JPH04197184A - New polypeptide having thrombin-inhibiting activity and its production - Google Patents

Abstract

NEW MATERIAL:The polypeptide precursor having the amino acid sequence of formula. USE:Thrombin-inhibiting agent, etc. PREPARATION:The compound is produced by DNA recombination technique.

Description

DETAILED DESCRIPTION OF THE INVENTION [Field of Industrial Application] The present invention relates to a novel polypeptide having thrombin inhibitory activity and a method for producing the same.

[Conventional technology]

Thrombosis has been attracting attention as a disease that has been on the rise in recent years. A thrombus is a clot formed when blood coagulates within a blood vessel, and the pathological phenomenon in which this forms is called thrombosis. Thrombus formation is a change in the vascular endothelium.

It is known that these lesions occur frequently in areas with sclerotic and inflammatory changes, and the number of these lesions increases rapidly with age, and the fact that lifespans are increasing worldwide also increases the risk of thrombosis. This is the cause of the increase. Blood clots occur throughout the body,
It is known that it is formed due to the deposition of fibrin in the microvasculature as a result of pathological activation of thrombin. Thrombosis causes narrowing and occlusion of blood vessels due to thrombus, causing ischemic lesions and infarctions in major organs, such as the heart, brain, and lungs, leading to functional impairment in these organs. In recent years, these thromboses have attracted attention as pathologies of organitis caused by immunological mechanisms such as nephritis and pneumonitis, and as accompanying lesions during transplantation of organs and substitute blood vessels. In addition, disseminated angiogenic coagulation syndrome (DIC), which is known as a pathological condition in which thrombi occur frequently in microvessels, has been attracting attention as a unique pathological condition. The concept of DIC was proposed in the 1960s, and DIC was initially thought to be an extremely rare syndrome. However, in recent years, DI
It has become clear that DIC is not at all rare, and various clinical symptoms that have previously been overlooked without being fully explained as bleeding or organ symptoms that occur in the terminal stages of various diseases are now understood to be the result of DIC. It's coming.

Clinicopathological examples of thrombosis include stroke, myocardial infarction,
There are deep venous thrombosis, occlusion of limb arteries, pulmonary thrombosis, and fundus thrombosis, but if you add up the cases of these diseases in various organs in specialized fields, it ranks first among various diseases in terms of morbidity and cause of death. It is said.

Therefore, the clinical and pathological significance of thrombosis is expected to become increasingly important in the future.

As a treatment for such thrombosis, antithrombin■
Antivitamins are known to inhibit the biosynthesis of vitamin-dependent blood coagulation factors, and heparin, which acts through . Furthermore, as another thrombin inhibitor, gabegisate mesylate is known as a non-pebutide proteinase inhibitor. This substance also has an inhibitory effect on physiologically important enzymes such as plasmin, kallikrein, and trypsin, and its use requires careful consideration.

Heparin is a well-known antithrombotic agent that is often used to treat thrombosis such as DIC, but its action is to accelerate the anticoagulation effect of antithrombin, so it can be used to treat thromboses such as DIC and nephrosis. It is thought that heparin is not effective in the treatment of thrombosis in which antithrombin levels are decreased, such as thrombosis associated with blood clots (Reference 1). Heparin also has problematic side effects such as prolongation of bleeding time and thrombocytopenia. (“Recombinant hirud”)
in as an antithrobotic
agent''J, HJalenger, DRllGS
OF THE FUTURE, Vol15 No319
90.267-280), from this point of view, the development of new antithrombotic agents that have the potential to prevent or treat thrombosis, including DIC, is important in therapeutic and preventive medicine. It is.

HVI type hirudin is expected to be used as an antithrombotic agent having such medicinal effects.

) fVl type hirudin is a eukaryotic medical leech (H
This is a polypeptide that has thrombin inhibitory activity and is present in the salivary glands of P. irudo medicinalis.

) (Vl-type hirudin consists of 65 amino acid residues, and its structural feature is known to be the presence of three intramolecular S-3 bonds essential for the expression of thrombin inhibitory activity.

In particular, HVI type hirudin has extremely high specificity of action against thrombin and prethrombin 2 (dissociation constant:
0.8×10-”) (Reference 2), activated factor Ⅰ is only inhibited by substances other than thrombin. That is,
HVl type hirudin does not inhibit enzymes other than those involved in blood coagulation. In the form in which it is present, it is promptly excreted from the kidneys into the urine (Reference 3).

From these points, HVI type hirudin is extremely useful as an alternative to conventional antithrombotic agents.
Alternatively, it has potential as a therapeutic drug.

[Problem to be solved by the invention]

Before the advent of recombinant DNA technology, HVI type hirudin was produced by direct extraction from leeches. However, this method requires a large amount of fasted leeches to obtain even a small amount of hirudin, and also requires quite complicated purification steps and time to obtain crude hirudin.

For example, to prepare crude hirudin with a purity of about 10% and containing a large amount of leech-derived contaminant proteins in addition to HVI-type hirudin, leech homogenate that has been fasted for 2 to 3 weeks is extracted with hot water and then ethanol precipitated. It was necessary to perform acetone fractional precipitation, adsorption and desorption with bentonite, and isoelectric point precipitation.Furthermore, in order to obtain HVI-type hirudin as a pure product, using this crude hirudin, ECTEO
It is necessary to perform LA cellulose column chromatography, 5hephadex CM-25 column chromatography, and gel filtration using 5hephadex G-25, and the yield is reported to be less than 0.001% (Reference 4). Because only a small amount of HVI hirudin can be obtained, HVI hirudin cannot be used practically as a medicine, and the therapeutic use expected from the excellent properties of HVI hirudin has not yet been achieved.

In recent years, using recombinant DNA technology, it has become possible to use microorganisms as hosts to express heterologous genes that normally do not exist in the microorganisms, and to produce large quantities of heterologous gene products.

Substance production by recombinant DNA technology using microorganisms as hosts can be broadly divided into intracellular production and extracellular production.

In the case of intracellular production, it is possible to efficiently produce a heterologous gene product within the microbial cell, but the heterologous gene product may be degraded by intracellular proteases, the formation of inclusion bodies observed when produced in large quantities, Problems include the addition of methionine, a transcription initiation codon, to the amino terminus of a foreign gene product.

Recent research has revealed that all of these problems can be solved by secreting foreign gene products outside the bacterial cell (Reference 5). This method has the advantage that it is easy to purify a heterologous gene product, and the risk of contamination with foreign substances can be significantly reduced.

As described above, secretory production of heterologous gene products has great significance in terms of substance production.

Regarding HVI type hirudin, there are reports of intracellular production and extracellular secretory production.

In the former case, that is, in the case of intracellular production of HVl type hirudin using E. coli as a host, 0.2■//! −
It was reported that only HVI type hirudin, which has a thrombin inhibitory activity equivalent to A660, was observed to accumulate (Reference 6).
), the reason why only a small amount of HVI type hirudin was accumulated is probably due to the accumulation of inactive type hirudin, which does not retain thrombin inhibitory activity and whose S-S bonds are not properly cross-linked. It was done.

In the latter case, the problem of intracellular production can be avoided by expressing it in the bacterial body as a precursor protein with a secretion signal attached to the N-terminus of HVI type hirudin and secreting it outside the bacterial body. It is expected that HVI type hirudin will be secreted outside the bacterial cells.

From this point of view, secretion of HVI type hirudin using Escherichia coli and yeast as hosts has been reported.

In secretory production of HVI type hirudin using Escherichia coli as a host, problems such as those pointed out by J. Dodt et al. (Reference 7) have arisen. That is, they release mature HV immediately after the E. coli alkaline phosphatase secretion signal.
A secretion plasmid conjugated with type I hirudin was constructed, and an attempt was made to secrete HVI type hirudin using E. coli as a host. In this case, in addition to HII type hirudin, a polypeptide with three amino acids added to the N-terminal upstream of HVI type hirudin was also secreted. It was found that the thrombin inhibitory activity of this polypeptide was reduced to about 1/500 of that of HVI type hirudin.

Furthermore, in the case of secretory production of a heterologous gene product using yeast as a host, it has been pointed out that there is a particular problem in which amino acid residues on the C-terminal side of the heterologous gene product are deleted (Reference 8). In addition, in the case of secretory production of HVI type hirudin using yeast as a host, HV1 type hirudin is present at 10% in the culture solution.
mg accumulated (ref. 9), but in this case, HV
In addition to type I hirudin, it has also been reported that hirudin, which lacks one or two amino acid residues at the C-terminus of HVl type hirudin, has reduced thrombin inhibitory activity (Reference 10).

In order to avoid such problems, the present inventors developed a Bacillus species that has the ability to secrete large amounts of protein and has extensive experience in being used as an industrial microorganism used for the production of enzymes, amino acids, nucleic acids, etc. The secretory production of H1 type hirudin using bacteria as a host was investigated. In particular, we investigated the method of using Bacillus subtilis as a host, which has a wealth of genetic, biochemical, molecular biological, and applied microbiological knowledge among bacteria of the genus Bacillus. There have already been some reports on attempts to extracellularly secrete heterologous gene products using Bacillus subtilis as a host, which has unique characteristics (References 11 and 12). It has also been reported that it is not necessarily easy to secrete and produce a large amount of the derived protein (Reference Document 13).

