressing secretion vector; The biotechnology journal, 2002,18 (4): 438-4411; Acta Genetica Sinica, 2000,27 (7): 647-6531].In the eighties of last century later stage, many scientific workers make up all kinds of expression vectors, in the hope of can intestinal bacteria, or in Bacillus subtilus, or in different carrier such as intestinal bacteria-Bacillus subtilus, efficiently express gene simultaneously.The structure multifunction opening mover that has starts expression simultaneously to improve expression level or the like.All research purposes have only one, and that is exactly to exchange the maximum output of expressing for minimum cost by every possible means, to reduce the production cost of expression product such as biomedical product; Perhaps significantly reduce the time and the cost of research and development.So, publish the successful report of many different expression vector establishments, to satisfy the needs of different researchs and production purpose.Expression of the zone purification label that carries out secretion type expression, has that these expression vectors carry out amalgamation and expression, the non-fusion expression that has, have or the like.

The expression vector that the present invention makes up meets above-mentioned condition.The present invention operates as reporter gene with these albumen that host produced toxic action such as cecropin Bovinelactoferrin, people source LL-37, N,O-Diacetylmuramidases, and meliority is more arranged.Can overcome its toxic action, carry out in prokaryotic organism, expressing free-revving engine albumen and have more practical significance the host.

N,O-Diacetylmuramidase is the lytic enzyme that extensively is present in each organ, tissue, serum or saliva in the organism, and discovery is all arranged in organisms such as plant-animal, phage.Relevant so far report such as birds N,O-Diacetylmuramidase, T4 N,O-Diacetylmuramidase, P22 N,O-Diacetylmuramidase, egg white lysozyme etc. have tens of kinds more than.Wherein the lysozyme content in the egg white is particularly abundant, accounts for 3.4%～3.5% of egg white total protein, uses also the widest.N,O-Diacetylmuramidase is a kind of non-specific immunity molecule, can improve body's immunological function, also have simultaneously antitumor, antiviral, improve and strengthen macrophage phagocytic, digestive function.N,O-Diacetylmuramidase more is the application of sterilizing function at present.N,O-Diacetylmuramidase is to make bacterium cracking kill bacteria with (1-4) glycosidic link between-acetylmuramic acid of cracking bacteria cell wall (NAM) and N-acetate glucono-(NAG).Yet N,O-Diacetylmuramidase can only work to the part gram-positive microorganism; When acting on the golden Portugal bacterium of one type of people, animal susceptive disease, but be difficult to gather effect; Some are prone to morbific negative bacterium (like intestinal bacteria) difficulties has strong killing action, shows that fungicidal spectrum is wide, the limited limitation of efficient.After this, the investigator carries out rite-directed mutagenesis to N,O-Diacetylmuramidase, carries out the genetic modification research to N,O-Diacetylmuramidase, though situation has the effect of improvement not remarkable.For solving the fungicidal spectrum problem; Often need use in the practical application,, or add other materials such as vegeto-alkali, polyphosphoric acid, glycocoll like the interpolation microbiotic with other bacteriocidal substance compatibilities; Increase sterilization effect and enlarge fungicidal spectrum with this, these materials have played the synergy use for N,O-Diacetylmuramidase.People source N,O-Diacetylmuramidase is a kind of source of N,O-Diacetylmuramidase, and dna sequence dna and egg white lysozyme are quite similar, and only many amino acid contain eight halfcystines equally in the molecule, and eight halfcystines are folded to form four pairs of disulfide linkage in twos, and avtive spot is also identical.Except that some indivedual amino acid changed, the mode of action of enzyme was identical with function, and the activity of people source N,O-Diacetylmuramidase effect micrococcus lysodeikticus will exceed 3 times of egg white lysozymes.Because it is extremely difficult that people source N,O-Diacetylmuramidase obtains, many investigators begin to utilize genetic engineering technique human cloning source lysozyme gene [animal medicine progress, 2009,30 (4): 5-7; Science Bulletin, 48 (20): 2149-2153; Agric Biol Chem, 1986,50 (3): 713～723; Gene, 1987,56:53-59; Appl Microbiol Biotechnol, 1992,38:109-114; J.FEBSLetters, 2001,506 (1): 27-32].The same fungicidal spectrum problem that exists of human lysozyme with egg white lysozyme.

Searching biologically active peptides combined utilization with it can address the aforementioned drawbacks.(Antibacterial peptides ABP) is exactly one type of functional peptides, or claims antimicrobial peptide or peptide antibiotic, is the important composition composition of congenital immunity in the organism like antibacterial peptide.The cecropin fungicidal spectrum is wide; The antibiotics resistance bacterial strain can be killed, fungicidal, virus, parasite can be pressed down, even characteristics such as tumour cell and solid tumor; Importantly cecropin uses and is difficult for producing the resistance sudden change; Stable, the antibiotic mechanism of physico-chemical property is unique, water-soluble easily again, to many advantages such as the rare murders by poisoning of higher animal normal cell.Therefore expert's prophesy through great efforts, being expected to some day develop becomes antibacterium of new generation, fungi, virus or even anticancer medicine.In developed countries such as U.S.A, days, process heath food with these functional peptides, like polypeptide beverage, polypeptide kid's meal, old man's meal, polypeptide health care food, radioprotective lozenge etc.The application of foreseeable future active polypeptide becomes a series bactericidal agent of tool green safety with full of hope, and is dynamic.The cecropin that comes to light now and study has more than hundreds of, like sterilization/power/permeability increasing protein (BPI) of cecropin (cecropins), Magainin (Magainins), melittin (melittins), cicada, silkworm antibacterial peptide and chicken, milk cow and people, people's derived antimicrobial peptide LL-37 or the like.These sterilization polypeptide secretory volumes are few in vivo; Obtain very difficulty; Also be confined to research field at home basically with these sterilization polypeptide of chemosynthesis now, have its trend of application of scale not form, reason is exactly the greatest problem that cost has become broadened application.

Using gene engineering method clone and expression cecropin become first-selection [Biochimica et Biophysica Acta1758 (2006): 1351-1358; The mikrobe circular, 1997,24 (6): 350-353; China's sanitary inspection magazine, 2009,19 (6): 1202-1205; China animal doctor journal, 2009,29 (8): 1041-1044].Clone and expression cecropin all need overcome several obstacles.1, because the cecropin molecular weight is all smaller, generally all about tens amino acid, so expression amount is not high when expressing; 2; The expression system that is suitable for expressing antibacterial peptide is very limited; Generally can only express at eukaryote such as yeast or cow mammary gland or insect etc.; If express the problem that exists expression product to poison or kill host self with prokaryotic organism as the host, so generally can not directly in prokaryotic organism, express, high expression level or secretion type expression are more difficult; 3, just because of the cecropin molecular weight is little, in case express excessive being very easy to by host's mycoproteinase identification degraded.Therefore express normal and other high molecular weight protein amalgamation and expressions of cecropin, but amalgamation and expression can make cecropin lose sterilizing function; 4, for the fusion rotein that makes expression has BA, need effectively cut expression product, discharge cecropin from the fusion state and recover sterilizing function.Cutting method at present commonly used has the enteropeptidase of use, zymoplasm, Xa factor or BrCN etc.BrCN is a noxious chemical; Enzymes such as use zymoplasm then cost an arm and a leg and have restricted fusion sterilization polypeptide large-scale production and application.Have only and solved above-mentioned these problems and could really carry out large-scale production.The present invention is a reporter gene with cecropin, N,O-Diacetylmuramidase, and the double-promoter secretion inducing type shuttle plasmid that relatively makes up is expressed cecropin, N,O-Diacetylmuramidase situation.Effect is remarkable.Different gene can obtain secretion type expression simultaneously after being cloned into expression vector in different expression systems, find the expression system of optimum expression cecropin easily, reduces search time and cost.Express the enzyme that has more important pharmaceutical use, albumen, hormone etc. through shuttle vector of the present invention and will have more realistic meaning.

