CN101922047B - Gap promoter library and application thereof - Google Patents
Gap promoter library and application thereof Download PDFInfo
- Publication number
- CN101922047B CN101922047B CN2009100531989A CN200910053198A CN101922047B CN 101922047 B CN101922047 B CN 101922047B CN 2009100531989 A CN2009100531989 A CN 2009100531989A CN 200910053198 A CN200910053198 A CN 200910053198A CN 101922047 B CN101922047 B CN 101922047B
- Authority
- CN
- China
- Prior art keywords
- seq
- promotor
- gene
- gap
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a GAP promoter library and application thereof. The invention discloses a nucleic acid sequence of each promoter in the GAP promoter library, a vector and a host cell which contain the nucleic acid sequence. The invention also discloses a method for screening a required mutation promoter. The invention establishes an effective screening model, obtains the mutation GAP promoter library with strength of graded distribution, and can realize continuous fine adjustment on expression of a target gene.
Description
Technical field
The invention belongs to biological technical field; More specifically, the present invention relates to be used for the GAP promoter library of pichia spp.
Background technology
The metabolic engineering (Metabolic Engineering) of optimizing the cellular metabolism network through genetic manipulation is becoming a very important forward position of biological chemical field research direction.But, in the face of in the microorganism cells by gene, albumen, metabolite, various signaling molecule and the complex dynamic network that interacts and forms between them, the analysis of metabolic process and regulation and control are complicacy and difficult very.Have only through genetic expression being carried out accurate fine setting and study the influence of its pair cell phenotype and metabolism stream, could therefrom parse the crucial metabolism node of supply transforming.Therefore, accurate " amount of opening " formula gene fine setting is to carry out metabolic engineering to study very important advanced means, and it is conducted a research has important scientific meaning application space widely.
Promotor (Promoter) is the most frequently used element of gene expression regulation.But, no matter be composing type (Constitutive), or induction type (Inducible) promotor, all can't in the scope of a broad, carry out the successive regulation and control to genetic expression intensity.Although inducible promoter can pass through induction time and the expression of regulatory gene to a certain extent of inductor concentration; But the essence of this adjusting is " switch " control still; Length and the height of non-transcribed intensity of the time of transcribing are promptly regulated in the beginning of can only regulatory gene transcribing and stopping.And the inductor concentration effect often just increases cell count but not the expression level of each individual cells of genetic expression in the colony, the homogeneity that does not embody.In addition, consider from the angle of practical application in industry that because the price of inductor is generally more expensive, and cell has high susceptibility to inductor, its operability is not strong.Just because of these defectives, in the last few years software engineering researchers invent promoter library (Promoter Library) in order to as to the more flexible and accurate regulation and control instrument of genetic expression.
Promoter library is exactly that the promotor base sequence of regulating and control genetic transcription is suddenlyd change; Through reporter gene (Reporter Gene; Like green fluorescent protein GFP gene, galactosidase gene LacZ etc.) expression level, the manual activation subclass of a series of varying strengths of obtaining of screening is fit.Because the base sequence of promotor directly influences the intensity that its regulatory gene is transcribed; So as long as constructed library comprises enough abundant mutant nucleotide sequence; The screening amount is enough big; Just can therefrom filter out a series of sudden change promotors with different regulation and control intensity, formation can be implemented the library that " amount of opening " declines and transfer to its downstream gene.
Promoter library promptly is applied to the research of metabolic engineering after occurring, and has shown its strong functions in many-side.At first, promoter library has been realized genetic expression " amount of the opening " accent that declines, and significantly is superior to utilizing " switch " formula regulation and control of single promotor.People such as Solem utilize promoter library, in lactococcus lactis ssp (Lactococculs latis), not only to glycolytic pathway pfk gene, also two other gene (pyk and Idh) that is positioned at same operon have been realized the expression regulation of strength increase.Secondly, promoter library can be used for metabolic analysis, makes people can locate metabolism control node more accurately.Keobmann etc. utilize promoter library regulation and control F in the research of intestinal bacteria glycolytic pathway
1-ATP synthetic enzyme is expressed, and the hydrolysis that discovery improves the gentle ATP of ATP enzyme running water gradually can make the glycolysis-flux improve 70%, shows that the main regulation and control factor of glycolytic pathway is the ATP level, and the enzyme that is not each reaction of approach itself is lived.The 3rd, promoter library also can be used for seeking the restrictive factor of polygene regulation and control route of synthesis.Alper etc. research lycopene synthetic the time; Discovery improves dxs gene (deoxy-xylulose-p synthase in wild bacterium; Deoxidation-lyxulose phosphate synthetic enzyme) expression can only improve the output of lycopene to a certain extent, and express in the reorganization bacterium of these two enzymes in route of synthesis downstream excessively; Constantly strengthen dxs genetic expression lycopene output is improved constantly, explain that deoxidation-lyxulose phosphate synthetase activity is the restrictive factor of reorganization bacterium route of synthesis.The 4th, promoter library also can be used for confirming the optimization gene regulating level of metabolism control.Nevoigt etc. find when analyzing glycerol 3-phosphate desaturase (GPDH) gene GPD1 to the influencing of yeast saccharomyces cerevisiae glycerine productive rate; When changing 2 times that are no more than its wild-type through the enzyme ratio of sudden change promotor control GPDH is alive; The living weight of thalline and glycerine productive rate all with the active positive correlation of GPDH; But crossing of multi-copy gene expressed; Not only can not make the corresponding increase of glycerine productive rate, also the cell growth generation suppresses, and therefore in Metabolically engineered, can accurately finely tune gene expression dose to reach optimization control through the sudden change promoter library.