Under these circumstances, as shown in Production Example 1 below, the present inventors constructed a heterologous gene product expression secretion vector using the neutral protease gene of Bacillus amyloliquefaciens. Using this, the HVI type hirudin secretion plasmid shown in Comparative Example 1 was constructed. moreover,
Using Bacillus subtilis transformed with this plasmid, as shown in Comparative Example 2, culture solution 1j! Hit 80
We succeeded in secreting 100 μ of HVI type hirudin from the following. However, in this case, S
It was found that there was an inactive type of hirudin that does not have thrombin inhibitory activity, which is thought to be due to the -3 bond not being accurately crosslinked.

As already mentioned, when HVI-type hirudin was intracellularly produced in Escherichia coli, such an inactive form of hirudin was produced, so it is possible that inactive form of hirudin is also produced when Bacillus subtilis is used as a host. One of the reasons for this was thought to be poor secretion efficiency. In this case, it was thought that if the secretion efficiency was improved, the proportion of such S-3 bonds that were not accurately cross-linked would be reduced. On the other hand, it has been shown that such secretion efficiency is influenced by the amino acid sequence of the binding region consisting of the C-terminal amino acid residue of the secretion signal and the N-terminal amino acid residue of the heterologous gene product.
reported by a1va et al. (reference document 14) and 5chain et al. (reference document 15). They reported that the C-terminal amino acid of the secretion signal necessary to secrete the foreign gene product outside the bacterial cell and the N-terminal amino acid of the target foreign gene product differ from the amino acid sequence of the original secretion signal break point. This suggests that secretion efficiency decreases when the amount of secretion increases.

As a method to make the amino acid sequence of the binding region of both the same as the sequence of the original secretion signal, there is a method of substituting the N-terminal sequence of the target foreign protein, and a method of making the amino acid sequence of the cleavage point of the original secretion signal in the binding region of both is the method of substituting the N-terminal sequence of the target foreign protein. It will be reproduced・
One possible method is to introduce a binding region having an NA sequence.

Since the latter method has the problem of decreased activity due to the addition of amino acid residues derived from the binding region as described below, the present inventors investigated the former method. However, I(
Amino acid sequence of the N-terminal region of Vl type hirudin (l to 5
position) is an important sequence in that it is involved in maintaining the structure of the C-terminal active site of HVI type hirudin (Reference 16), and alteration of this part has a large effect on maintaining activity. For example, as mentioned above, the thrombin inhibitory activity of a polypeptide with three amino acid residues added upstream of this part is 11% higher than that of Hvl-type hirudin.
It is reported that the number has decreased to 1500 (Reference 7).
From this, it can be clearly understood that the amino acid sequence of the N-terminal region of HVI type hirudin plays an important role in the expression of thrombin inhibitory activity. This means that if the amino acid sequence of the original secretory signal cleavage site is reproduced by substituting the N-terminal region of HVI-type hirudin, even if the N-terminal amino acid residue of HVI-type hirudin is replaced, the secretion of the polypeptide This suggests that even if the accumulated amount increases, the thrombin inhibitory activity of this polypeptide is likely to decrease.

The objective of the present invention is to efficiently produce polypeptides with high thrombin inhibitory activity that can be used as prophylactic or therapeutic agents for thrombosis. The purpose is to provide a manufacturing method that produces high yields.
Moreover, it is necessary to find an amino acid sequence of a polypeptide having thrombin inhibitory activity that does not have a thrombin inhibitory activity lower than that of H1 type hirudin.

[Means to solve the problem]

In view of the above, the present inventors found that the secretion signal of the neutral protease of Bacillus amyloliquefaciens is HV as described in Comparative Example 1 and Comparative Example 2 below.
It was found to be useful for secretory production of type I hirudin. However, to achieve even higher secretion efficiency, HVI
H■1 by modifying the N-terminal region amino acid sequence of type hirudin
We investigated a precursor of a polypeptide that does not lose the high thrombin inhibitory activity of type H1 hirudin (and can increase the amount of secretory production). By substituting hirudin, the selectivity for thrombin time is increased compared to HVI-type hirudin without reducing its high thrombin inhibitory activity, and it has a high antithrombotic effect on a rat congestive venous thrombosis model and is effective. The present invention was finally completed by discovering the structure of a polypeptide that is secreted and produced outside the bacterial body of Bacillus subtilis. It has the structure of a so-called pre-secretory precursor, which has a polypeptide-bound amino acid sequence with the N-terminal region modified as described below. The secretion signal is removed, resulting in a mature polypeptide with thrombin inhibitory activity.This polypeptide is secreted more efficiently than HVI type hirudin, and its thrombin inhibitory activity is at the same level as HVI type hirudin. It has higher selectivity for thrombin time than Hvl-type hirudin, and has a high antithrombotic effect on a rat congestive venous thrombosis model.

The polypeptide of the present invention that has high thrombin inhibitory activity, has increased selectivity for thrombin time compared to HV1 hirudin, and has a high antithrombotic effect on a rat congestive venous thrombosis model is the N-terminal of HVI type hirudin. valine and aspartic acid at the fifth residue from the N-terminus are replaced with alanine and glutamic acid, respectively. The present invention also provides a promoter of the neutral protease gene of Bacillus amyloliquefaciens,
A DNA fragment to which a DNA fragment encoding a precursor of the polypeptide according to claim 1, which has thrombin inhibitory activity and has thrombin inhibitory activity downstream of the ribosome binding site, is bound to the vector DNA. A secretory plasmid, a transformed strain obtained by transformation with this secreted plasmid, and a polypeptide having thrombin inhibiting activity, which is obtained by culturing this transformed strain and recovering a polypeptide having thrombin inhibiting activity from the culture supernatant. This relates to a manufacturing method.

The present invention will be explained in detail below.

The term promoter used in the present invention refers to a DNA sequence that is recognized and bound by RNA polymerase.

Generally, when the starting point of RNA synthesis is set to "+1" and the DNA sequences upstream thereof are arranged, it is known that a highly common DNA sequence exists at about 10 bases from there. Its DNA sequence is 5' TATAAT 3';
It is known that there is a highly common DNA sequence about 35 bases further upstream of the ``108i region'', and the DNA sequence is 5''TTGACA3', which is called the ``-35 region''. Normally, the ``-35 Sekijo'' is required for RNA polymerase recognition, and the ``-1083 region'' is required for its binding (Reference 17).
).

Bacillus subtilis is known to have several types of RNA polymerases. This diversity plays an important role in the sporulation process of Bacillus subtilis, which involves complex expression regulation. In particular, most of the RNA polymerase in the vegetative growth phase is σ55 type RNA.
It is known that the transcription of most genes is carried out by this polymerase (Reference 18).
).

″-1 of the promoter in the secretory plasmid of the present invention
DN considered to be “061 area” and “-35 area”
The A sequence is 5゛TATTAT3'' starting from T, which is the 202nd base from the 5' end, and 179 of the DNA sequence according to claim 8.
5' TTC, CAG starting from the th base T
It is 3°.

This DNA sequence is a consensus sequence that is the recognition sequence and binding sequence of σ55-type RNA polymerase, which is the main RNA polymerase during the vegetative growth phase of Bacillus subtilis.
35 and one ten! It has high homology with the sequence of the region (Reference 18).

Furthermore, the term "ribosome binding site" refers to a DNA sequence where mRNA synthesized by RNA polymerase binds to a ribosome.

Generally, the ribosome binding site is a DNA sequence commonly found 5 to 9 bases upstream of the start codon, and is a DNA sequence commonly found 5 to 9 bases upstream of the start codon.
Refers to the NA sequence that is complementary to the 3'-end DNA sequence of
The 16S rRNA DNA sequence differs depending on the type of microorganism, but the 16S rRNA of Bacillus subtilis
The DNA sequence of is known to be 3' UCUUUCCUCC 5' (Reference 18).

The DNA sequence considered to be the ribosome binding site of the secretory plasmid of the present invention is the 5'AAAGG (, GG3'.This DNA sequence is 16Sr of Bacillus subtilis.
It has extremely high complementarity with RNA.

It is now widely known that the DNA sequences encoding these bromotors and ribosome binding sites play important roles in gene expression, and that these DNA sequences are related to gene expression efficiency. (Reference 1
8).

When expressing a desired protein gene using Bacillus bacteria as a host, the RNA polymerase and ribosomes of Bacillus bacteria have strict specificity for promoters and ribosome binding sites (Reference 18).
Those regions are preferably derived from Bacillus bacteria (Reference 19).

Secretory proteins are synthesized within bacteria as precursor proteins with a secretion signal added to the N-terminal upstream of the mature protein, but the secretion signal is removed from this precursor protein during the secretion process and the precursor protein is released into the bacteria as a mature protein. The mature protein is secreted outside the body (Reference 20), where the mature protein refers to a protein from which its own secretion signal has been removed from the secretory protein.
Furthermore, the secretion signal refers to a polypeptide consisting of 20 to 30 amino acid residues present upstream of the N-terminus of the mature protein.The secretion signal has the following nine characteristics.