Summary of the invention:

But the object of the present invention is to provide a kind of double-promoter can induce secretor type shuttle plasmid and construction process thereof; It is little that but described this double-promoter can induce secretor type shuttle plasmid and construction process thereof will solve the amount of vector expression cecropin of the prior art, or excessive and the technical problem that can not scale operation of cost.

But the invention provides a kind of double-promoter and can induce the secretor type shuttle plasmid; The Bacillus subtilus pE194 plasmid that the intestinal bacteria pET-28a plasmid that described shuttle plasmid is cut by an enzyme and enzyme are cut constitutes, and is inserted with lysozyme-antibacterial peptide function fragment and Bovinelactoferrin on the intestinal bacteria pET-28a plasmid that described enzyme is cut.

Further, described antibacterial peptide gene is a kind of, perhaps any two kinds or the two or more segmental combinations of sterilizing function peptide ammino acid, the repetition fused in tandem of perhaps any function fragment.

Further, described antibacterial peptide gene is Bovinelactoferrin peptide gene or people source cecropin gene or people source lysozyme gene or cecropin gene or Magainin gene or melittin gene or other source antibacterial peptide genes.

Further, to cut the recognition site aminoacid sequence be GGG to the enzyme of the lysostaphin in the described lysozyme-antibacterial peptide function fragment.

But the present invention also provides above-mentioned this double-promoter can induce the construction process of secretor type shuttle plasmid; Comprise a step of cutting intestinal bacteria pET-28a plasmid at NdeI and XhoI site enzyme; Cut at least one antibacterial peptide function fragment of insertion between intestinal bacteria pET-28a plasmid NdeI and the XhoI restriction enzyme site at described enzyme; Comprise that also makes up the segmental step of promotor signal peptide; On described promotor signal peptide fragment, be disposed with BglII, PstI, NheI, KpnI and BglII restriction enzyme site, described promotor signal peptide fragments sequence is cut promotor signal peptide fragment and intestinal bacteria pET-28a plasmid with the BGlII enzyme respectively then shown in SEQ ID NO:2; The employing ligase enzyme connects; Form one and be inserted with the segmental intestinal bacteria pET-28a of promotor signal peptide plasmid, also comprise a step that makes up the lysozyme-antibacterial peptide function fragment, be respectively arranged with NheI and KpnI restriction enzyme site at the two ends of lysozyme-antibacterial peptide function fragment; Cut at NheI that is inserted with the segmental intestinal bacteria pET-28a of promotor signal peptide plasmid and KpnI site enzyme then; Insert the lysozyme-antibacterial peptide function fragment, adopt ligase enzyme to connect, form an intestinal bacteria pET-28a plasmid that is inserted with the lysozyme-antibacterial peptide function fragment; Also comprise a step of cutting at the PstI site enzyme of the intestinal bacteria pET-28a plasmid that is inserted with the lysozyme-antibacterial peptide function fragment; The Bacillus subtilus pE194 plasmid that enzyme is cut in the PstI site is inserted with the intestinal bacteria pET-28a plasmid of lysozyme-antibacterial peptide function fragment then, can induce the secretor type shuttle plasmid but constitute double-promoter of the present invention.

Further, make up in the segmental step of promotor signal peptide at one, the primer sequence of pcr amplification promotor signal peptide function fragment is:

P1:5-A AGATCTCTGCAGCCGGAACTCTTGAATG (BglII and PstI),

P2：5-A AGATCTGCTTCAACTTTAGGAA (BglII)，

The effective terminator fragment of clone in described promotor signal peptide function fragment,

Adopt synthetic three segment DNA fragments, obtain the terminator fragment through overlapping pcr amplification, primer sequence is:

P3：5-CAT GCTAGCGGTACCGGCGGCGGCGGCCATCATCACCACCACCACTGAGCGCGC，

P4：5-ACCACCACTGAGCGCGCTTTTTATAAACTTATATGATAATTAGAGCAAATAAAA，

P5：5-C GCCATGCCGGCAAGCTTCAACTTTAGGAATGAGAAAAAATTTTTATTTGCTCTAA，

Through promotor signal peptide fragment and the segmental overlapping PCR of terminator, obtain complete promotor signal peptide function fragment again,

Forward P7:5-AAAATGAAACACAT GCTAGCGGTACCGGCGGCGGCGGCC (NheI, KpnI)

Reverse P8:5-GGCCGCCGCCGCC GGTACCGCTAGCATGTGTTTCATTTTG (NheI, KpnI)

After synthesizing promotor signal peptide function fragment, be template, with primer P1 and primer P8 with this fragment; Primer P7 and primer P5; Synthesize two fragments respectively, after electrophoresis reclaims, mix two fragments that reclaim; Carry out overlapping PCR with P1, P5 two primers again, obtain to contain the promotor signal peptide function fragment of BglII, PstI, NheI, KpnI and BglII restriction enzyme site.

Further, the clone has promoter sequence, signal peptide sequence, terminator sequence, six Histidines on the described promotor signal peptide function fragment, and described promotor comprises-35 districts ,-10 districts and ribosome bind site AGGAGGT.Described signal peptide sequence is: TTGAAGAAAACAAAAAACAATTATTATACGAGACCTTTAGCTATTGGACTGAGTAC ATTTGCCTTAGCATCTATTGTTTATGGAGGGATTCAAAATGAAACACATGCTAGC, described terminator sequence is TGAGCGCGCTTTTTATAAACTTATATGATAATTAGAGCAAATAAAAATTTTTTCTC ATTCCTAAAGTT GCCGGCA TGGCG, also cloning on the described promotor signal peptide fragment has BglII, PstI, NheI, KpnI and BglII restriction enzyme site.

Further, the clone has the enzyme of lysostaphin to cut recognition site GGC (3Gly) and 6His on described promotor signal peptide function fragment.

Further; In the step of a structure lysozyme-antibacterial peptide function fragment; Described antibacterial peptide gene is a kind of, perhaps any two kinds or the two or more segmental combinations of sterilizing function peptide ammino acid, the repetition fused in tandem of perhaps any function fragment.

Further, described antibacterial peptide gene is Bovinelactoferrin peptide gene or people source cecropin gene or people source lysozyme gene or cecropin gene or Magainin gene or melittin gene or other antibacterial peptide genes.

Further, between the antibacterial peptide of fusion rotein, be inserted with the lysostaphin cleavage site.