It is thus clear that; Through making up promoter library; Will " amount of opening " decline and transfer genetic expression to become possibility; Metabolic analysis with transform, broken through originally can only through gene knockout (Knock out) with cross expression (Over expression) two kinds non-" opening " promptly the means of " pass " realize the genotypic disturbance of pair cell (Perturbation), can be through analyzing and control its influence to phenotype and metabolism distributions to the accurate fine setting of target gene expression carrying out gradient type.In addition, also can develop into the different promoters that uses in the library, a plurality of expression of gene are regulated and control simultaneously the utilization of this instrument.Therefore, promoter library is becoming metabolic engineering research to systems analysis and the developing effective research tool of global optimization, with the research level that greatly promotes this field.
Summary of the invention
The object of the present invention is to provide GAP promoter library that is used for pichia spp and uses thereof.
Another object of the present invention is to provide the screening mutant GAP method of promotor.
In first aspect of the present invention; A kind of mutant GAP promoter library is provided, and described promoter library comprises the promotor of nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ IDNO:6 or the SEQ ID NO:7.
In a preference, the promotor of nucleotide sequence has the intensity of the startup destination gene expression that weakens successively shown in described SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ IDNO:4, SEQ ID NO:5, SEQ ID NO:6 and the SEQ ID NO:7.
In another preference, the promotor of nucleotide sequence is an enhancement type GAP promotor with respect to wild-type GAP promotor shown in the described SEQ ID NO:1; The promotor of nucleotide sequence shown in described SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 is a reduction type GAP promotor with respect to wild-type GAP promotor.
In second aspect of the present invention; A kind of carrier is provided; Described carrier contains the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7, as promoter element.
In a preference, described carrier also contains the goal gene that is operably connected with described promoter element.
In another preference, described goal gene includes, but is not limited to: proteic gene, reporter gene (like green fluorescent protein, luciferase gene or galactosidase gene LacZ) that structure gene, coding have specific function.
In another preference, described goal gene is positioned at the downstream of promoter element, and with the interval of said promotor less than 2000bp; Preferable less than 1000bp; More preferably less than 500bp, as less than 200bp, less than 100bp, less than 50bp.
In the third aspect of the invention, a kind of genetically engineered host cell is provided, described cell:
Contain described carrier; Or
Be integrated with the nucleic acid of the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 in its genome.
In a preference, described cell is pichia spp (Pichia Pastoris) cell.
In fourth aspect of the present invention, the purposes of described mutant GAP promoter library is provided, be used to provide mutant GAP promotor, said mutant GAP promotor operability ground is connected with goal gene, regulate the expression of goal gene.
Aspect the of the present invention the 5th; A kind of method of screening mutant GAP promotor is provided; Described mutant GAP promotor changes (comprise strengthening and express or the reduction expression) with respect to the intensity of wild-type GAP promotor, startup destination gene expression, and said method comprises:
(1) recombinant expression vector 1 is provided, said recombinant expression vector 1 contains GAP promoter mutation body sequence, and the reporter gene sequence that links to each other with said GAP promoter mutation body series of operations property; With this recombinant expression vector 1 transformed host cell, obtain recombinant host cell 1, with this recombinant host cell 1 of BMD culture medium culturing;
(2) recombinant expression vector 2 is provided, said recombinant expression vector 2 contains wild-type GAP promoter sequence, and the reporter gene sequence that links to each other with said wild-type GAP promoter sequence operability; With these recombinant expression vector 2 transformed host cells, obtain recombinant host cell 2, with this recombinant host cell 2 of BMD culture medium culturing;
(3) observe described recombinant host cell 1 and express the situation of reporter gene; If with respect to recombinant host cell 2; The expression intensity of recombinant host cell 1 reporter gene changes (preferably having the variation of statistical significance), and the GAP promoter mutation body that then recombinant expression vector 1 carries in this recombinant host cell 1 is required mutant GAP promotor.
In a preference, described host cell is pichia spp (Pichia Pastoris) cell.
In another preference, described reporter gene is selected from but is not limited to: green fluorescent protein (GFP), synergic green fluorescent protein (EGFP) or galactosidase gene LacZ.
In another preference, the culture condition of described recombinant host cell 1 and recombinant host cell 2 is: 30 ± 2 ℃, and 200 ± 100rpm.
In another preference, the described recombinant host cell 1 of step (1) is identical with described recombinant host cell 2 culture condition of step (2).
In another preference; In the step (3); If with respect to recombinant host cell 2, significantly enhancing takes place the expression intensity of recombinant host cell 1 reporter gene, and (as strengthening more than 10%, preferable enhancing is more than 20%; Better enhancing is more than 30%), the GAP promoter mutation body that then recombinant expression vector 1 carries in this recombinant host cell 1 is an enhancement type GAP promotor with respect to wild-type GAP promotor.
In another preference; In the step (3); If with respect to recombinant host cell 2, significantly reduction takes place the expression intensity of recombinant host cell 1 reporter gene, and (as weakening more than 10%, preferable reduction is more than 20%; Better reduction is more than 30%), the GAP promoter mutation body that then recombinant expression vector 1 carries in this recombinant host cell 1 is a reduction type GAP promotor with respect to wild-type GAP promotor.
In another preference, in step (1) or (2), comprising with the method for BMD culture medium culturing recombinant host cell (recombinant host cell 1 or recombinant host cell 2):
(a) cultivated this recombinant host cell in advance 30-50 hour (more preferably 36-48 hour) with the BMD culture medium A; Wherein, glucose concn 0.2 ± 0.05% in the described BMD culture medium A;
(b) will transfer to BMD substratum B through pre-incubated recombinant host cell, cultivate 30-65 hour (preferably 36-48 hour); Wherein, glucose concn 1 ± 0.2% among the described BMD substratum B.