Specifically, it is known that there is a basic amino acid near the N-terminus, a cluster of hydrophobic amino acids in the center, and an amino acid with a small side chain at the cleavage site of the secretory signal.

This polypeptide is removed during the secretion process and is thought to play an important role in the passage of the precursor protein through the cell membrane (Reference 20).

The amino acid sequence that is the secretion signal for Bacillus amyloliquefaciens neutral protease used in the construction of the secretion plasmid of the present invention is Met-Gly-Leu-Gl.
y-Lys-Lys-Leu-3er-3er-Ala
-Val-Ala-^1a-5er-Phe-Me t
-5er-Leu-Thr-11e-5er-Leu
-Pro-G Iy-Val-Gln-Ala- and has a typical secretion signal structure.

The DNA sequence encoding this secretion signal is 5' of the DNA sequences shown in claim 8 of the claims of the present invention.
5' starting from G, the 251st base from the end
GTC,GC,TTTAGGTAAGAAATTGT
CTACTGCTGTAGCCGCTTCCTTTAT
C,AGTTTAACCATCAGTCTGCCGGG
TGTTCAGGCCGCT3'.

As described in Comparative Example 1, the present inventors discovered that Bacillus
A Hvl type hirudin secretion plasmid was constructed by ligating a DNA fragment encoding H1 type hirudin immediately after the promoter, ribosome binding site and secretion signal of the neutral protease gene of E. amyloliquefaciens. Furthermore, as shown in Comparative Example 2, by culturing the transformant obtained by transforming Bacillus subtilis with this plasmid, we succeeded in secreting Vl-type hirudin (into the culture medium). However, In this case, it was found that there was a small amount of inactive hirudin that does not have thrombin inhibitory activity because the S-3 bond is not accurately cross-linked. Since such an inactive form of hirudin was produced when Bacillus subtilis was used, low secretion efficiency was considered to be one of the reasons for the production of such an inactive form of hirudin in Bacillus subtilis. ,
When Bacillus subtilis is used as a host, inactive hirudin is thought to be formed due to decreased secretion efficiency of hirudin, suggesting that improving secretion efficiency is useful as a way to avoid this problem. It was done. Therefore, by modifying the amino acid sequence of the binding site between the secretion signal and mature hirudin in the HVI type hirudin secretion plasmid, that is, the amino acid sequence of the cleavage point of the secretion signal, we have proposed converting this inactive type hirudin into active type hirudin. investigated. That is, Pa1va et al.
Reference 14), 5chien et al. (Reference 15),
We report on the effect of changing the original amino acid sequence of the secretion signal derived from the binding of the secretory signal to a different amino acid sequence on the efficiency of secretion productivity of the foreign protein.

In other words, Palva et al. investigated the region containing the secretion signal breakpoint (Ala-amylase gene) of Bacillus amyloliquefaciens, which is one of the secreted proteins.
DN encoding mature interferon (IFN) immediately following Val) or via a binding region consisting of 5 amino acid residues (Asn-Gly-Thr-Glu-Ala)
A fragment was ligated to try to secrete human IFN protein. In this case, the secretion signal was removed, but the secreted interferon was either one (Val) or six (Vat-Asn-
It is reported that a fusion protein with added amino acids (Gly-Thr-Gln-Ala) was secreted and accumulated, and the amount thereof was 0.5 mg to 1 mg per 11 culture fluids. On the other hand, 5chain et al. ligated a DNA fragment encoding mature interferon (IFN) immediately after the region encoding the C-terminal amino acid (Ala) of the secretion signal of the α-amylase gene as Pa1va et al. I tried to secrete it. However, in this case, it has been reported that a large amount of precursor IFN or mature IFN remained in the cell membrane, and only a small amount was secreted into the medium.

In addition, the relationship between the structure of the cleavage site of the secretory signal and secretion efficiency and membrane permeation has been investigated (Reference 21).
As a result, it was found that the amino acid sequence of the cleavage site plays an important role in cleavage at the precise cleavage site.

The above suggests that the secretion productivity of the foreign protein may be higher if the amino acid sequence of the original secretion signal is reproduced in the binding region of the secretion signal and the foreign gene product. The reason for this is thought to be that the amino acid sequence that is the original cleavage site of the secretion signal is more easily cleaved by signal peptidase than the altered cleavage site. In order to reproduce the cleavage site of the original secretion signal, the amino acid sequence of the original secretion signal must be reproduced between the base sequence encoding the C-terminus of the secretion signal and the N-terminus of the target heterologous gene. A method of inserting a binding region having a different base sequence, or a method of changing the N-terminal amino acid sequence of HVI type hirudin to alanine to reproduce the alanyl-alanine cleavage site of the original secretion signal. Two methods have been considered for altering the DNA sequence encoding the amino acid sequence.

In the former case, i.e., the C-terminus of the secretory signal and Hvl
If an inserted region that reproduces the amino acid sequence of the original secretion signal cleavage point is created between the N-terminus of type hirudin, N
A fusion protein with an extra amino acid added to the end may be secreted (Reference document 14). In particular, in the case of HVI-type hirudin, it has been pointed out that the presence of such additional amino acids leads to a significant decrease in thrombin inhibitory activity, as described in the above-mentioned literature (Reference 7).

In addition, the latter method also poses a difficult problem since the N-terminal amino acid sequence of HVI type hirudin is reported to play an important role in maintaining its high thrombin inhibitory activity (Reference 22). It has become. After intensively studying this problem, the present inventors completed the present invention as shown below.

That is, the C-terminal amino acid of the secretion signal in the HVI type hirudin secretion plasmid shown in Comparative Example 1 and the HVI
We focused on the fact that the amino acid sequence at the cleavage site of the secretion signal that binds to the N-terminal amino acid of type hirudin is alanyl-valine, which is different from the alanyl-alanine cleavage site of the secretion signal of the original neutral protease.

On the other hand, the mechanism of expression of thrombin inhibitory activity of HVI type hirudin has already been studied. According to this, the C-terminus of hirudin (residues 56-65) is thought to bind to thrombin and significantly change the three-dimensional structure of thrombin, resulting in the expression of thrombin inhibitory activity (Reference 23
).

In addition, the amino acid sequence of the N-terminus (residues 1-5) of Hvl-type hirudin is related to the structural maintenance of the C-terminal active site of HVI-type hirudin, as previously reported (
It is considered to be an important sequence in Reference 16).

Based on these facts, if the original cleavage point by signal peptidase is created in the binding region by replacing the N-terminal region of HVI-type hirudin, even if the polypeptide in which the N-terminal region of HVI-type hirudin is replaced can be efficiently cultured. It is easily inferred that even if secreted into fluid, the secreted polypeptide is likely to have only weak thrombin inhibitory activity.

On the other hand, in recent years, systems have been developed to freely create artificially mutated proteins using modified DNA technology. As a result, an academic system called "protein engineering" is being developed, which aims to create proteins with stronger activity, more stability, and completely new functions. However, in reality, there is no principle that can serve as a guiding principle for protein modification, and the current situation is that purposeful protein modification cannot be carried out. Hirujin's N as mentioned above
At present, there is no guiding principle regarding a modification method that does not reduce thrombin inhibitory activity when the terminal portion is modified to reproduce the original secretion signal break point.

Therefore, in order to minimize the effect of changing the N-terminal amino acid of HVI type hirudin from valine to alanine, the present inventors investigated An attempt was made to modify residues 1 to 5 of the polypeptide, replacing valine at the N-terminus with alanine and replacing aspartic acid at the 5th residue from the N-terminus with glutamic acid, ensuring excellent secretion efficiency and high thrombin inhibitory activity. The present invention was completed based on this discovery. That is, Example 1 and Example 2 of the present invention
As shown in Figure 2, we have discovered that a new polypeptide that has high thrombin inhibitory activity and does not exist in nature can be secreted and produced efficiently in a system using Bacillus subtilis as a host.

The blood coagulation process is a series of chain reactions culminating in fibrin clot formation (common pathway). Blood coagulation occurs through activation of relatively slow endogenous pathways, or
It occurs through activation of the extrinsic pathway, which progresses more rapidly. Blood coagulation begins when the activity of coagulation factors in the common blood coagulation system declines. Furthermore, it is said that when the activity of endogenous and extrinsic coagulation factors increases, the bleeding time increases. Heparin, one of the conventional antithrombotic agents, has been problematic in that it has side effects such as thrombocytopenia and prolongation of bleeding time.

As an antithrombotic agent, it is superior in that it inhibits coagulation factors in the common blood coagulation system and does not inhibit coagulation factors in the endogenous or extrinsic systems, which prevents blood coagulation but does not prolong bleeding time. It can be said that it is an antithrombotic agent. Therefore, as shown in Example 3 below, the thrombin time, prothrombin time, and activated partial thromboplastin time were investigated in order to identify which step in the blood coagulation process the polypeptide of the present invention acts on. The thrombin time can identify common system abnormalities, the prothrombin time can identify abnormalities in extrinsic coagulation factors, and the partial thromboplastin time can identify abnormalities in endogenous coagulation factors.