Further, between the NheI of intestinal bacteria pET-28a plasmid and KpnI site, be inserted with the lysostaphin cleavage site.

Further, at Bovinelactoferrin gene C end the cutting recognition site GGG of lysostaphin is arranged, the base sequence of described Bovinelactoferrin gene is shown in SEQ ID NO:1, and the amino acid preface of described Bovinelactoferrin is shown in SEQ ID NO:3.

Further; The people source cecropin gene LL-37 that contains two molecules polyphone in the described antibacterial peptide gene, described people source cecropin gene LL-37, its N terminal amino acid is changed into Gly; 4th, 30 amino acids become Asn; 11st, 16,36 amino acids are changed into Gln, and the 13rd, 20,24,33 amino acid changes are Pro, and the C end increases Gln and two amino acid of Gly; The base sequence of described people source N,O-Diacetylmuramidase and two fens Ziren source LL-37 antigen-4 fusion protein genes is shown in the SEQ ID NO:4, and the amino acid preface of described people source N,O-Diacetylmuramidase and two fens Ziren source LL-37 antigen-4 fusion protein genes is shown in SEQ ID NO:5.

But the present invention also provides above-mentioned double-promoter can induce the application of secretor type shuttle plasmid in preparation treatment antibacterials.

The invention provides a kind of difunctional secretion inducing type shuttle expression carrier; Same expression vector clone's target protein gene can efficiently express in different expression systems, particularly express one type to prokaryotic organism have toxic action like genes such as cecropin, N,O-Diacetylmuramidase, toxalbumin.Building process of the present invention is: the Bovinelactoferrin gene is arranged between the NdeI and XhoI site of MCS clone on the pET-28a plasmid; The step in NheI site is deleted in success; Present invention includes one and on clone's promotor signal peptide function fragment, introduce BglII and PstI restriction enzyme site step; Do not change the pET-28a structure, be cloned into promotor signal peptide function fragment on the pET-28a, also comprised the promotor signal peptide function fragment of BglII single endonuclease digestion pET-28a and pcr amplification; The pET-28a after the BglII enzyme cut and the function fragment of pcr amplification adopt the ligase enzyme Connection Step, comprise the step of a plasmid conversion after will connecting; Comprise that the BglII single endonuclease digestion inserts the step of identifying the function fragment direction of insertion behind the pET-28a; Comprise the step that the pET-28a that contains secretion type expression promotor signal peptide function fragment and pE194 shuttle back and forth; The PstI enzyme is cut pET-28a and pE194; Adopt the ligase enzyme step of connecting behind the purifying; Comprise the step that a plasmid after will connecting transforms, obtain can be in intestinal bacteria, Bacillus subtilus and Bacillus sphaericus the shuttle plasmid transformant of shuttling expressing clone gene.

The promotor signal peptide fragment of the present invention's amplification is introduced BglII and PstI, and the BglII site is unique enzyme point of contact on the pET-28a carrier, can under the situation that does not change the pET-28a function, be cloned into promotor signal peptide function fragment on the pET-28a; Do not have PstI on the pET-28a carrier, introduce the PstI site, conveniently shuttle back and forth with Bacillus subtilus pE194 plasmid through the PCR primer amplification, structure can be in intestinal bacteria, Bacillus subtilus, Bacillus sphaericus all can expressing gene shuttle plasmid.The target protein gene that NheI that introduces and KpnI site can make expression inserts with correct direction and expresses.The NheI site still is the identification cleavage site of signal peptidase, helps expressing protein and secretes outside born of the same parents.

The antibacterial peptide gene that double-promoter secretion inducing type of the present invention is expressed in the shuttle plasmid can pass through abduction delivering; Also can the secretor type born of the same parents express outward; Any function fragment repeats the amalgamation and expression of connecting in also can antibacterial peptide partial amino-acid fragment; Also can same gene redundancy tandem expression, introduce therebetween and dissolve (Portugal's ball) bacterium enzyme cleavage site, express after dissolve (Portugal's ball) bacterium enzyme enzyme and cut the recovery sterilizing function.

The invention provides a kind of can abduction delivering, also can express the shuttle plasmid of target protein by external secretion, and efficiently express the isogenic method of N,O-Diacetylmuramidase or cecropin or toxalbumin.The expression vector that the present invention makes up is suitable in prokaryotic organism (intestinal bacteria, subtilis, Bacillus sphaericus), expressing.This shuttle plasmid changes prokaryotic organism over to and expresses albumen such as toxalbumin, cecropin with amalgamation mode the host is not showed toxic action.Through polypeptide protein or fusion rotein achieving successes such as shuttle plasmid expressing human source LL-37 of the present invention, Bovinelactoferrin, N,O-Diacetylmuramidases.The expression vector plasmid that the present invention makes up is introduced 6His, and is convenient through the Ni column purification.Fusion rotein behind the purifying is through dissolving the identification (GGG) of (Portugal's ball) bacterium enzyme to the intersegmental restriction enzyme site of each fusogenic peptide; And correct cutting; Discharging each functional peptides makes it recover original activity; And (Portugal's ball) the bacterium enzyme that dissolves that is used to cut is removed separation and directly use of quilt from, and dissolving (Portugal's ball) bacterium enzyme itself is exactly the single-minded enzyme of killing streptococcus aureus.This method has the albumen of toxic action effective especially for expressing one type to the host; Method is easy; Easy handling; The target protein expression vector that makes up an expression can be expressed in intestinal bacteria, subtilis, Bacillus sphaericus simultaneously, therefrom finds the expression system of suitable high yield easily, has certain shared property.Time saving and energy saving, get twice the result with half the effort.The shuttle expression carrier plasmid that the present invention makes up also can be through IPTG or lactose-induced, to improve gene expression dose; Be suitable for external secretion yet and express, the target protein convenient processing that external secretion is expressed does not have contaminated with endotoxins again.Owing to have difunctional promotor, different genes all can insert gene in suitable correct direction and express.

The shuttle plasmid design that the present invention makes up considers that following characteristics: pET-28a is a Novagen company commercialization expression vector; Contain single BglII restriction enzyme site on the plasmid vector; The BglII enzyme is cut and is not changed former plasmid function vector, utilizes BglII enzyme point of contact to be inserted in pET-28a to the secretor type promotor signal peptide function fragment of pcr amplification; There is not PstI on the pET-28a carrier; When pcr amplification secretor type promotor signal peptide function fragment, introduce PstI; PET-28a and pE194 two plasmids that contain secretor type promotor signal peptide function fragment are cut with the PstI enzyme in the amplification back; The T4 ligase enzyme connects, CaCl2 method transformed competence colibacillus intestinal bacteria DE3, obtain can be in intestinal bacteria and Bacillus subtilus the shuttle plasmid transformant of shuttling expressing clone gene.The promotor of when this shuttle plasmid expressing gene, being cloned has wider shared property, clones an expression vector plasmid and just can in intestinal bacteria, Bacillus subtilus and Bacillus sphaericus, start expression; The clone has signal peptide sequence on the plasmid, and the target protein of expression is secreted outside born of the same parents, makes things convenient for separation and purification; Designed effective terminator and terminator sequence, protein translation is effectively stopped; The signal peptidase cleavage site designs the connection that favourable enzyme is cut the correct direction of rear clone gene; The clone has 6His on the shuttle vector, can carry out separation and purification through the Ni post easily; The shuttle vector clone has the enzyme of lysostaphin to cut identification point (GGG); When the target protein of Ni column purification has a plurality of functional peptides amalgamation and expression; Cut through the lysostaphin enzyme; Discharge fusogenic peptide albumen easily, more meaningful to expression one type of albumen toxic to the host or killing action as antibacterial peptide, toxalbumin.In a word, the shuttle plasmid of the present invention's design has certain shared property, can different gene be cloned in carrier and express.