In another preference, described reporter gene is green fluorescent protein (GFP), and in the step (2), the method for observing the situation of described recombinant host cell expression reporter gene comprises: the fluorescence intensity of measuring the substratum that contains described recombinant host cell.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1, recombinant plasmid pGHg make up synoptic diagram.
Fig. 2, recombinant plasmid are identified.
A, recombinant plasmid pGAPZAgfp enzyme are cut with PCR and are verified.Swimming lane 1:Not I and the checking of SalI double digestion; Swimming lane 2: with primer GFP F and GFP R PCR checking; M:DNA marker.
B, recombinant plasmid pGAPg enzyme are cut checking.M:DNA Marker; Swimming lane 1:SpeI and the checking of Not I double digestion.
C, recombinant plasmid pGHg enzyme are cut with PCR and are verified.
M:DNA Marker; Swimming lane 1:SpeI and the checking of Not I double digestion; Swimming lane 2: with primer GAP primer and GFP R PCR checking.
Fig. 3, plasmid pGH collection of illustrative plates and structure synoptic diagram.
Fig. 4, recombinant plasmid pGH enzyme are cut with PCR and are verified.Swimming lane 1:PCR checking; Swimming lane 2: recombinant plasmid pGH cuts through the HindIII enzyme; M:DNA Marker.
Fig. 5, fluorescence microplate reader and and reorganization bacterium G/GHg expression GFP fluorescence intensity.
A, fluorescence microplate reader GFP fluorescence intensity.
B, cells were tested by flow cytometry GFP fluorescence intensity.1:G/GH; 2 and 3:G/GHg.
Different substratum BMD, BSM, BMDY, YPD are to the influence of reorganization bacteria growing in Fig. 6, the 48 hole depth orifice plates.
A, reorganization bacterium G/PHg are in 30 ℃, and 200rpm cultivates 60h, measures cell density OD
600
B, reorganization bacterium G/GHg are in 30 ℃, and 200rpm cultivates 60h, measures cell density OD
600
Fig. 7, different substratum are expressed influence to reorganization bacterium GFP.Flow cytometer detects reorganization bacterium G/PHg and through different substratum GFP is expressed influence with contrast bacterium G/PH.1.YPD cultivate contrast bacterium G/PH; 2.YPD cultivate G/PHg; 3.BMD cultivate G/PHg; 4.BSM cultivate G/PHg.
Fig. 8, screening model synoptic diagram.
The different vaccination amount is to reorganization bacterium G/PHg, G/GHg and the influence of contrast bacteria growing in Fig. 9, the preparatory culture plate of 48 deep-well plates.
Different vaccination amount reorganization bacterium G/GHg growing state relatively in A, the preparatory culture plate of 48 deep-well plates.Every hole dress BMD (0.2%) 900 μ L, 30 ℃, 200rpm cultivates 48h.GHg1: inoculum size 10 μ L; GHg2: inoculum size 20 μ L; GHg3: inoculum size 30 μ L.
Different vaccination amount reorganization bacterium G/PHg growing state relatively in B, the preparatory culture plate of 48 deep-well plates.Every hole dress BMD (0.2%) 900 μ L, 30 ℃, 200rpm cultivates 48h.PHg1: inoculum size 10 μ L; PHg2: inoculum size 20 μ L; PHg3: inoculum size 30 μ L.
Different vaccination amount contrast bacteria growing situation relatively in C, the preparatory culture plate of 48 deep-well plates.Every hole dress BMD (0.2%) 900 μ L, 30 ℃, 200rpm cultivates 48h.C1: inoculum size 10 μ L; C2: inoculum size 20 μ L; C3: inoculum size 30 μ L.
Figure 10, different vaccination time are adorned 900 μ L BMD (1%) substratum to reorganization bacterium G/PHg, G/GHg in the every hole of screen plate 48 hole depth orifice plate growth effect screen plate 48 deep-well plates; Cultivate 24h, 36h, 48h in advance in the culture plate and inoculate 30 μ L respectively to the screening flat board; 30 ℃; 200rpm cultivates 60h and measures cell density OD
600
Figure 11, be seeded to screen plate 48 hole depth orifice plate different vaccination amounts to reorganization bacteria growing influence from preparatory culture plate.
Figure 12, reorganization bacterium G/G
1stHgfp, G/G
2ndHgfp, G/G
3thThe HgfpPCR checking.
(A) swimming lane 1-10:G/G
1stHgfp; Swimming lane 11-17:G/G
2ndHgfp; M:DNA Marker.
(B) swimming lane 1-10:G/G
3thHgfp; Swimming lane 11-13:G/G
2ndHgfp; M:DNA Marker.
Figure 13, the expression of pGAP sudden change library regulation and control green fluorescent protein in recombinant yeast pichia pastoris have shown test tube cultivation flow cytometer detected result.
Figure 14, the comparison of G1-G7 sequencing result.
Embodiment
The inventor has made up a mutant GAP promoter library based on the GAP promotor through extensive and deep research, and this library comprises one group of isolating promotor, and the intensity that each promotor starts destination gene expression presents Gradient distribution.Promoter library of the present invention can be realized the continuous fine adjustment to destination gene expression.Accomplished the present invention on this basis.
Term
As used herein, described " promotor " is meant a kind of nucleotide sequence, and the upper reaches (5 ' end) that it is present in the goal gene encoding sequence usually can be transcribed into mRNA by the guiding nucleus acid sequence.Usually, promotor provides RNA polymerase and correct initial recognition site of transcribing necessary other factor.
As used herein, described " GAP promoter library " is meant and contains the nucleic acid aggregate that the present invention screens a series of mutant GAP promotors that obtain.