As a result, a polypeptide in which the N-terminal valine of HVI-type hirudin was replaced with alanine, and the aspartic acid at the 5th residue at the N-terminus was replaced with glutamic acid, had higher selectivity for thrombin time than HVI-type hirudin. I discovered that. That is, it was found that while both have equivalent effects on thrombin time, the polypeptide of the present invention has a gentler effect on prothrombin time and activated partial thromboplastin than HvI hirudin.

From these facts, it is considered that the polypeptide of the present invention has blood coagulation activity equivalent to HVI type hirudin, but prolongs bleeding time to a lower degree than HVI type hirudin. From this, the polypeptide of the present invention is superior to HVI type hirudin in that it may prevent side effects such as prolongation of bleeding time that are often reported in treatment with conventional antithrombotic agents. it is conceivable that.

Furthermore, surprisingly, as shown in Example 4 below, in a congestive venous thrombosis model using rats, HVI
It was discovered that the polypeptide of the present invention, in which the N-terminal valine of HVI-type hirudin was replaced with alanine, and the aspartic acid at the fifth residue from the N-terminus was replaced with glutamic acid, had a higher antithrombotic effect than HVI-type hirudin. It was also found to be an antithrombotic agent with higher efficacy than type hirudin.

In the present invention, the amino acid sequence of a polypeptide that has thrombin inhibitory activity, has higher selectivity for thrombin time than HV1 hirudin, and has a high antithrombotic effect on a rat congestive venous thrombosis model is ^1a-V.
al-Tyr-Thr-Glu-Cys-Thr-Gl
u-3er-Gly-Gl n-Asn-Leu-Cy
s-Leu-Cys-Gl u-Gly-3er-^5
n-Val-Cys-Gly-Gln-Gly-Asn
-Lys-Cys-11e-Leu-G 1y-5er
-Asp-Gly-Glu-Lys -Asn-GI
n-Cys-Va 1-Thr-G 1y-Glu-G
1y-Thr-Pro-Lys-Pro-Gln-3
er-H1s-Asn-Asp-G 1y-Asp-P
be-G 1 u-G 1 u-11e-Pro-G
1u-Gl u-Tyr-Leu-Gln, and the DNA sequence encoding this polypeptide is 5' GC
CGTTTATACAGAGTGCACAGAATCC
GGACAAAAATTTATICTTTATGTGAA
GAATCTAATGTTTGTGGACAAGGGAA
ATAAATGTATTTTAGGATCTGATGG
AGAAAAAAATCAATGTGTTACAGGA
GAAGGAACACCGAAACCGCAATCTC
ATAATGATGGAGATTTTGAAGAAAT
TCCTGAAGAATATTTACA3'.

In addition, it has thrombin inhibitory activity as defined in the present invention, and H■1
The polypeptide precursor has higher selectivity for thrombin time than type hirudin and has a high antithrombotic effect on rat congestive venous thrombosis model. It refers to a type of polypeptide in which the polypeptide of the present invention having thrombin inhibitory activity is bound immediately after the terminal end.

That is, H
The amino acid sequence of the precursor of a polypeptide that has higher selectivity for thrombin time than type VI hirudin and has a high antithrombotic effect on a rat congestive venous thrombosis model is Net-Gly-Leu-G I y-L
ys-Lys-Leu-3er-5er-A Ia-
Va l-A 1a-A la -5er-Phe-N
et-5er-Leu-Thr-11e-5er-Le
u -Pro-G ly -Va l-G In-A
1a-Ala-Va 1-Tyr-Thr-G Iu-
Cys-Thr-Glu-5er-G Iy-G 1
n-Asn-Leu-Cys-Leu-Cys-Glu
-Gly-5er-Asn-Va 1-Cys-G 1
y-G In-G ly-Asn-Lys-Cys
-11e-Leu -Gly-5er-Asp-Gl
y-G Iu-Lys-Asn-Gl n-Cys-V
al -Thr-G Iy-G Iu-G 1y-Th
r-Pro-Lys-Pro-G ln-5et-H1
s-ASn-Asp-G 1y-Asp-Phe-G
l u-Glu-11e-Pro-Gl u-G 1u
-Tyr-Leu -G 1 n, and the DNA sequence encoding this polypeptide can be obtained by connecting codons corresponding to each amino acid residue base. usually,
Since multiple codons correspond to one amino acid, there are many DNA sequences that specify the above amino acid sequence6.
,TTTAGGTAAGAAATTGTCTAGTG
TGCTGCTGTAGCCGCTTCCTTTATG
AGTTTAACCATCAGTCTGCCGGGTG
TTCAGGCCGCC, TTTATACACAGT
GCACAGAATCCGGACAAAAATTTATG
TTTATCTGAA(, AATCTAATGTTTG
TGGACAAC, GAAATAAATGTATTTT
AGGATCTGATCGAGAAAAAAATCAA
TGTGTTACAGGAGAAGC;AACACCG
AAACCGCAATCTCATAATGATGGAG
ATTTTGAAGAAAATTCCTGAAGAATA
The DNA sequence of TTTACAA3' was used. this DNA
The sequence can be easily obtained by assembling chemically synthesized fragments.
The following points were kept in mind when selecting the NA sequence from among the many existing DNA sequences encoding the same amino acid sequence.

That is, in recent years, the DNA sequences of many genes have been clarified, making it possible to examine the frequency of codon usage in genes. As a result, it was found that there are differences in codon usage frequency between organisms. Therefore, when chemically synthesizing a DNA sequence for efficient expression, it is common practice to design the DNA sequence so that it contains a large number of optimal codons for the organism used as a host. In general, codons encoding one amino acid residue are not limited to one type, so in constructing the secretory plasmid of the present invention, DNA sequences encoding several types of polypeptides having thrombin inhibitory activity were considered. In the case of the present invention, a DNA sequence designed to contain a large number of optimal codons for Bacillus subtilis was used, especially considering that Bacillus subtilis would be used as a host for expression.

As described in Examples 1 and 2, the present inventors conducted an intensive search for a gene encoding a secretory protein that has the ability to secrete a large amount of hirudin, and found that the neutral protease gene of Bacillus amyloliquefaciens By selecting and further ligating a DNA fragment encoding a secretion signal, we succeeded in secreting HVI type hirudin.

In this case, as the vector DNA constituting the secretion plasmid, any vector DNA can be used as long as it can be replicated in bacteria of the genus Bacillus.Plasmid pUB1 derived from the genus Staphylococcus is commonly used.
10, pTP5, pC194, pDB9, pBD64,
Examples include pBc16, pE194, etc. and derivatives thereof. Bacillus subtilis containing the above plasmids can be purchased from the Ohio University Bacillus Stock Center (address: 484 West 12th Aven.
ue Columbus Ohi.

43210 USA) and will be distributed to everyone.

In particular, the vector DNA used in the present invention may be any DNA as long as it can be replicated in bacteria of the genus Bacillus; pUB110 from point
Good.

The secretory plasmid of the present invention, as described in the Examples,
A DNA fragment encoding a polypeptide having thrombin inhibitory activity in a heterologous protein expression secretion vector of a type capable of ligating a DNA fragment encoding a heterologous protein immediately after the promoter of the neutral protease gene, the ribosome binding site, and the region encoding the secretion signal. It is constructed by inserting and combining. As a result, the polypeptide encoded by the secretion plasmid is
The secretion plasmid of the present invention, which is a precursor type polypeptide having an amino acid sequence consisting of 27 amino acid residues added to the N-terminal upstream of a polypeptide having thrombin inhibitory activity having the amino acid sequence described in A DNA fragment containing the DNA sequence according to claim 8, which has been synthesized manually, and a vector DNA fragment which has been cleaved with an appropriate eye-opening enzyme and can be replicated in Bacillus bacteria are ligated using a conventional ligation technique. This makes it easier to implement. In this case, the two DNA fragments can be linked, for example, via common restriction enzyme sites and/or by using synthetic NA linkers and/or by blunt-end joining.

The above DNA fragment is linked with a DNA fragment encoding a polypeptide having thrombin inhibitory activity downstream of the promoter, ribosome binding site, and region encoding the secretion signal of the neutral protease gene of Bacillus amyloliquefaciens. A secretion plasmid constructed by ligating with the described vector DNA can be used to transform Bacillus subtilis to obtain a transformed strain.

As a method for transforming Bacillus subtilis, any method used in the art can be used. For example, it can be performed by the method of Chang et al. (Reference document 24). This method can be divided into three stages.

1. Process of producing Bacillus subtilis without a cell wall, that is, protoplast, by treating Bacillus subtilis in an isotonic solution with lysotium. 2. Vector D using a polyethylene glycol solution.
Step 3 of transforming protoplasts with NA, regenerating the cell wall of protoplasts in a regeneration medium and selecting the transformed Bacillus subtilis Using the obtained transformed strain, obtaining a polypeptide having thrombin inhibitory activity For example, in 21 Erlenmeyer flasks, 40
After inoculating the transformed strain into 0d LB medium (Reference 25), it was incubated at 37°C for about 20 hours, preferably with shaking, until the maximum yield of the polypeptide having thrombin inhibitory activity was secreted and produced. There is a way to cultivate it.