The present invention compares with prior art, and its effect is obvious, initiative, with strong points.Invention is introduced between each fusion function peptide and is connected little peptide, and this connects little Toplink by lysostaphin specificity cutting [Recsei, PNAS, 1987, Vol84, pp1127-1131], recovers the sterilizing function of original peptide through the cutting of lysostaphin specificity.In the culturing process of engineering bacteria; The cecropin that merges is expressed host bacterium self is no longer produced murder by poisoning, and amalgamation and expression makes molecular weight increase no longer again and degraded by the host bacterium, and expression amount increases thereupon; Especially express the class of enzymes resemble the human lysozyme, this enzyme itself is exactly one and presses down Bactericidal enzyme.Simultaneously, consider the separation and purification of expression product, merged 6His at fusion rotein C end; Work as fermentation ends; Utilize the Ni post easily with the fusion rotein purifying, with lysostaphin fusion rotein is carried out the specificity cutting again, discharge polypeptide and make it recover original sterilizing function.Mark sheet of the present invention is present; The N,O-Diacetylmuramidase and the sterilization polypeptide of expressing and be used to cut the equal tool sterilizing function of lysostaphin of fusion polypeptide; The present invention uses gene engineering method to improve mass production of high activity sterilization polypeptide to be purpose, thereby need not separate with purifying with lysostaphin cutting and directly used.The present invention is a kind of technological method that a kind of using gene engineering technique is produced various sterilization polypeptide, human lysozyme or the fusion rotein between them.

Description of drawings:

But Fig. 1 can induce the structure synoptic diagram of secretor type shuttle plasmid for double-promoter.

Fig. 2 is the sterilization effect figure of antibacterial peptide.

Embodiment:

But embodiment 1 double-promoter can be induced the structure of secretor type shuttle plasmid

But the structure of double-promoter secretion inducing type intestinal bacteria and Bacillus subtilus shuttle plasmid is as shown in Figure 1.Intestinal bacteria pET-28a is a Novagen commercialization expression plasmid.NdeI and XhoI double digestion pET-28a, insertion contains two sections functional peptides of the Bovinelactoferrin of NdeI and XhoI restriction enzyme site, deletes the NheI in the MCS with this.Deletion NheI is that NheI also is the site that gene inserts with correct direction for introducing in the promotor signal peptide function fragment that makes up subsequently has the cleavage site NheI of signal peptidase; The 0.3kb Bovinelactoferrin gene that inserts can carry out abduction delivering under the inducing of IPTG or lactose.

The dna sequence dna of clone's Bovinelactoferrin is shown in SEQ ID NO:1, and aminoacid sequence is shown in SEQID NO:3. CATATGGGCGGCGGCTTCAAATGCTGGCGCTGGCAGTGGCGCTGGAAGAAACTGGGCGCGCCGAGCATTACCTGCGTGCGCCGCGCGTTTGGCGGCGGCTTCAAATGCTGGCGCTGGCAGTGGCGCTGGAAGAAACTGGGCGCGCCGAGCATTACCTGCGTGCGCCGCGCGTTTGCGGGCCGCCGC CTCGAG

The promotor signal peptide fragment of clone's secretor type can make the target protein of expression secrete outside born of the same parents.The promotor signal peptide fragment PCR amplimer of design.

P1：5-A GCCGGCATGGCCTGCAGCCGGAACTCTTGAATG，

P2：5-CC GGTACCGCTAGCATGTGTTTCATTTTGA，

In promotor that increases and signal peptide function fragment, introduce BglII and PstI, the BglII site is unique enzyme point of contact on the pET-28a carrier, can under the situation that does not change the pET-28a function, can be cloned into promotor signal peptide function fragment on the pET-28a; Do not have PstI on the pET-28a carrier, introduce the PstI site, conveniently shuttle back and forth with Bacillus subtilus pE194 plasmid through the PCR primer amplification, structure can be in intestinal bacteria, Bacillus subtilus, Bacillus sphaericus can both expressing gene shuttle plasmid.The NheI site of introducing is the signal peptidase cleavage site, also is the site that expressing gene inserts with correct direction.Amplify promotor signal peptide function fragment with PCR method.The pcr amplification condition of promotor signal peptide function fragment, 94 ℃ of sex change be after 3 minutes, 94 ℃ of sex change 30s, and 55 ℃ of annealing 40s, 72 ℃ are extended 30s.30 circulations were extended 3 minutes for back 72 ℃.With purifying kit purifying pcr amplification product.

The clone has effective termination subarea in described promotor signal peptide function fragment, and 6His to be making things convenient for purifying, and three contained Gly codons can excise 6His by molten (Portugal's ball) bacterium enzyme enzyme behind expression and purification, make expression product more approach original series.

P3：5-CAT GCTAGCGGTACCGGCGGCGGCGGCCATCATCACCACCACCACTGAGCGCGC，

P4：5-ACCACCACTGAGCGCGCTTTTTATAAACTTATATGATAATTAGAGCAAATAAAA，

P5：5-C GCCATGCCGGCAAGCTTCAACTTTAGGAATGAGAAAAAATTTTTATTTGCTCTAA，

Going out the 91bp fragment with primer P2 and the overlapping pcr amplification of P3, is template with this fragment again, amplifies terminator primer sequence 132bp with P1 and P3 primer PCR.Terminator sequence pcr amplification condition, 94 ℃ of sex change be after 3 minutes, 94 ℃ of sex change 30s, and 55 ℃ of annealing 40s, 72 ℃ are extended 30s, 30 circulations.Accomplish behind the secondary PCR with purifying kit purifying pcr amplification product.

After obtaining promotor signal peptide fragment and terminator fragment, carry out overlapping PCR with segmental P1 primer of amplification promotor signal peptide and the segmental P3 primer of amplification terminator again, amplify and contain promotor signal peptide and the function fragment that stops the subarea.Pcr amplification system 50uL, promotor signal peptide fragment and each 2uL of terminator fragment are template, promotor signal peptide fragment P1 primer 1uL, terminator fragment P3 primer 1uL, Taq enzyme buffer liquid 5uL, 10mmol/L dNTP 1.5uL, Taq enzyme 0.3uL, water 37.2uL.The pcr amplification condition: 94 ℃ of sex change are after 3 minutes, 94 ℃ of sex change 30s, and 54 ℃ of annealing 40s, 72 ℃ are extended 45s, 30 circulations, 72 ℃ were extended 2 minutes again.