As used herein, described " GAP promotor " abbreviates pGAP or P as
GAP
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification like polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, described " being operably connected " or " operability links to each other " is meant functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promotor is placed in the specific position with respect to the goal gene nucleotide sequence, makes transcribing of nucleotide sequence receive the guiding of this promotor, thereby promotor is " operably connected " on this nucleotide sequence.
As used herein, " goal gene " is meant and can instructs the gene of expressing by promotor of the present invention.The present invention has no particular limits suitable goal gene, for example includes but not limited to: proteic gene, enzyme, reporter gene (like green fluorescent protein, luciferase gene or galactosidase gene LacZ) that structure gene, coding have specific function.
As used herein; Described " enhancement type GAP promotor " is meant with respect to its intensity that starts destination gene expression of wild-type GAP promotor (its sequence is shown in SEQ ID NO:8) and significantly strengthens; For example strengthen more than 10%; Preferable enhancing is more than 20%, and better enhancing is more than 30%, as strengthens more than 50%, strengthens more than 80% or strengthen more than 100%.Its intensity that starts destination gene expression can learn that the detection of expression amount is a technology well known to those skilled in the art through the gene expression amount of testing goal.
As used herein; Described " reduction type GAP promotor " is meant with respect to its intensity that starts destination gene expression of wild-type GAP promotor and significantly weakens; For example weaken more than 10%; Preferable reduction is more than 20%, and better reduction is more than 30%, as weaken more than 50%, reduction is more than 80% or weaken more than 100%.
As used herein, " external source " or " allogenic " is meant from the relation between two of different sources or many nucleic acid or the protein sequence.For example, if the combination of promotor and target gene sequences is not naturally occurring usually, then promotor is an external source for this goal gene.Particular sequence is " external source " for cell or organism that it inserted.
Promoter library
In order to realize continuous fine adjustment to genetic expression; The inventor is through extensive studies; Screen one group of mutant GAP promotor, comprised the promotor of nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7, constituted promoter library; The intensity that each promotor starts destination gene expression presents Gradient distribution, is used under varying strength, instructing destination gene expression.The acquisition of promoter library can guarantee the destination gene expression of being regulated and control is carried out gradient adjusting, implements controlled gene disturbance and systems analysis.
Promotor of the present invention can be operatively connected on the goal gene, and this goal gene can be external source (allos) for promotor.Described goal gene can be any nucleotide sequence (like a kind of structural nucleotide sequence) usually, and described goal gene optimized encoding has the albumen of specific function, and for example some has the albumen of key property or function.
For example, when being used for the research of expression intensity, described goal gene includes but not limited to: green fluorescent protein, synergic green fluorescent protein, luciferase gene or galactosidase gene LacZ etc." green fluorescent protein " has endogenous fluorophor, receiving UV-light or can efficiently launch apparent green glow when blue-light excited, and seeing that light is difficult for cancellation." synergic green fluorescent protein " is the albumen after green fluorescent protein is improved.The instrument that " luciferase " expressed situation as a kind of representational indicator can be indicated the expression conditions that is instructed by promotor well.
As optimal way of the present invention; Can from promoter library of the present invention, select the promotor of varying strength; Respectively they are operably connected with goal gene to be studied; Or with goal gene and described promotor is exercisable connects in the suitable carriers, take suitable mode to import in the host cell, thereby obtain the wherein different a series of cells of destination gene expression amount.Can learn the function or the purposes of this goal gene through metabolism situation, phenotype variation, protein expression situation or the interaction situation of analyzing these cells, the variation of various signaling molecules etc.
As optimal way of the present invention; Described goal gene can be a kind of for a certain cell the disappearance or the insufficient gene of expression amount; Can this goal gene be operably connected with enhanced GAP promotor of the present invention; Or with goal gene and promotor of the present invention is exercisable connects in the suitable carriers, take suitable mode to import in this cell, thereby express goal gene high-levelly.
Promotor of the present invention can also be operably connected on the target gene sequences that is modified, and this goal gene is external source (allos) with respect to promotor.Described goal gene can be modified and produce various desired characteristics.For example, goal gene can be modified increases contents of essential amino acids, improves the translation of aminoacid sequence; Change the modification (like phosphorylation site) after translating; Outside the translation product transporte to cells, improve proteic stability, insert or delete cell signal etc.
In addition, promotor and goal gene can be designed to reduce specific gene.This generally is to realize that through promotor is connected on the target gene sequences this sequence oppositely is directed with antisense.Those of ordinary skill in the art is familiar with this antisense technology.Any nucleotide sequence can be conditioned by this way.
Carrier and host cell
Any promotor and/or the target gene sequences that come from promoter library of the present invention can be comprised in the recombinant vectors.
As a kind of mode, described recombinant vectors comprises promotor of the present invention, comprises MCS or at least one restriction enzyme site in the downstream of said promotor.When needs are expressed goal gene, goal gene is connected in the suitable MCS or restriction enzyme site, thereby goal gene is operably connected with promotor.
As a kind of mode, described recombinant vectors comprises (from 5 ' to 3 ' direction): the promotor that the guiding goal gene is transcribed, and goal gene.If desired, described recombinant vectors can also comprise 3 ' transcription terminator, 3 ' polymerized nucleoside acidifying signal, other untranslated nucleotide sequence, transhipment and target nucleotide sequence, resistance selective marker, enhanser or operator.
The method that is used to prepare recombinant vectors is well-known to those skilled in the art.Term " expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, mammalian cell virus or other carriers.In a word, as long as it can duplicate in host and stablize, any plasmid and carrier all are can be adopted.Preferably, described expression vector is the expression vector that yeast cell is suitable for.