The transformed strain of the present invention is cultured in a liquid medium containing an assimilable carbon source, nitrogen source, and inorganic salt source. For example, an LB medium is a commonly used liquid medium.

Furthermore, the strain used here may be any Bacillus bacterium that can be transformed with the secreted plasmid of the present invention, but it should be noted that genetic, biochemical, molecular biological, and applied microbiological knowledge is sufficient. Bacillus subtilis is preferred because it accumulates in large quantities and is highly safe.

A polypeptide having thrombin inhibitory activity can be prepared from a culture solution by recovering and purifying the culture supernatant.The present inventors adjusted the pH of this culture supernatant to 3 with hydrochloric acid, and then Polypeptides with thrombin inhibitory activity remain in the supernatant fraction obtained by removing the proteinaceous precipitate produced by treatment at 70°C for 15 minutes by centrifugation, and their abundance ratio is 23% of the total protein. It has been found that the amount of contaminant proteins is extremely low. As a result, the polypeptide with thrombin inhibitory activity secreted into the culture medium
From this supernatant, it can be easily purified by cation exchange chromatography, anion exchange chromatography, and reverse phase chromatography.

The present inventors transformed Bacillus subtilis with the HVI type hirudin secretion plasmid shown in Comparative Example 1 and cultured it under the conditions shown in Comparative Example 2. It was found that a polypeptide having thrombin inhibitory activity equivalent to A660 was secreted and accumulated. Furthermore, the present inventors constructed Example 1 of the present invention by improving this HVI type hirudin secretion plasmid.
By culturing Bacillus subtilis transformed using the secretion plasmid shown in Example 2 under the conditions shown in Example 2, a polypeptide having thrombin inhibitory activity equivalent to 18■/ff1-A660 was obtained in Comparative Example 2. We found that secretion and accumulation are more efficient than in the case of In addition,
The absorbance (A660) of the culture solution indicating the growth rate of Bacillus subtilis at this time was IO in all cases. This unit (■/1・A660) is the culture supernatant (lff
The value obtained by dividing the amount of polypeptide having thrombin inhibitory activity (■) accumulated in i) by the absorbance (A660) indicating the growth rate of Bacillus subtilis in the culture solution is shown.

The pH of the culture supernatant (11) prepared in Example 2 was adjusted to 3 with hydrochloric acid.
After adjusting to It was found that it was possible to obtain a polypeptide having thrombin inhibitory activity of 70 μm from culture solution 11 after purification, and the present invention was completed.

In addition, the secretion plasmid of the present invention can be used immediately after the 3' end of the secretion signal region of the neutral protease gene.
DN of modified hirudin in which the N-terminal valine was replaced with alanine and the 5th residue glutamic acid was replaced with aspartic acid.
It has a type of DNAfil region in which the 5' end of the A fragment is directly linked, and the amino acid present at the C-terminus of the neutral protease secretion signal is detected in the cells or cell membranes of the transformed strain obtained by transformation with this plasmid. Immediately after this, it is thought that a precursor of a polypeptide in which the amino acid present at the N-terminus of a polypeptide having thrombin inhibitory activity is bound is synthesized.

It is generally known that secretion signals are removed during the secretion process. However, simply joining a DNA fragment encoding a heterologous protein immediately after the promoter, ribosome binding site, and region encoding a secretion signal of a gene encoding a secreted protein does not
5chain et al. (Ref. 15) reported. Furthermore, their report does not teach any method for efficiently secreting a heterologous protein. The present invention also provides a precursor in which the N-terminus of a polypeptide having thrombin inhibitory activity is substituted with the amino acid sequence of the N-terminal region of HVl type hirudin immediately after the amino acid present at the C-terminus of the neutral protease secretion signal. It was unclear whether modified hirudin, in which the secretion signal has been removed, is secreted from the protein. Moreover, as already mentioned, the amino acid sequence of the N-terminal region of hirudin (position 5 from l) is
Since it plays an important role in maintaining the structure of the sequence related to the expression of thrombin inhibitory activity, even if a polypeptide constructed by substituting amino acids in this N-terminal region is secreted efficiently, the thrombin inhibitory activity will decrease. It was imagined that there would be a high possibility that this would happen.

The present inventors surprisingly found that in the case of the present invention, as a result of substituting amino acids in the N-terminal region of Vl-type hirudin,
As shown in the Examples of the present invention, a polypeptide having the same level of thrombin inhibitory activity as HV1 type hirudin was produced by transformed Bacillus subtilis, and also
It was found that the secretion was more efficient than that of type VI hirudin. Furthermore, it was found that the polypeptide has better selectivity for thrombin time than HVI type hirudin and has a high antithrombotic effect in a congestive venous thrombosis model.

[Effect]

As shown as one aspect of the present invention, a secretion plasmid was constructed using the promoter, ribosome binding site, and secretion signal region of the neutral protease gene of Bacillus amyloliquefaciens, and was obtained by introducing it into Bacillus subtilis. By culturing the transformed strain, it was found that it has the same level of thrombin inhibitory activity as leech-derived HVI type hirudin, has better selectivity for thrombin time than H1 type hirudin, and is highly effective in a congestive venous thrombosis model. It has become possible to secrete a polypeptide with antithrombotic effects into the culture supernatant with high efficiency. In other words, it is efficient in a system using Bacillus subtilis as a host (
A secreted polypeptide with thrombin inhibitory activity has been discovered, and a method for producing a polypeptide with thrombin inhibitory activity has been established, which allows the polypeptide to be recovered and purified from the culture supernatant using a simple method! [Example] The present invention will be explained below using a specific example.

This example is not intended to be limiting in any way.

Production Example 1 (Construction of heterologous protein expression secretion vector pNPA225) A DNA fragment encoding a heterologous protein is inserted and ligated immediately after the promoter, ribosome binding site, and region encoding the secretion signal of the neutral protease gene of Bacillus amyloliquefaciens. A heterologous protein expression secretion vector pNPA225, which can be used to express and secrete a heterologous protein, was constructed according to the method shown in FIG.

Plasmid pNPA84 is a neutral protease gene promoter, ribosome binding site, secretion signal, and has a DNA fragment encoding mature α-amylase protein linked downstream of the region encoding the upstream region of propeptide. It is a plasmid. The mature α-amylase gene refers to a DNA fragment that encodes a protein with α-amylase activity starting from naturally occurring leucine.
Transformant strain MT-8400 (FERM
BP-923), pNPA84 was prepared using the method of Tabak et al. (Reference 26). This pNP
A84 DNA was digested with restriction enzymes Hpall (manufactured by Takara Shuzo) and restriction enzymes BamH summer (manufactured by Takara Shuzo).
An 8 Kb DNA fragment (hereinafter referred to as DNA fragment A) was purified by electrophoresis using agarose gel. This D
NA fragment A lacks the promoter, ribosome binding site, and C-terminal region of the neutral protease gene (including the region encoding the secretion signal).On the other hand, the restriction enzyme 5t is inserted immediately after the secretion signal region of the neutral protease gene.
To create the ul cleavage site, 15mer and 18m
Two types of synthetic oligonucleotides (5' CG
GTCTTCAGGCCTC, 3', 5' GATC
CAGC, CCTGAACACC3') was synthesized by a modified triester method (Reference 27). 1βg each of two types of synthetic oligonucleotides were added to T4 polynucleotide kinase (manufactured by Takara Shuzo) and dATP (manufactured by Pharmacia).
(Reference 28), and then the two synthetic oligonucleotides were annealed by mixing these reaction products and heating in boiling water for 3 minutes followed by slow cooling. After that, DNA fragment A (0.5 μg
) and a synthetic oligonucleotide (ltlg) annealed with
were ligated using T4 ligase (manufactured by Takara Shuzo) to obtain hybrid plasmid pNPA225.

Comparative Example 1 (Construction of HVI type hirudin secretion plasmid pNPH208) Plasmid pNPH208 was constructed according to the method shown in FIG.

First, two types of oligonucleotides (5'
CCGTTGTTTATACATAGATTGCACAG
AATCCC; GATG3', 5' GATCCATC
CGGATTCTCTGTAATCTGTATAAAC
AACGG3') was synthesized according to a conventional method.

Next, each lμg of the obtained synthetic oligonucleotide was phosphorylated and then annealed. pNPA225 DNA (0
, 5 μg) using T4 ligase (manufactured by Takara Shuzo), and the DNA encoding HVI type hirudin was added immediately after the region encoding the secretion signal of the neutral protease gene.
N-terminal region of the fragment (lO from the N-terminus of HVI type hirudin)
A vibuturido plasmid pNPA225ΔH was obtained in which the amino acid residues (corresponding to the order of the order Phizoe) were bound.