Forward P7:5-AAAATGAAACACAT GCTAGCGGTACCGGCGGCGGCGGCC (NheI, KpnI)

Reverse P8:5-GGCCGCCGCCGCC GGTACCGCTAGCATGTGTTTCATTTTG (NheI, KpnI)

After synthesizing promotor signal peptide function fragment, be template, with primer P1 and primer P8 with this fragment; Primer P7 and primer P5; Synthesize two fragments respectively, after electrophoresis reclaims, mix two fragments that reclaim; Carry out overlapping PCR with P1, P5 two primers again, obtain to contain the whole promotor signal peptide function fragment of BglII, PstI, NheI, KpnI and BglII restriction enzyme site.Accomplish behind the overlapping PCR with purifying kit purifying pcr amplification product.

The promotor signal peptide function fragment of purifying, 16 ℃ are connected with pMD 18-T and spend the night CaCl on the PCR appearance ₂Method transformed competence colibacillus intestinal bacteria DE3, liquid to be transformed are absorbed the back by solid medium and are inverted overnight cultures in 37 ℃ of incubators, and the transformant that grows on Amp+ plate switching is preserved, and send the order-checking row.It is identical with expected design to measure the result.The result is (SEQID NO:2) as follows.

Secretor type promotor signal peptide function fragment sequencing sequence

A GCCGGCATGGCCTGCAGCCGGAACTCTTGAATGTTTAGTTTTGAAAATTCCAAAAAAAAACCTACTTTCTTAATATTGATTCATATTATTTTAACACAATCAGTT AGAATTTCAAAAATCTTAAAG TCAATTTTTGAGTGTGTTTGTATATTTCATCAAAATCAATCAATATTATTTTACTTTCTTCATCGTTAAAAAATGTAATATTTATAAAAATATGCTATTCTCATAAATGTAATAATAAATT AGGAGGTATTAAGG TTGAAGAAAACAAAAAACAATTATTATACGAGACCTTTAGCTATTGGACTGAGTACATTTGCCTTAGCATCTATTGTTTATGGAGGGATTCAAAATGAAACACAT GCTAGCGGTACCGGCGGCGGCGGCCATCATCACCACCACCACTGAGCGCGCTTTTTATAAACTTATATGATAATTAGAGCAAATAAAAATTTTTTCTCATTCCTAAAGTTGAAGCTT GCCGGCATGGCG，

The underscore tilted letter respectively is BglII, PstI, NheI, KpnI and BglII; Other underscores respectively are-35 district AGAATTT ,-10 district TCAATTTTTG, ribosome bind site AGGAGGT, initiator codon TTG, 3Gly, 6His, terminator codon TGA.

The BglII single endonuclease digestion contains the pMD 18-T and the pET-28a that contains cecropin of promotor signal peptide function fragment, and 37 ℃ of enzymes are cut 3h, 1% agarose electrophoresis; And the pET-28a of BglII single endonuclease digestion prevented recirculation (dephosphorization buffered soln 5uL, Ostase 2.5uL, the pET 28a fragment 5uL that the switchback of BglII enzyme is received with the Ostase dephosphorization; Moisturizing is to 50uL) 65 ℃ of effect 30min; Moisturizing is handled each once with phenol/chloroform/primary isoamyl alcohol and chloroform/primary isoamyl alcohol respectively to 100uL, and water adds 2.5 times of-20 ℃ of absolute ethyl alcohols; Deposit D NA, and high speed centrifugation reclaims pET-28a.Mix in right amount then and with the promotor signal peptide function fragment of purifying kit purifying, connect with the T4 ligase enzyme.Linked system 10uL, promotor signal peptide function fragment 5uL, the pET-28a carrier 2uL of lysozyme connects damping fluid 1uL, T4 ligase enzyme 0.2uL, water 1.8uL.16 ℃ of connections of PCR appearance are spent the night.CaCl ₂Method transformed competence colibacillus intestinal bacteria DE3, liquid to be transformed are absorbed the back by solid medium and are inverted overnight cultures in 37 ℃ of incubators, and the transformant that grows on Kan+ plate switching is preserved.Enlarged culturing is extracted plasmid with little upgrading grain kit simultaneously, carries out the enzyme blanking method and identifies the insertion direction of fragments.With PstI and NdeI double digestion, 1% agarose gel electrophoresis is compared with standard molecular weight.No matter with what direction insert, form always the result is cut by two kinds of possible enzymes.One group is 1.9kb and two fragments of 4.2kb, and another group is 2.4kb and two groups of fragments of 3.7kb.Electrophoresis result shows that two bands are respectively 1.9kb and 4.2kb.So actual enzyme obtains result as shown in Figure 1 after cutting connection.The connection site of promoter sequence AGGAGGT that is cloned and mRNA and 16S ribosome-RNA(rRNA) is complementary fully, the complete homology of σ 37 promotors [Recsei, PNAS, 1987, Vol84, pp1111-1127] of-35 districts of promotor and-10 districts and Bacillus subtilus.Therefore the shuttle plasmid that makes up is suitable for clone gene expression in Bacillus subtilus, also is suitable in Bacillus sphaericus, expressing.When at escherichia coli expression with Kan+ as selection markers, can be through IPTG and the lactose-induced clone gene that efficiently expresses; In subtilis and Bacillus sphaericus during cloning by expression genetic expression, as selection markers, and carry out secretor type and efficiently express clone gene with Em+.

As reporter gene, carry out expression ratio that different table reaches system behind the clone with human lysozyme, people's cecropin LL-37.Simultaneously indivedual amino acid are carried out codon mutation; Carrying out the pcr amplification polyphone of two molecule L L-37 expresses; Introduce and dissolve (Portugal's ball) bacterium enzyme cleavage site GGG; The dna sequence dna of people source N,O-Diacetylmuramidase and people source LL-37 antigen-4 fusion protein gene is shown in SEQ ID NO:4, and the aminoacid sequence of people source N,O-Diacetylmuramidase and people source LL-37 antigen-4 fusion protein gene is shown in SEQ ID NO:5.

GCTAGCAAAGTGTTCGAACGTTGCGAACTGGCGCGTACCCTGAAACGTCTGGGTATGGATGGCTACCGTGGTATCAGCCTGGCCAACTGGATGTGCCTGGCGAAATGGGAATCTGGCTACAACACCCGCGCCACCAACTATAACGCCGGCGATCGCTCGACCGACTACGGTATTTTTCAGATTAACAGCCGCTATTGGTGCAACGACGGCAAGACCCCGGGTGCGGTGAACGCGTGTCATCTGTCGTGCTCGGCGCTGCTGCAGGATAACATTGCGGATGCGGTTGCGTGCGCGAAACGTGTGGTTCGCGATCCGCAGGGTATTCGTGCGTGGGTGGCGTGGCGTAACCGCTGCCAGAACCGTGACGTGCGTCAGTACGTGCAGGGTTGCGGTGTG GGCGGCGGCCTGCTGAACTTCTTTCGCAAGAGCAAGCAGAAGCCGGGCAAGCAGTTCAAACGCCCGGTGCAGCGCCCGAAGAACTTCTTACGCAACCTGCCGCCGCGCACCCAGAGCCAG GGCGGTGGCCTGCTGAACTTCTTTCGCAAGAGCAAGCAGAAGCCGGGCAAGCAGTTCAAACGCCCGGTGCAGCGCCCGAAGAACTTCTTACGCAACCTGCCGCCGCGCACCCAGAGCCAG GGCGGCGGTACC