Method well-known to those having ordinary skill in the art can be used to make up the expression vector that contains promotor of the present invention and/or target gene sequences.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, like Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein (GFP) etc.
Except containing promotor of the present invention, also can contain one or more other promotors in the recombinant vectors.Described other promotor for example is: tissue-specific, composing type or induction type.
Comprise the above-mentioned suitable promotor and the carrier of goal gene, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, like bacterial cell; Or eukaryotic cell such as low, like yeast cell; Or higher eucaryotic cells, like vegetable cell.Representative example has: yeast, intestinal bacteria, the histocyte of animal, vegetable cell etc.Persons skilled in the art all know how to select appropriate carriers and host cell.As optimal way of the present invention, described host cell is a yeast cell, and more preferably, described host cell is the pichia spp cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
Screening method
The present invention also provides a kind of method of screening mutant GAP promotor; Described mutant GAP promotor changes (comprise strengthening and express or the reduction expression) with respect to the intensity of wild-type GAP promotor, startup destination gene expression; Said method comprises: under same culture conditions; Cultivate the host cell that starts destination gene expression by the host cell of GAP promoter mutation body startup destination gene expression and by wild-type GAP promotor respectively; The expression intensity (or expression amount) that compares goal gene in two kinds of cells; Compare expression intensity generation noticeable change if GAP promoter mutation body starts destination gene expression with wild-type GAP promotor startup destination gene expression, then this GAP promoter mutation body is required mutant GAP promotor.
In the above-mentioned screening method, preferred host cell is a yeast cell, more preferably is the pichia spp cell.The condition of culturing yeast cell is that those skilled in the art know, and has no particular limits among the present invention; Preferably, the condition of culturing yeast cell is 30 ± 2 ℃, 200 ± 100rpm.
The inventor finds under study for action, although multiple substratum all can be used for the cultivation of host cell among the present invention (like yeast cell), utilizes different culture medium to cultivate host cell, and is influential for the susceptibility or the accuracy of follow-up screening.Therefore, the inventor finds finally that to contrasting in the multiple substratum and selecting the BMD substratum is suitable for screening method of the present invention most.The BMD substratum is the known substratum of those skilled in the art, and it is filled a prescription as follows: YNB (yeast basis nitrogenous source) 26.8g/L, vitamin H 0.2g/L, glucose (Dextrose) 10g/L, 100mM phosphate buffered saline buffer (pH 6.0) preparation.
In the screening method of the present invention, at different screening stages, the inventor also regulates the concentration of glucose wherein.Therefore, as optimal way of the present invention, comprise with the method for BMD culture medium culturing recombinant host cell: (a) cultivated this recombinant host cell in advance 30-50 hour (more preferably 36-48 hour) with the BMD culture medium A; Wherein, glucose concn 0.2 ± 0.05% in the described BMD culture medium A; (b) will transfer to BMD substratum B through pre-incubated recombinant host cell, cultivate 30-65 hour (preferably 36-48 hour); Wherein, glucose concn 1 ± 0.2% among the described BMD substratum B.
The method of measuring the expression of reporter gene in the culture system is a technology well known to those skilled in the art, also can make adjustment according to the difference of reporter gene.As optimal way of the present invention, described reporter gene is green fluorescent protein (GFP), and the method for measuring this report expression of gene situation comprises: measure the fluorescence intensity in the culture system.
Major advantage of the present invention is:
(1) the present invention has obtained a series of promotors through a large amount of screenings, and the intensity that they start destination gene expression presents Gradient distribution, thereby has set up the GAP promoter library;
(2) the present invention is through making up promoter library; Will " amount of opening " decline and transfer genetic expression to become possibility; At metabolic analysis with in transforming; Broken through originally can only through gene knockout with cross express two kinds non-" opening " promptly the means of " pass " realize the genotypic disturbance of pair cell, can be through analyzing and control its influence to phenotype and metabolism distributions to the accurate fine setting of target gene expression carrying out gradient type.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to people such as normal condition such as Sambrook; Molecular cloning: lab guide (New York:Cold Spring HarborLaboratory Press; 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
The structure of embodiment 1, reorganization bacterium G/GHg
Utilize green fluorescent protein (GFP) as the GAP promotor intensity of reporter gene with its expression of description regulation and control.In order to make up the reporter gene expression carrier; The promotor of being convenient to suddenly change is inserted; At first utilize the expression of primary without the GAP promoter regulation reporter gene gfp of sudden change; Make up GFP reporter gene expression carrier pGHg and corresponding reorganization bacterium G/GHg, and make up the carrier pGH that does not contain the GFP gene and the bacterium G/GH that recombinates, investigate the expression of GFP as contrast.
1, the structure of expression vector pGHg and evaluation
(1) structure of recombinant plasmid pGAPZAgfp and evaluation
With reference to Fig. 1, (SEQ ID NO:15) is template with the complete synthesis gfp gene of chemistry, with primer GFP F (AAT
GCGGCCGCAAACCC
AAGCTTATGTCTAAAGGTGAAGAAT (SEQ ID NO:9)) and GFP R (GAC
GTCGACGCTCCC
AAGCTTTTATTTG TACAATTCATCC (SEQ ID NO:10)) amplifying target genes gfp, through restriction enzyme Not I and SalI double digestion, plasmid pGAPZ A (contains wild-type GAP promotor; Available from Invitrogen company) cut with the quadrat method enzyme.The gfp fragment is connected acquisition recombinant plasmid pGAPZAgfp with vector plasmid pGAPZA behind double digestion.Recombinant plasmid pGAPZAgfp carries out PCR with primer GFP F and GFP R and identifies the about 750bp of purpose fragment gfp; Not I and SalI digestion with restriction enzyme are identified, downcut the about 750bp of purpose fragment gfp (like Fig. 2 A).