Using plasmid p4014, which was constructed from vector PBR322 DNA and synthetic RNA, which was chemically synthesized by selecting a coton corresponding to the amino acid sequence of HVI type hirudin from the codons frequently used in Bacillus subtilis, that is, the optimal codon (Reference 29). Transformed strain (FERM
P-9924) has already been deposited. ) (The DNA fragment encoding Vl-type hirudin was obtained from this transformant strain P4.
It was obtained from 014 as follows. First, a DNA fragment containing HVI type hirudin was prepared by cleaving p4014 with restriction enzymes EcoRI and BamHI. Bibutulido plasmid p3009 was constructed by inserting and ligating this DNA fragment into the restriction enzyme EcoRI and restriction enzyme Ba+n1 (I) cleavage site of plasmid pUc13 (Fig. 3). By decomposition, a DNA fragment (DNA fragment B) containing the DNA region encoding the amino acid sequence from the 11th position to the C-terminus of Type IV hirudin was prepared and purified by agarose gel electrophoresis. This DNA fragment (1 μg) and pNPA22
About 6.5ΔH was digested with restriction enzymes Accll and Hindll. OKb DNA fragment (DN
A fragment C) (1 μg) was ligated using T4 ligase,
HVI type hirudin secretion plasmid pNPH20B was constructed. This pNPH208 contains the promoter of the Bacillus amyloliquefaciens neutral protease gene,
This is a hybrid plasmid containing a DNA sequence in which a DNA fragment encoding mature HVI type hirudin is bound immediately after the region encoding the ribosome binding site and secretion signal.

Comparative Example 2 (Secretory production of HVI type hirudin using HVI type hirudin secretion plasmid) Using the plasmid pNPH208 constructed in Comparative Example 1, Bacillus subtilis strain MT-430 (FERM
BP-1079) using the method of Chang et al. (Reference 24
). Obtained transformed strain MT-20
8 (FREM P-10028) was cultured with shaking at 37° C. for 20 hours using a double concentration LB medium. The thrombin inhibitory activity in the obtained culture supernatant was measured. Thrombin inhibitory activity was determined by measuring the degree of inhibition of the ice-melting activity of the synthetic substrate H-D-phenylanyl-L-pipecoly-L-arginyl-p-nitroanilide against thrombin (Reference 30), i.e., 50 μl of thrombin (
Wr solution (20 IU/d) and buffer solution (50 m
50 μl of M Tris-HCI, pH 8,0) was mixed in a neutral to acidic state and pre-quenched for 2 minutes at room temperature. - Substrate final concentration added to the (manufactured by Kagaku Yakuhin Co., Ltd.) solution.

After the start of the reaction, the release of p-nitroanilide was measured at a wavelength of 405 nm, and the increase in absorption per unit time was defined as a.Next, the sample solution was added instead of the buffer solution, and the same operation was performed. The thrombin inhibitory activity of the culture supernatant was measured by measuring the increase in absorption at a wavelength of 405 nm and calculating (a-b)/a, where the value was taken as b.

Thrombin inhibitory activity IUnit is thrombin INIH
Defined as something that neutralizes a Unit.

In the culture supernatant after culturing at 37°C for 20 hours using double concentration LB medium, accumulation of HVI type hirudin having a thrombin inhibitory activity of 80 to 100 μ per medium 11 was observed. The absorbance (A660) of the culture solution at this time, which indicates the growth rate of Bacillus subtilis, was 10.

In addition, the results of 5DS-PAGE analysis of the precipitate obtained by adding trichloroacetic acid to the culture supernatant revealed that a large amount of protein was present, which was the same size as the hirudin preparation obtained by purifying HVI type hirudin purchased from Sigma. It was shown that it accumulated in the culture supernatant. Furthermore, analysis of this protein using a gel scanner densitometer revealed that the amount of HVI type hirudin present in the culture supernatant of the MT-208 strain was as high as 5%. In the superfluid fraction obtained by removing the proteinaceous precipitate produced by heat treatment by centrifugation, thrombin inhibitory activity remains, and the abundance ratio of Hvl-type hirudin to the total protein is 20%, which increases the amount of contaminant protein. It was found that there were very few. HVI type hirudin was purified from this supernatant by DEAE-Sepharose column chromatography and CM-Sepharose column chromatography. That is, the supernatant fraction obtained by heat-treating the culture supernatant was added to a DEAE-Sepharose column washed with 20mM) Lis-HCl buffer (pH 8,0), and then a concentration gradient of 0 to 0.5M NaCl was applied. It was eluted by The obtained percentage with thrombin inhibitory activity was collected and added to 20mM sodium acetate-hydrochloride buffer (
After dialysis against 20 mM sodium acetate-hydrochloric acid buffer (pH 3,0), it was applied to a CM-Sepharose column that had been washed with 20 mM sodium acetate-hydrochloride buffer (pH 3,0). Elution is from 0 to 0.2M
The concentration gradient of NaCl was used. The eluted fractions with thrombin inhibitory activity were collected and packed with 5ynchropack R.
Reversed phase column chromatography was performed using a P8 (manufactured by SynChrom, Inc.) column, and a fraction with thrombin inhibitory activity and a small amount of a fraction without thrombin inhibitory activity were collected. Polypeptides contained in those fractions were analyzed using 5DS-PA.
As a result of analysis by GE, it was 1 hand in terms of 5DS-PAGE, and moreover, it was an HV derived from Hill purchased from Sigma.
It was found that it had the same molecular weight as the HVI type hirudin preparation obtained by purifying type I hirudin. Therefore, when we determined the N-terminal amino acid sequences of these proteins (Reference 31), we found that both Val-V
It was found to be l-Tyr-Thr-Asp, which matched the N-terminal amino acid sequence of HVI type hirudin derived from leech.

Based on these results, the secretion signal portion of a polypeptide having the same molecular weight as HVI type hirudin, which is secreted and produced by Bacillus subtilis transformed with the HVI type hirudin secretion plasmid, can be accurately removed regardless of the presence or absence of thrombin inhibitory activity. It was found that it was secreted by

Furthermore, as a result of thrombin inhibition experiments, the protein having thrombin inhibitory activity has a stoichiometric ratio of 1:1 with thrombin.
It was revealed that the polypeptide with thrombin inhibitory activity secreted and produced by Bacillus subtilis transformed with the HVl-type hirudin secretion plasmid reacts with HVI derived from leech in terms of thrombin inhibitory activity. This indicates that it has the same activity as type hirudin. On the other hand, in an inactive polypeptide that does not have thrombin inhibitory activity despite having the same structure as HV1-type hirudin, the S-5 bond, which is important for the expression of thrombin inhibitory activity, is accurately cross-linked. It is thought that there are some polypeptides that have not been used.

Example 1 (Construction of secretory plasmid pNPH141) Plasmid p
NPH141 was constructed according to the method shown in FIG.

First, valine at the N-terminus of HVI type hirudin and aspartic acid at the 5th residue from the N-terminus were replaced with alanine and glutamic acid, respectively.
In order to construct a DNA fragment containing a DNA region encoding amino acids up to residue 0, two types of oligonucleotides (5' CCC, CCGTTTATACAGACTC
;CACAGAATCCGGATG3', 5' GAT
CCATCCGGATTCTGTGCACTCTGTA
TAAACGGCGG3'') was synthesized according to a conventional method.
Next, 1 μg of each of the obtained synthetic oligonucleotides was phosphorylated and then annealed. This, pNPA225 DNA was cut with restriction enzyme 5tul and restriction enzyme BamHI.
(0.5Mg) using T4 ligase (manufactured by Takara Shuzo), and immediately after the region encoding the secretion signal of the neutral protease gene, valine at the N-terminus of HVI type hirudin, and the valine at the 5th residue from the N-terminus. A hybrid plasmid pNPH225 was obtained in which the N-terminal regions of DNA fragments encoding polypeptides in which aspartic acid was replaced with alanine and glutamic acid, respectively, were linked.

A DNA fragment encoding HVI type hirudin.

It was prepared from transformed strain P4014 according to the method shown in Comparative Example 1. That is, p4014 was converted to restriction enzyme EcoR.
A DNA fragment containing hirudin was prepared by digestion with I and the restriction enzyme BamHI. This DNA fragment was digested with restriction enzyme EcoRI and restriction enzyme B of plasmid pUc13.
The vibsolido plasmid p3009 was constructed with an insert ligated into the amHI cleavage site. This p3009 DNA (2
μg) with restriction enzymes AccIII and HindIII to prepare a DNA fragment (DNA fragment B) containing the DNAtIA region encoding the amino acid sequence from the 11th position to the C-terminus of HVI type hirudin.Purified by agarose gel electrophoresis. did. This DNA fragment (1 μg
) and pNPH225 with restriction enzymes AccIII and Hin
As a result of decomposition with dIII, approximately 6. OKb's DN
Fragment A (DNA fragment C) (1 μg) was ligated using T4 ligase to construct the secretion plasmid pNPH141 of the present invention. This pNPHl 41 has an N-terminal valine and an alanine aspartate immediately after the region encoding the promoter, ribosome binding site and secretion signal of the neutral protease gene of Bacillus amyloliquefaciens.

This is a hybrid plasmid containing a DNA sequence bound to a DNA fragment encoding a polypeptide substituted with glutamic acid and glutamic acid.

Example 2 (Secretory production of a polypeptide having thrombin inhibitory activity using a secretory plasmid) Using the plasmid pNPH208 constructed in Example 1, Bacillus subtilis strain MT-430 (FERM
BP-1079) using the method of Chang et al. (Reference 24
). Obtained transformed strain MT-14
1 (FREM BP-2403) was cultured with shaking at 37° C. for 20 hours using a double concentration LB medium. The thrombin inhibitory activity in the obtained culture supernatant was measured according to a conventional method.