Cut pET-28a and the pE194 that contains promotor signal peptide function fragment with the PstI enzyme, 37 ℃ of enzymes are cut 3h, and 1% agarose electrophoresis reclaims pET-28a and the pE194 that contains promotor signal peptide function fragment respectively, with purifying kit purifying, connects with the T4 ligase enzyme.Linked system 10uL contains the pET-28a 4uL of promotor signal peptide function fragment, and pE194 plasmid 4uL connects damping fluid 1uL, ligase enzyme 0.3uL, water 0.7uL.16 ℃ of connections of PCR appearance are spent the night.CaCl ₂Method transformed competence colibacillus intestinal bacteria DE3, liquid to be transformed are absorbed the back by solid medium and are inverted overnight cultures in 37 ℃ of incubators, and the transformant that grows on Kan+ plate switching is preserved.

Intestinal bacteria-Bacillus subtilus the shuttle plasmid that makes up thus can be used as shared expression vector, and the clone has promotor, signal peptide and terminator sequence on this shuttle plasmid.This promotor is suitable for the expression of gene in prokaryotic organism.The conversion of embodiment 2 shuttle plasmids in Bacillus sphaericus

Protoplastis method [Chang S S, Cohen S N.MolGen Genet, 1979,168:111-115] is adopted in the conversion of plasmid basically in Bacillus sphaericus.Ordinary culture medium adopts VY substratum (2.5% calf meat extract powder, 1% yeast powder), and the protoplast transformation substratum has DM3, PAB, SMM, SMMP substratum.The subtilis activation, its single bacterium colony inserts 3mL VY liquid nutrient medium, and 37 ℃ of shaking culture are spent the night.Switching 1% is to fresh medium, 37 ℃ of shaking culture 2.5h, i.e. bacteria growing to logarithmic growth middle and later periods.Soduxin concentration changes 0.3mol/L into, replaces glucose with glycerine, transforms in substratum and the reagent all to add bovine serum albumin, in PEG 6000, adds 5x10 simultaneously ^-5Mol/LCaCl ₂Take a sample at different time after adopting the N,O-Diacetylmuramidase effect in the protoplasma preparation, add the centrifugal N,O-Diacetylmuramidase of removing of dilution nutrient solution SMMP dilution then.Be used for transforming after with the preservation plasmid of embodiment 1 to the TE dialysed overnight.

Connect a global shape genus bacillus in the VY of 5mL nutrient solution, 37 ℃ of shaking culture are spent the night.Switching 2% was to fresh 30mL nutrient solution, 37 ℃ of shaking culture 2.5h, i.e. bacteria growing to logarithmic growth middle and later periods in second day.Centrifugal then, suspend with 2XSMM 1mL, add the fresh N,O-Diacetylmuramidase of joining of equal-volume, the final concentration of N,O-Diacetylmuramidase is 200u/mL, 37 ℃ of shaking culture 20min, at this moment thalline appears spherical basically.With the SMMP solution dilution of 10mL, 3000rpm/min is centrifugal.The centrifugal protoplastis adds 0.5mL SMM and suspends, and adds the plasmid 5ug mixing that embodiment 1 preserves then, adds 1.5mL PEG6000 immediately, and twice, 37 ℃ of effect of dropper pressure-vaccum 2min adds the SMMP dilution of 10mL immediately.3000rpm/min is centrifugal, and with the SMMP suspension protoplastis of 1mL, 30 ℃ are shaken 90min slowly then, draws 0.15mL respectively and coats on the plate that is added with final concentration Em10ug/mL substratum, and experiment table is placed 1h under the room temperature.After be inverted in 37 ℃ of incubators again and be cultured to transformant and grow.The transformant dibbling that grows is preserved.And carry out fermentation culture, mensuration also compares its expression level and germ-killing efficiency.Germ-killing efficiency is measured and is undertaken by embodiment 4.

The conversion of embodiment 3 shuttle plasmids in subtilis

The competence method is adopted in the conversion of Bacillus subtilus.Give birth to spore substratum (0.1% peptone, 0.07% yeast powder, 0.1%KH in new Bacillus subtilus ₂PO ₄, 0.1% glucose, 0.02%MgSO ₄, 0.02% (NH ₄) ₂SO ₄) flat board on choose single colony inoculation at SPI (1.4%K ₂HPO ₄, 0.6%KH ₂PO ₄, 0.028%MgSO ₄, 0.2% (NH ₄) SO ₄, 0.1% yeast powder, 0.5% glucose, 0.6%Na ₃Citrate, 0.02%casamino acid) in the nutrient solution, 30 ℃ of 110rpm/min shaking culture are spent the night, and receive fresh SPI with the kind amount of 1/25 volume, 37 ℃ of 250rpm/min shaking culture 4-5h, OD ₆₀₀≈ 2.0, are transferred to SPII with 1/10 inoculum size of nutrient solution volume then and (promptly in SPI, add 0.0005mol/L CaCl ₂, 0.0025mol/L MgCl ₂) in the nutrient solution, 37 ℃ of 110rpm/min shaking culture 1.5h, with the centrifugal collection thalline of 5000rpm/min, the supernatant that thalline stays 1/10 volume suspends, and the plasmid that carries out competent cell with this thalline transforms.

Get the above-mentioned competent cell of 250uL and add the EDTA that final concentration is 1mmol/L; 110rpm/min shaking culture 10min under 37 ℃ of conditions adds the plasmid DNA purification 2ug that makes up among the embodiment 1 then, continues 110rpm/min shaking culture on 37 ℃ of shaking tables; About about 1h; Continue shaking culture 30min with 250rpm/min again, be coated on the Em+ solid medium plate that contains the 10ug/mL substratum with every ware 100uL volume then, room temperature is placed about 1h; Treat that nutrient solution is absorbed the back inversion and is put in 37 ℃ of incubators cultivations, grow until single bacterium colony.The dibbling of picking list bacterium colony is preserved.And carry out fermentation culture, detect its BA.