(2) structure of recombinant plasmid pGAPg and evaluation
Plasmid pGAPZ A is a template, positive-sense strand primer GAP F BSpe (AGA
AGATCTTCG
ACTAGTTTTTTGTAGAAATGTCTTGGT (SEQ ID NO:11)) and antisense strand primer GAP R Not (TTA
GCGGCCGCAATAGTTGTTCAATTGATTGAAA (SEQ ID NO:12)), the GAP promoter fragment that amplification obtains is cut through BglII and NotI enzyme, connects the carrier pGAPZAgfp that cuts through with the quadrat method enzyme, obtains recombinant plasmid pGAPg.Recombinant plasmid pGAPg identifies with SpeI and Not I digestion with restriction enzyme, downcuts GAP promotor and carrier segments and is respectively 500bp and 3kb (like Fig. 2 B).
(3) structure of recombinant plasmid pGHg and evaluation
Plasmid pGAPg cuts through the BglII enzyme, and dephosphorylation.PAO815 plasmid (available from the Invitrogen company) fragment (HIS4 of 4.0kb and 3 ' AOX fragment) of cutting with restriction enzyme BglII and BamH I enzyme; This fragment with cut through the BglII enzyme and dephosphorization acid after plasmid pGAPg be connected; Obtain plasmid pGHg; SpeI and Not I digestion with restriction enzyme are identified, downcut the about 500bp of purpose fragment; Identify the about 750bp of purpose fragment (like Fig. 2 C) with primer GAP primer (TTTCAATCAATTGAACAACTAT (SEQ ID NO:13)) and GFP R (GCAAATGGCATTCTGACATCC (SEQ ID NO:14)) PCR.
2, the structure of recombinant plasmid pGH and evaluation
Recombinant plasmid pGHg cuts through restriction enzyme HindIII enzyme, returns by the 6.8kb carrier segments through connecting acquisition plasmid pGH, plasmid construction synoptic diagram such as Fig. 3 certainly.Identify recombinant plasmid pGH with GAP promotor positive-sense strand primer GAP F BSpeI and 3 ' AOX primer PCR, the about 750bp of purpose fragment, restriction enzyme HindIII enzyme cut checking plasmid pGH, and linearization plasmid is about 6.8kb, like Fig. 4.
3, the structure of genetic engineering bacterium G/GHg and G/GH
With the recombinant plasmid pGHg that builds and pGH with Restriction Enzyme BspeI linearization for enzyme restriction after; With ethanol sedimentation method deposit D NA, reclaim back electricity commentaries on classics pichia spp GS115 (available from Invitrogen company) respectively, coating MD is dull and stereotyped; Be inverted for 30 ℃ and cultivated 3~5 days, occur up to mono-clonal.Adopt bacterium colony PCR to identify transformant.
10 genetic engineering bacterium G/GHg that select on the MD flat board are inoculated in the 3mL YPG substratum, and 30 ℃, 220rpm cultivates 16h; Get 1mL bacterium liquid guarantor and plant 1mL bacterium liquid 5000rpm, centrifugal collection thalline; The de-ionized washing once with the resuspended thalline of 20% glycerine, is preserved so that the subsequent analysis of sample for-20 ℃.Remaining bacterium liquid is used to measure cell concentration (OD
600).
(1) fluorescence microplate reader detects the GFP fluorescence intensity
Bacterium liquid is diluted to OD with PBS (pH7.0)
600Be 1, dilution back sample is got 250 μ L to 96 orifice plates, uses fluorescence microplate reader to detect GFP fluorescence intensity (excitation wavelength: 488nm, emission wavelength: 505nm), and detect OD
600When detecting the GFP fluorescence intensity, remove background interference as contrast with the genetic engineering bacterium G/GH that does not express GFP.The GFP of G/GH and G/GHg is respectively 2246.5 (RFU) and 2349.3 (RFU) than fluorescence intensity level, like Fig. 5 A, than fluorescence intensity F/OD
600(RFU/OD
600) be that fluorescence intensity level is than last corresponding cell density OD
600
(2) cells were tested by flow cytometry GFP fluorescence intensity
Thalline is diluted to OD with PBS (pH7.0)
600Be 0.2, then through cells were tested by flow cytometry cell GFP fluorescence intensity (same testing conditions under with genetic engineering bacterium G/GH as blank).Shown in Fig. 5 B, utilize flow cytometer can detect the characteristic fluorescence of GFP, the reorganization bacterium G/GHg of structure can utilize the expression of GAP promoter regulation reporter gene gfp, and the GFP that expresses has activity.Thus it is clear that, can characterize its expression promoter intensity of regulation and control through the fluorescence intensity that detects GFP.
To sum up, the inventor has successfully made up expression vector pGHg, utilize constitutive promoter GAP regulation and control reporter gene gfp to express, and the carrier pGH that structure does not contain the GFP gene is as contrast.GFP expression vector pGHg changed among the pichia spp GS115 obtain G/GHg; Detect GFP fluorescence through PCR, flow cytometer and fluorescence microplate reader, verified that the gfp gene has successfully been changed over to the reorganization bacterium and received promotor GAP regulating and expressing to provide activated green fluorescent protein.With GS115 is the host, changes the control vector pGH that does not express gfp over to, and the bacterium G/GH that obtains recombinating through changing over to of PCR checking carrier pGH, obtains contrast reorganization bacterium G/GH.
The foundation of embodiment 2, screening model
1, screening culture medium confirms
(1) different substratum influence the GFP fluoroscopic examination
With the negative contrast of PBS, investigate of the influence of different substratum to the GFP fluoroscopic examination.