In the culture supernatant after culturing at 37° C. for 20 hours using double concentration LB medium, accumulation of polypeptides having thrombin inhibitory activity of 180 to 200 μ/N of medium was observed. This indicates that polypeptides in which the N-terminal valine and the fifth aspartic acid residue from the N-terminus of HVI type hirudin were replaced with alanine and glutamic acid, respectively, were secreted more efficiently than HVI type hirudin.
It is thought that The absorbance (A660) of the culture solution at this time, which indicates the growth rate of Bacillus subtilis, was 10.

In addition, the results of 5DS-PAGE analysis of the precipitate obtained by adding trichloroacetic acid to the culture supernatant showed that a protein of the same size as the HVI type hirudin preparation obtained by purifying HVI type hirudin purchased from Sigma was found. This protein was shown to accumulate in large amounts in the culture supernatant, and as a result of analysis using a gel scanner densitometer, this protein was found to be one of the polypeptides with thrombin inhibitory activity in the culture supernatant of strain MT-141. The abundance was as high as 7%, and this supernatant was incubated at 70°C for 1
The thrombin inhibitory activity remained in the supernatant fraction obtained by removing the proteinaceous precipitate produced by heat treatment for 5 minutes by centrifugation.
Furthermore, it was found that the abundance ratio of polypeptides having thrombin inhibitory activity to the total protein was 23%, and the amount of contaminating proteins was extremely low.

A polypeptide having thrombin inhibitory activity was purified from this supernatant by the method performed in Comparative Example 2. In this case, unlike the case of secretory production of HVI type hirudin shown in Comparative Example 2, secretion and accumulation of inactive hirudin was not observed. The obtained polypeptide having thrombin inhibitory activity showed one band on 5DS-PAGE, and was the same size as the HVI type hirudin preparation obtained by purifying leech-derived HVI type hirudin purchased from Sigma. It was found that it has a molecular weight. When the N-terminal amino acid sequence of the obtained purified polypeptide was determined, it was found to be Ala-Val-Tyr-Thr-Glu.

From these results, it was revealed that the secretory signal portion of the polypeptide secreted and produced by Bacillus subtilis transformed with the secretion plasmid of the present invention is secreted with the secretion signal portion accurately removed.

Further, as a result of a thrombin inhibition experiment, it was revealed that this purified Hvl type hirudin reacts with thrombin stoichiometrically at l:1.34.

These facts also indicate that the polypeptide secreted and produced by Bacillus subtilis transformed with the secretion plasmid of the present invention has the same activity as fVl type hirudin (derived from leech) in terms of thrombin inhibitory activity. This shows that.

Example 3 (Effects of the polypeptide of the present invention and HVI type hirudin on blood coagulation) The anticoagulant effects of the polypeptide of the present invention produced in Example 2 and HVI type hirudin produced in Comparative Example 2 are compared. For this purpose, these drugs were added to plasma and the thrombin time (TT), prothrombin time (PT), and activated partial thromboplastin time (APTT) were measured.

Blood collection and plasma preparation were performed as follows. That is,
The rabbit was fixed in the dorsal position, a polyethylene tubule was inserted into the carotid artery, and blood was collected from the other end into two 45-d tubes each containing 511 ft of 3.8% sodium citrate. Blood collected from two rabbits was centrifuged at 4°C with a Hitachi centrifuge 1185PR-22 at 118°C.
Centrifugation was performed at 00X for 15 minutes, and only the plasma was transferred to another plastic test tube. Pool the plasma and prepare plasma for investigational drug,
Alternatively, it was used as a control plasma sample.

First, a plasma sample was prepared.

The polypeptide of the present invention and HVI type hirudin were each dissolved in physiological saline to prepare a 6.26 μ/d (0.9 mM) solution, which was used as a test drug solution. Plasma for investigational drug preparation 0.4
Add 0.1 d of the test drug solution to 9 d, and add 9
This was used as a plasma sample containing 10-'M. Furthermore, this plasma sample was diluted with plasma for preparing the test drug to prepare a plasma sample with an arbitrary concentration.

Prothrombin time (PT) was measured as follows.

PT is an automatic blood coagulation measuring device (Amelung KC-10)
Measured using 0.1 d of plasma specimen was transferred to a sample cup and heated at 37° C. for 1 minute. The reaction was started by adding 0.2 d of the test drug for PT measurement (Brain Thromboplastin, manufactured by Oats, prepared by adding 5.0 ml of purified water per vial) that had been warmed to 37°C, and solidification was started. The time was measured. If the plasma sample did not clot for more than 200 seconds, the result was taken as 200 seconds.

Activated partial thromboplastin time (APTT) was measured as follows. APTT was also measured using an automatic blood coagulation measuring device. Plasma sample 0. Transfer the lid to the sample cup and
Warm at 7°C for 10 minutes. APTT reagent (activated thromboplastin made by Oats) kept at 37°C was added to a 0.1 d cup, and after another 240 seconds, 0.02 M
The reaction was started by adding CaC1z and the coagulation time was measured. If the plasma sample did not clot for more than 300 seconds, the result was taken as 300 seconds.

Measurement of thrombin time (TT) was performed as follows.

TT was similarly measured using an automatic blood coagulation measuring device.

0.1 ml of plasma sample was transferred to a sample cup and heated at 37°C for 5 minutes. 2U/d heated to 37°C)
The reaction was started by adding 0.2 d of Rhombin (Kaido Pharmaceutical ■), and the coagulation time was measured. If the plasma sample did not clot even after 150 seconds, the result was taken as 150 seconds.

First, the polypeptide of the present invention and P of HVI type hirudin
The effect on T was investigated.

The polypeptide of the present invention and HVI type hirudin at 0.06
Table 1 shows the PT of plasma added with μm to 3 μm (final concentration). The PT of the control plasma sample was 5.8 seconds.

The polypeptide-added plasma sample of the present invention showed a significant prolongation of the clotting time at 0.06 μm or more compared to the control plasma sample. On the other hand, HVI type hirudin showed a significant prolongation of the coagulation time compared to the control plasma sample at 0°07 μm or more.

0.3μ of the polypeptide of the present invention and HVI type hirudin
2. A significant extension was observed. 3
All of the plasma samples to which the polypeptide of the present invention of 1 μm or more was added and the plasma samples to which HVI type hirudin of 1 μm or more was added did not coagulate even after 150 seconds.

Next, the polypeptide of the present invention and HVI type hirudin A
The effect on PTT was investigated.

The polypeptide of the present invention and HVI type hirudin at 0.00
Table 2 shows the APTT of plasma to which 1 μm to 3 μm (final concentration) was added.

The APTT of the control plasma sample was 35.5 seconds.

The polypeptide of the present invention significantly AP from o,ootμm
TT was gradually prolonged. APTT was significantly prolonged from 1 μm or more, and plasma samples spiked with 21 Im or more did not coagulate even after 300 seconds. On the other hand, a similar prolonging effect was observed in HVI type hirudin-containing plasma samples, with 0.0
The coagulation time was significantly prolonged when the diameter was 3 μm or more. Also, Iu
All of the plasma samples to which more than m was added did not coagulate even after more than 300 seconds.

Finally, the effects of the polypeptide of the present invention and HVI type hirudin on thrombin time (TT) were investigated.

The polypeptide of the present invention and HVI type hirudin at 0.00
Table 3 shows the TT of plasma to which 1 μm to 0.06 μm (final concentration) was added.

The TT of the control plasma sample was 14.6 seconds.

The polypeptide of the present invention has a diameter of 0.003 μm or more and a Hv
Type l hirudin significantly prolonged TT at 0.01 μm or more. 0 of the polypeptide of the present invention and HVr type hirudin
．． Spiked plasma samples of 0.04 μm or larger did not clot even after 150 seconds. These facts indicate that the polypeptide of the present invention, that is, the polypeptide in which the N-terminal valine of HVI-type hirudin is replaced with alanine and the asparagine at the fifth residue from the N-terminus with glutamic acid, has a better response to thrombin time than HVI-type hirudin. It was found that the selectivity was increased.

Table 1 The results of the influence of the polypeptide of the present invention and HVI type hirudin on prothrombin time (PT) are shown as the standard deviation above the mean value (number of samples: 4).

b) Contains samples that did not clot for more than two seconds.

* : P < 0.05 ** : P < 0.01 Kimoto * : P < 0.001 Table 2 Effects of the polypeptide of the present invention and HV1 type hirudin on activated partial thromboplastin time (APTT) It is shown as the standard deviation (number of samples: 4).

a) Results 41 Average value Soil standard deviation (Sampuno L@2o).

b) If all plasma samples did not coagulate for more than 3 seconds, the result was set as 30.

c) Contains samples that did not solidify beyond one 30Ω.