Embodiment 4 lysozyme assays----micrococcus lysodeikticus bacteriolytic test

The present invention measures the two kinds of methods that adopt for activity of lysozyme.Method one: activatory micrococcus lysodeikticus list bacterium colony is inserted the LB nutrient solution, and 37 ℃ of shaking table overnight cultures are with solid LB substratum heat fused; Slowly cool to about 50 ℃, the micrococcus lysodeikticus of inhaling the 0.2mL overnight cultures is in the LB substratum of this fusing, and jog mixes; Do not allow to produce bubble, fall ware, approximately 20m/ ware rapidly; Be put on the level table that (the substratum level helps each other relatively sterilization spot size; To reduce error), the 5mm size stainless steel tube with sterilization punches on cakey substratum then, chooses blob of viscose; The enzyme that the lysostaphin enzyme that drips different fusion roteins in the foregoing description is cut liquid or Ni column purification is cut the enzyme that spends the night and is cut liquid, and is cultivating.Near sample well, drip the standard lysozyme soln of concentration known.Observed the sterilization spot in second day,, estimate the enzyme relative size alive of expression with the size of concentration known N,O-Diacetylmuramidase comparison sterilization spot.Method two: press the appended measuring method of Sigma company basically and carry out with the method that [vitality test of toolenzyme, p82, Shanghai science tech publishing house, 1982] make an amendment slightly.The 0.1mol/L phosphoric acid buffer of preparation pH6.2 takes by weighing NaH ₂PO ₄2H ₂O 1.17 grams, Na ₂HPO ₄12H ₂O 0.786 gram, EDTA 0.0392 gram, be dissolved in boiling sterilization go dried up in and be diluted to 100mL, calibration pH is between 6.15～6.25.N,O-Diacetylmuramidase has solvency action to specific micrococcus lysodeikticus cell wall, and under certain density micrococcus lysodeikticus, temperature and action time condition, the decline of micrococcus lysodeikticus turbidity and the concentration of enzyme and activity are proportionate.Utilize this principle to carry out nephelometry and measure enzymic activity.Take by weighing micrococcus lysodeikticus olry bacterial powder [Nat'l Pharmaceutical & Biological Products Control Institute's product] in volumetric flask, add the 0.1mol/L phosphoric acid buffer of pH6.2,25 ℃ of water-bath pre-incubations are put in the jog dissolving.Accurately measure 25 ℃ of water-bath pre-incubation substrate suspension 3mL, put 1cm optical path cuvette, measure OD _450nmAbout absorbancy 0.70, do blank zeroing, reading is A ₀Accurately take by weighing simultaneously N,O-Diacetylmuramidase standard substance 20mg, the 0.1mol/L phosphoric acid buffer dissolving with pH6.2 is settled to 250mL, is equivalent to 80ug/mL enzyme reference liquid.Accurately draw 25 ℃ of pre-incubation enzyme reference liquid 0.1mL (being the 8.0ug N,O-Diacetylmuramidase), be added to school zero cuvette, rapid mixing, manual time-keeping, writing down at this moment during to 180s, optical density is A; Accurately draw pre-incubation phosphoric acid buffer (pH6.2) 0.1mL, the blank test is done in the same operation, and reading is A0 ' when recording zero second, and reading is A ' during 180s.Every sample is done and is repeated for 2 times to reduce error.Using the blank cuvette reading in spectrophotometer correction 450nm place of preheating is zero.Regulating nephelometry mensuration enzymic activity through adding deduct of application of sample amount is that reading is in an OK range.The unit of activity that turbid malicious method is measured N,O-Diacetylmuramidase is defined as: 25 ℃, and pH6.2, under the wavelength 450nm, the enzyme effect causes absorbancy OD _450nmEvery decline 0.001 is an enzyme activity unit.

w is for measuring the weight that supplies specimen in the liquid.

V: lysostaphin cutting liquid is measured the uL number that enzyme is lived and drawn.

Embodiment 5Ni column purification amalgamation and expression albumen

The transformant list bacterium colony that contains LL-37, human lysozyme gene with embodiment 1 makes up is transferred in the LB of 5mL nutrient solution, is cultured to OD ₆₀₀≈ 1.0, and enlarged culturing is in the LB of 200mL nutrient solution, 37 ℃ of shaking table overnight cultures.The centrifugal thalline that goes, supernatant suitably concentrates through the Millipore ultra-filtration membrane, utilizes the fusion rotein C that expresses to hold contained 6 His stern constructions then, can be easily with the soluble fusion protein of expressing purifying in addition.Concrete grammar is following: the aseptic water washing that adds about 3 times of column volumes is purchased 5mL Ni ²⁺The post resin, (pH7.8) balance resin (in the operation note do not allow damping fluid to be lower than the post liquid level) is placed subsequent use for 20mmol/L sodium phosphate, 500mmol/L sodium-chlor to use the binding buffer liquid of 3 times of column volumes again instead.Will be on the suitable spissated sample solution of Millipore ultra-filtration membrane Ni ²⁺Post.The adjustment flow rate control is at≤50mL/h.Treat that the binding buffer liquid (pH7.8) of using about 6 column volumes when sample liquid leaves the about 2-3mm of liquid level instead washes post, (20mmol/L sodium phosphate, 500mmol/L sodium-chlor pH6.0) are washed post, with spectrophotometer trace flow fluid A then to use the lavation buffer solution of about 4 column volumes instead ₂₈₀Finished washing at＜0.02 o'clock, use instead lower concentration imidazoles elution buffer (the 20mmol/L sodium phosphate, 500mmol/L sodium-chlor, the 10mmol/L imidazoles, pH6.0) 4 column volume wash-outs are collected effluent with the 1.5mL centrifuge tube, the 1.5mL/ pipe is pressed elution order and is numbered.Treat that effluent also has the 2-3mm height time to use the imidazoles elution buffer wash-out successively that concentration is 100mmol/L and 200mmol/L instead, each concentration is with 4 column volumes.The wash-out 10uL that finishes to take a sample at interval again carries out the SDS-PAGE protein electrophoresis, with standard molecular weight albumen relatively, analyzing proteins distributes, and merges the about 14.7mL of fusion rotein effluent that expresses.Suitably be concentrated into about 5mL with the Millipore ultra-filtration membrane, transfer about pH7.5, with the lysostaphin 50uL of 1mg/mL, 37 ℃ of water bath heat preservation 2h.Get this liquid and measure enzymic activity.

Activity determination method such as embodiment 4 described employing plate sterilization spot detection methods.Concrete operations are following: respectively activatory micrococcus lysodeikticus, streptococcus aureus, the single bacterium colony of intestinal bacteria are inserted LB nutrient solution, 37 ℃ of shaking table overnight cultures.With solid LB substratum heat fused, slowly cool to about 50 ℃, micrococcus lysodeikticus or streptococcus aureus or the intestinal bacteria to 3 that respectively inhale the 0.2mL overnight cultures respectively have in the LB substratum of 20mL (mark institute adds strain name respectively); Jog mixes; Do not allow to produce bubble, and be put in (the substratum level helps each other relatively sterilization spot size, to reduce error) on the level table; Treat culture medium solidifying; Beat some holes about 2cm at interval at the 5mm size stainless steel tube with sterilization on the substratum then, choose blob of viscose, drip above-mentioned lysostaphin enzyme and cut liquid; This instance adds 5uL, 10uL, 15uL, four concentration of 20uL respectively, and the sterilized water with sterilization complements to 20uL simultaneously.In the middle of petridish, drip CIPROFLOXACIN USP 24 20uL as positive control.Treat under the room temperature that institute adds sample liquid and is positioned over 37 ℃ of incubator overnight cultures after by substratum basic absorption (about 1h).Observed the sterilization spot in second day,, estimate the enzyme relative size (as shown in Figure 2) alive of expression with the size of concentration known N,O-Diacetylmuramidase comparison sterilization spot.Test bacterium commonly used is to be harmful to bacterium streptococcus aureus CowanI (ATCC12598), harmful bacterium intestinal bacteria CMCC (B) 44102 and micrococcus lysodeikticus (CGMCC 1.634) as test person N,O-Diacetylmuramidase and cecropin bacteriolyze effect.