Aseptic BMD, BMDY, YPD, BSM substratum (referring to the operational manual of Invitrogen company: A Manualof Methods for Expression of Recombinant Proteins in Pichia pastoris) and PBS respectively get 250 μ L and add in 96 orifice plates and measure fluorescence intensity (excitation wavelength: 488nm, emission wavelength: 505nm) through fluorescence microplate reader.The result finds that the BSM substratum disturbs minimum (BSM:537 (RFU) to fluorescent strength determining; PBS:460 (RFU)), secondly be BMD:616 (RFU).Aseptic culture medium BMDY and YPD are the strongest through the fluorescence microplate reader fluorescence intensity, are respectively: 47581 (RFU) and 46499 (RFU) exceed PBS and detect more than 100 times of fluorescence.
BMD, BMDY, YPD, BSM substratum and PBS fill a prescription as follows:
BMD (1% glucose): YNB 26.8g/L, vitamin H 0.2g/L, glucose (Dextrose) 10g/L, the preparation of 100mM potassium phosphate buffer, pH 6.0.
BMD (0.2% glucose): YNB 26.8g/L, vitamin H 0.2g/L, glucose (Dextrose) 2g/L, the preparation of 100mM potassium phosphate buffer, pH 6.0.
BMDY: peptone 20g/L, yeast extract 10g/L, YNB 26.8g/L, vitamin H 0.04g/L, glucose (Dextrose) 10g/L, the preparation of 100mM potassium phosphate buffer, pH 6.0.
YPD (1% glucose): peptone 20g/L, yeast extract 10g/L, glucose 10g/L.
BSM: (NH
4)
2SO
47.0g/L, CaSO
40.46g/L, K
2SO
49.1g/L, MgSO
47H
2O 7.5g/L, glucose (Dextrose) 10g/L, PTM
112mL/L.K with 0.2M
2HPO
4/ KH
2PO
4The damping fluid preparation, pH5.5.
PTM wherein
1: CuSO
45H
2O 6g/L, KI 0.08g/L, MnSO
4H
2O 3g/L, Na
2MoO
42H
2O0.2g/L, H
3BO
30.02g/L, ZnSO
47H
2O 20g/L, FeSO
47H
2O 65g/L, CoCl
26H
2O 0.5g/L, vitamin H 0.04g/L, H
2SO
45mL/L.
PBS:pH7.0:NaCl 8g/L, KCl 0.2g/L, Na
2HPO
41.42g/L, KH
2PO
40.27g/L hydrochloric acid is transferred pH to 7.0.
(2) different substratum are to the influence of thalli growth
The inventor has examined or check four kinds of substratum BMD, BSM, BMDY, YPD (carbon source is 1% glucose) respectively to reorganization bacterium G/PHg and G/GHg growth effect.900 μ l substratum are adorned in the every hole of 48 hole depth orifice plates, and every kind of substratum is done three parallel multiple holes.48 hole depth orifice plates were cultivated 36 hours, got 30 μ L and were seeded to another the 48 hole depth orifice plate that contains corresponding substratum, and 30 ℃, 200rpm cultivates 60h, measures cell density OD
600, result such as Fig. 6.It is thus clear that, no matter be G/PHg and G/GHg reorganization bacterium, YPD and BMDY are the most favourable to thalli growth in four kinds of substratum, OD behind the cultivation 60h
600Reach about 17; Comparatively speaking, cell density OD behind BSM and the BMD cultivation 60h
600Be respectively 12 and 9.
(3) different substratum are expressed influence to reorganization bacterium GFP
Seeing that BSM and BMD substratum disturb minimum (BSM:537 (RFU) to the GFP fluorescent strength determining; BMD:616 (RFU)), this experiment has mainly been examined or check BSM and BMD substratum (glucose content is 1%) GFP has been expressed influence.900 μ L substratum are adorned in the every hole of 48 hole depth orifice plates, and every kind of substratum is done three parallel multiple holes respectively, and G/PHg, G/PH, G/GHg and G/GH cultivate 36h through 48 deep-well plates and inoculate 30 μ L respectively to another 48 deep-well plates that corresponding substratum is housed; 30 ℃; 200rpm cultivates 60h, measures cell density OD
600, (excitation wavelength: 488nm, emission wavelength: 505nm), flow cytometer detects the GFP fluorescence intensity to measure fluorescence intensity through fluorescence microplate reader.
Relatively recombinate bacterium G/GHg and contrast bacterium G/GH respectively behind BSM and BMD cultivation 60h GFP than fluorescence intensity (F/OD
600), visible: when with the BSM culture medium culturing, G/GHg is almost more consistent than fluorescence intensity with the GFP of contrast bacterium G/GH, can't distinguish; When with the BMD culture medium culturing, G/GHg and the GFP of contrast bacterium G/GH differ about 300 (RFU/OD than fluorescence intensity
600), can distinguish basically, the GFP of G/GHg is 2456 (RFU/OD than fluorescence intensity
600), it is 2155 (RFU/OD that G/GH detects than fluorescence intensity
600).
Relatively recombinate bacterium G/PHg and contrast bacterium G/PH respectively behind BSM and BMD cultivation 60h than fluorescence intensity (F/OD
600), visible: no matter be with BSM substratum or BMD substratum, G/PHg and the GFP of contrast bacterium G/PH can significantly distinguish than fluorescence intensity is equal, when utilizing the BMD substratum, and G/PHg (8029 (RFU/OD
600)) detected than fluorescence intensity (2246 (RFU/OD with contrast bacterium G/PH
600)) difference is significantly near 4500 (RFU/OD
600); The less about 1500 (RFU/OD of both differences when comparatively speaking, using the BSM substratum
600), the GFP of G/PHg is 3528 (RFU/OD than fluorescence intensity
600), G/GH is detected to be 1982 (RFU/OD than fluorescence intensity
600).Same; Detect G/PHg and contrast bacterium G/PH fluorescence intensity through flow cytometer through BSM and BMD cultivation 60h; The result is with consistent through the result that fluorescence microplate reader detects with 96 orifice plates, and it is the same to express the GFP effect with BMD substratum and use YPD substratum, like Fig. 7.