Zero: P< 0.05 m: 'P<
0.01 Car**: p<0.001 Table 3 Effects of the polypeptide of the present invention and HVI type hirudin on thrombin time (TT): 0 (Contr.l)=! 14.6:0.78", o, oot 1 15.4 go, 13 1
4.7±0.55! ':23.0=0.92""
27.4'-0,47°"[,0,02 Results are shown as average value:!N deviation (number of samples: 4).

a) The results are shown as average value: standard deviation (number of samples: 12). b) If all plasma samples did not coagulate even after exceeding 30 ml, the result was set as 3001 ml.

Book: P<0.05 **: P<0.01 Jinning: P<0.001 Example 4 (Effects of the polypeptide of the present invention and HVI type hirudin on congestive venous thrombosis model) In Example 2 The polypeptide of the present invention produced and H produced in Comparative Example 2
To compare the effects of type VI hirudin, these drugs were tested in a rat congestive venous thrombosis model (Wesslen
S, et al., J, ^pp1. Phys, , 14.943
(1959) ), and the degree of thrombus formation was determined.

The polypeptide of the present invention and HVI type hirudin were each dissolved in physiological saline to prepare a solution and used as a test drug solution. Male Uister rats with a zero body weight of 260 to 290 g were used in the experiment. The experiment was conducted as follows with 8 animals as one group.

First, experimental animals were treated with 25% ethyl urethane (ethyl-
urethan) solution (4d/kg intravaginally,
(2d/kg subcutaneously injected). Next, the jugular vein was dissected from the surrounding tissues, a Cannier tube was inserted into the femoral vein, and the test drug and physiological saline as a control were continuously injected intravenously for 30 minutes using a pump. 30 minutes after the start of continuous intravenous injection of the study drug, activated human serum (1
, 32 d/kg) was injected within 30 seconds through the femoral vein. Two minutes after the start of this injection, a portion of the jugular vein was ligated for 10 minutes, the ligated site was removed, and the degree of thrombus formation was determined by a score.

Thrombus scores were determined as follows.

0: No thrombus 1: Microthrombi 2: Large thrombus, blood vessel not occluded 3: Large blood clot, blood vessel completely occluded The experimental results are shown below.

The polypeptide of the present invention, HVI type hirudin, at 0.003
Table 4 shows the degree of thrombus formation in a rat congestive venous thrombosis model in which 20.3 μg/kg was administered intravenously for 30 minutes.

The control saline thrombus formation score (total) was 31.

The polypeptide of the present invention was found to significantly prevent thrombus formation when administered at doses of 0.01■/kg or more compared to control physiological saline, whereas HVI type hirudin was found to be effective at doses of 0.3■/kg or more. Only effective prevention of thrombus formation was observed. 0.
1■/kg or more of the polypeptide of the present invention, 0.3■/k
When HVI type hirudin was injected in an amount of 1 g or more, almost complete prevention of thrombus formation was observed.

From this, the polypeptide of the present invention, namely HVI
A polypeptide in which the N-terminal valine of type hirudin is replaced with alanine and the fifth residue from the N-terminus, aspartic acid, is replaced with glutamic acid has a lower intravenous dose (0.1■/kg) than HVI type hirudin. We found that thrombus formation in a rat congestive venous thrombosis model could be almost completely prevented. That is, the polypeptide of the present invention, that is, the polypeptide in which the N-terminal valine of HVI-type hirudin is replaced with alanine and the 5th residue from the N-terminus, aspartic acid, is replaced with glutamic acid, has a higher anti-inflammatory effect than HVI-type hirudin. It was discovered that it has the potential to be a thrombotic agent.

Percentage of thrombus formation score (review of literature): Rosenberg, R.D.; Ses+i
n, Hematol, 14427-440 (197τ
) 2 Markwardt, F.;”Methods
in Enzymol,” 19+924-932.
(19τ0) 3 wardt, F, et al, +;Th
romb, l'laemostasis (Stuff
gart), 52.160-163 (1984) 4
Badgy, D. et al., “Methods in Enzymol,” 45.6
69-678 (1976) 5 Kenji Nagako; Gendai Kagaku, extra edition 10゜ (Tokyo Kagaku Doujin), p 189-196 (1987) 6 Patent application 1987-501609 τ Dodt, J, et al,; FEBS
Lett, 202(2)8 Gainai Doujin et al.; Japan Clinical 59B-103 (1988)! ) Meyhac
k et ai, ; THROMBO3IS RES
EARCH■10 Grossenbacher e
tal,,HTHOROMBO5TS RE-3ER
CH■34 (1987) 11 Pa1va I et al,; Pro
c, Natl, Acad, Sci, USA79.558
2-5586 (1982) 12 Vasantha
N, et al. +; J, Bacteriol
-16513 Lin-Fa Wang et al.
; Gene, 69.39-47 (1988) 14
Pa1va, 1. et al, +; Gene
+ 22,229-235°15 5chain,
C, H, et al, HBTO/TECHNOLOGY
.

4.719 (1986) 16 Sukumaran et al, HBIO
TECIINOLOGY 617 Rosenber
g, M, et al; Ann, Rev, Gen
et-.

13.319. (1979) 18 Moran Jr, +C,P, et al
+Mo1. Gen, Genemt, +186.339
-346. (1986) 19 Goldfarb D
,S,et al,;Nature 293,3
0920 Blobel, G, st al,, HCe
1l Biol, 6783521 Kyoji Yamaguchi et al.: Modern Chemistry, Special Issue 1022 Mao SJT,...
; Biochemistry 27. 81τ0
-817323 Loison G, et al.
;BIOTECHNOLOGY 624 Chang
, S. et al.; Mo1. Gen, Gen
et,, 168+25 Maniatis, T et
al, :'Mo1ecular Cloning'.

p440. Co1d Spring)Iarbor
Laboratory26 Tabak H,F,e
tal; Nucleic Ac1ds R
es, 52321-2321 (197B) 27 Crea, R, et al, ; Proc, N
ATL, Acad, Sci, USA? 5,5765 (1
978) 28 Goeddel, D. V. et al.
:Proc, Natl, 5cad.

Sci, USA, 76.106-110.1979
29 0gasawara, N, ;Gene, 40,1
45-150 (1985) 30 Chang, J.;
FEBS Lett, 164. 307-313゜31
Hewick R, M, et al, ;J;
Biol, Chem, 256°

[Brief explanation of the drawing]

Figure 1 shows the heterologous protein expression secretion vector pNPA225.
FIG. Figure 2 shows HVI type hirudin secretion plasmid PNPH2.
08 is a diagram showing a construction method. FIG. 3 shows a method for constructing hybrid plasmid p3009 containing a DNA base sequence encoding hirudin. FIG. 4 is a diagram showing the construction method of hirudin secretion plasmid pNPH141. 2 In Figures 1, 2, 3, and 4, Pm represents the promoter g region of the neutral protease gene, SD represents the ribosome binding site of the neutral protease gene, and p
re is the region encoding the secretion signal of the neutral protease gene, Δpro is the upstream region of the propeptide of the neutral protease gene, α-amy 1 a se
H
is the DNA sequence encoding hirudin, ΔH' is the upstream region of the DNA sequence encoding modified hirudin, ΔH is the upstream region of the DNA sequence encoding HVI type hirudin, and Δprotease is the latter half of the neutral protease. shows. Furthermore, in FIGS. 1, 3, and 4, A represents adenine, C represents cytosine, G represents thymine, and G represents guanine. Patent applicant Mitsui Toatsu Chemical Co., Ltd. 16'. -r+-)U

Claims (13)

[Claims] (1) A precursor of a polypeptide having thrombin inhibitory activity, which has an amino acid sequence as shown below. [There is a gene sequence] (2) A polypeptide having thrombin inhibitory activity, which has an amino acid sequence as shown below. [There is a gene sequence] (3) A DNA sequence encoding a precursor of the polypeptide having thrombin inhibitory activity according to claim 1. (4) The arrangement according to claim 3, which is the following arrangement. [There is a gene sequence] [There is a gene sequence] (5) A DNA sequence encoding the polypeptide having thrombin inhibitory activity according to claim 2. (6) The arrangement according to claim 5, which is the following arrangement. [There is a gene sequence] (7) A DNA sequence in which a DNA fragment encoding a precursor of a polypeptide with thrombin inhibitory activity is linked downstream of the promoter of the neutral protease gene of Bacillus amyloliquefaciens and the region encoding the ribosome binding site. , a secretory plasmid characterized in that it is linked to vector DNA. (8) Claim 7 characterized by the following:
A secretory plasmid characterized in that the DNA sequence described in 1. is linked to vector DNA. [There is a gene sequence] (9) Claim 7 or 8, wherein the vector DNA is a plasmid capable of replicating in Bacillus bacteria.
Secretion plasmid as described in. (10) A secretory plasmid, characterized in that the plasmid capable of replicating in a Bacillus bacterium according to claim 9 is pUB110. (11) A transformed strain transformed with one secretion plasmid arbitrarily selected from the secretion plasmids described in claims 7 to 10. (12) The transformed strain according to claim 11, wherein the microorganism to be transformed is Bacillus subtilis. (13) A method for producing a polypeptide having thrombin inhibitory activity, which comprises culturing the transformed strain according to claim 12 and recovering the polypeptide having thrombin inhibitory activity from the culture supernatant.