Claims

1. but a double-promoter can be induced the secretor type shuttle plasmid; It is characterized in that: the Bacillus subtilus pE194 plasmid that the intestinal bacteria pET-28a plasmid of being cut by a PstI enzyme and PstI enzyme are cut constitutes; Be inserted with lysozyme-antibacterial peptide function fragment and antibacterial peptide gene on the intestinal bacteria pET-28a plasmid that described enzyme is cut; Described lysozyme-antibacterial peptide function fragment is formed by N,O-Diacetylmuramidase and antibacterial peptide gene fusion; Between the BglII restriction enzyme site of intestinal bacteria pET-28a plasmid, be inserted with promotor signal peptide fragment; The segmental gene order of described promotor signal peptide is shown in SEQ ID NO:2; NdeI and XhoI restriction enzyme site at described intestinal bacteria pET-28a plasmid are inserted with antibacterial peptide gene, are inserted with described lysozyme-antibacterial peptide function fragment at KpnI and NheI restriction enzyme site at described intestinal bacteria pET-28a plasmid, and the gene order of described lysozyme-antibacterial peptide function fragment is shown in the SEQ ID NO:4.

2. but a kind of double-promoter as claimed in claim 1 can be induced the secretor type shuttle plasmid, it is characterized in that: described antibacterial peptide gene is Bovinelactoferrin peptide gene or people source cecropin gene or people source lysozyme gene or cecropin gene or Magainin gene or melittin gene or people's derived antimicrobial peptide LL-37 gene.

3. but a kind of double-promoter as claimed in claim 1 can be induced the secretor type shuttle plasmid, it is characterized in that: it is GGG that the enzyme of the lysostaphin in the described lysozyme-antibacterial peptide function fragment is cut the recognition site aminoacid sequence.

4. but the described a kind of double-promoter of claim 1 can be induced the construction process of secretor type shuttle plasmid; It is characterized in that: comprise a step of cutting intestinal bacteria pET-28a plasmid at NdeI and XhoI site enzyme; Cut at least one antibacterial peptide gene of insertion between intestinal bacteria pET-28a plasmid NdeI and the XhoI restriction enzyme site at described enzyme; Comprise that also makes up the segmental step of promotor signal peptide; On described promotor signal peptide fragment, be disposed with BglII, PstI, NheI, KpnI and BglII restriction enzyme site, described promotor signal peptide fragments sequence is cut promotor signal peptide fragment and intestinal bacteria pET-28a plasmid with the BglII enzyme respectively then shown in SEQ ID NO:2; The employing ligase enzyme connects; Form one and be inserted with the segmental intestinal bacteria pET-28a of promotor signal peptide plasmid, also comprise a step that makes up the lysozyme-antibacterial peptide function fragment, be respectively arranged with NheI and KpnI restriction enzyme site at the two ends of lysozyme-antibacterial peptide function fragment; Cut at NheI that is inserted with the segmental intestinal bacteria pET-28a of promotor signal peptide plasmid and KpnI site enzyme then; Insert the lysozyme-antibacterial peptide function fragment, adopt ligase enzyme to connect, form an intestinal bacteria pET-28a plasmid that is inserted with the lysozyme-antibacterial peptide function fragment; Also comprise a step of cutting at the PstI site enzyme of the intestinal bacteria pET-28a plasmid that is inserted with the lysozyme-antibacterial peptide function fragment; The Bacillus subtilus pE194 plasmid that enzyme is cut in the PstI site is inserted with the intestinal bacteria pET-28a plasmid of lysozyme-antibacterial peptide function fragment then, can induce the secretor type shuttle plasmid but constitute double-promoter of the present invention.

5. but a kind of double-promoter as claimed in claim 4 can be induced the construction process of secretor type shuttle plasmid, it is characterized in that: make up in the segmental step of promotor signal peptide at one, the primer sequence of pcr amplification promotor signal peptide function fragment is:

P1：5-A AGATCTCTGCAGCCGGAACTCTTGAATG，

P2：5-A AGATCTGCTTCAACTTTAGGAA，

P3：5-CAT GCTAGCGGTACCGGCGGCGGCGGCCATCATCACCACCACCACTGAGCGCGC，

P4：5-ACCACCACTGAGCGCGCTTTTTATAAACTTATATGATAATTAGAGCAAATAAAA，

P5：5-C GCCATGCCGGCAAGCTTCAACTTTAGGAATGAGAAAAAATTTTTATTTGCTCTAA，

Forward primer P7:5-AAAATGAAACACAT GCTAGCGGTACCGGCGGCGGCGGCC

Reverse primer P8:5-GGCCGCCGCCGCC GGTACCGCTAGCATGTGTTTCATTTTG

6. but a kind of double-promoter as claimed in claim 4 can be induced the construction process of secretor type shuttle plasmid; It is characterized in that: the clone has promoter sequence, signal peptide sequence, terminator sequence, six Histidines on the described promotor signal peptide function fragment; Described promotor comprises-35 districts ,-10 districts and ribosome bind site AGGAGGT; Described signal peptide sequence is: TTGAAGAAAACAAAAAACAATTATTATACGAGACCTTTAGCTATTGGACTGAGTAC ATTTGCCTTAGCATCTATTGTTTATGGAGGGATTCAAAATGAAACACATGCTAGC, described terminator sequence is TGAGCGCGCTTTTTATAAACTTATATGATAATTAGAGCAAATAAAAATTTTTTCTC ATTCCTAAAGTT GCCGGCATGGCG, also cloning on the described promotor signal peptide fragment has BglII, PstI, NheI, KpnI and BglII restriction enzyme site.

7. but a kind of double-promoter as claimed in claim 4 can be induced the construction process of secretor type shuttle plasmid, it is characterized in that: the clone has the enzyme of lysostaphin to cut recognition site GGG and 6His on described promotor signal peptide function fragment.

8. but a kind of double-promoter as claimed in claim 4 can be induced the construction process of secretor type shuttle plasmid, it is characterized in that: described antibacterial peptide gene is Bovinelactoferrin peptide gene or people source cecropin gene or people source lysozyme gene or cecropin gene or Magainin gene or melittin gene or other source antibacterial peptide genes.

9. but a kind of double-promoter as claimed in claim 4 can be induced the construction process of secretor type shuttle plasmid, it is characterized in that: between the NheI of intestinal bacteria pET-28a plasmid and KpnI site, be inserted with the lysostaphin cleavage site.

10. but a kind of double-promoter as claimed in claim 8 can be induced the construction process of secretor type shuttle plasmid; It is characterized in that: the cutting recognition site GGG that lysostaphin is arranged at Bovinelactoferrin gene C end; The base sequence of described Bovinelactoferrin gene is shown in SEQ ID NO:1, and the amino acid preface of described Bovinelactoferrin is shown in SEQ ID NO:3.

11. but the described double-promoter of claim 1 can be induced the application of secretor type shuttle plasmid in preparation treatment antibacterials.