2, screening conditions confirms
(1) protects kind of a plate and be inoculated into the influence of preparatory cultivation (pre-culture) different vaccination amount cell growth
900 μ L BMD (0.2% glucose) are adorned in the every hole of culture plate 48 hole depth orifice plates in advance; Get 10 μ L, 20 μ L, 30 μ L bacterium liquid to preparatory culture plate, 30 ℃, 200rpm from protecting kind of a plate (masterplate) respectively; Cultivate 48h, cell density OD is surveyed in every interval 12h (0h, 12h, 24h, 36h, 48h) sampling
600, like Fig. 8.
The main examination of this experiment is seeded to screen plate 48 hole depth orifice plate different vaccination amounts to reorganization bacterium G/PHg, G/GHg and the influence of contrast bacteria growing from preparatory cultivation.Experimental result shows: though initial inoculation amount different (10 μ L~30 μ L), but the growth of reorganization bacterium is not had influence.To reorganization bacterium G/PHg, G/GHg and contrast bacterium, growth curve trend was consistent like Fig. 9 A-C when the initial inoculation amount was 10 μ L, 20 μ L or 30 μ L.Can know from Fig. 9 no matter inoculate what are, different reorganization bacterium all transits to the stage of stable development from logarithmic phase after cultivating 24h, and the 48h cell stops growing, though to the 48h cell density downtrending is arranged a little, cell density OD
600Finally maintain same level (OD
600=3.5~4.0).So, the initial inoculation weight range 10 μ L~30 μ L all can, consider convenient experimental operation property (volley of rifle fire minimum range is 30 μ L), it is 30 μ L that inoculum size is adopted in follow-up experiment.
(2) cultivation is seeded to the influence of screen plate different vaccination time cell growth in advance
900 μ L BMD (1% glucose) are adorned in the every hole of screen plate 48 hole depth orifice plates; Get 30 μ L bacterium liquid to screen plate with cultivating 24h, 36h, 48h bacterium liquid in the preparatory culture plate respectively, 30 ℃, 200rpm; Cultivate 60h, cell density OD is surveyed in every interval 12h (0h, 12h, 24h, 36h, 48h, 60h) sampling
600
The main examination of this experiment is seeded to the 48 hole depth orifice plate different vaccination times of screen plate to reorganization bacterium G/PHg, G/GHg growth effect from preparatory culture plate.Experimental result shows: in advance culture plate is cultivated 24h, 36h, 48h and is inoculated 30 μ L respectively to screen plate, even inoculation time is different, but to the growth did not influence of reorganization bacterium, through the mycetocyte density OD that respectively recombinates behind the screen plate cultivation 60h
600Finally reach same level (OD
600=8.3~8.5).It is thus clear that inoculation time does not have influence in 24h~48h scope to the reorganization bacteria growing, but consider that preparatory culture plate cultivation 48h has just reached the stage of stable development and OD
600Finally maintain same level (OD
600=3.5~4.0) (like Figure 10), thus 36h for to be seeded to screen plate 48 deep-well plates optimum time points from preparatory culture plate, follow-up experiment adopts inoculation time to be 36h.
(3) culture plate is seeded to the influence of screen plate different vaccination amount cell growth in advance
900 μ L BMD1% are adorned in the every hole of screen plate 48 hole depth orifice plates; Respectively preparatory culture plate is cultivated 36h bacterium liquid and get 10 μ L, 20 μ L, 30 μ L, 50 μ L bacterium liquid to screen plate, 30 ℃, 200rpm; Cultivate 60h, cell density OD is surveyed in every interval 12h (0h, 12h, 24h, 36h, 48h, 60h) sampling
600
Relatively be seeded to screen plate 48 hole depth orifice plate different vaccination amounts to reorganization bacterium G/PHg, G/GHg and the influence of contrast bacteria growing from preparatory culture plate; Experimental result shows: culture plate is cultivated 36h and is inoculated 10 μ L, 20 μ L, 30 μ L respectively to screen plate in advance; Though inoculum size difference but growth curve and no significant difference; Cultivate 24h through screen plate and all carry out the transition to the stage of stable development for a long time, the 36h mycetocyte density OD that respectively recombinates behind the 60h from logarithm
600All the time maintain about 8; When inoculum size is increased to 50 μ L, the stage of stable development, after this OD have just been reached in the 12h
600Maintain 9 (like Figure 11).So; Be seeded to screen plate 48 deep-well plates inoculum size scopes at 10~30 μ L from preparatory culture plate; To the growth did not influence of reorganization bacterium, factor and consider convenient experimental operation property (use the volley of rifle fire minimum range be 30 μ L) to sum up, it is 30 μ L that inoculum size is adopted in follow-up experiment.
3, result and discussion
Utilize 48 hole depth orifice plates screening promoter library, at first examined or check four kinds of substratum BMD, BSM, BMDY, YPD to the influence of reorganization bacteria growing, experimental result shows that YPD and BMDY are the most favourable to thalli growth in four kinds of substratum, OD behind the cultivation 60h
600Reach about 17; Comparatively speaking, utilize BSM and BMD substratum 60h after, cell density OD
600Lessly be respectively 12 and 9.After through the screening of 48 hole depth orifice plates, must be with the corresponding one by one dilution (OD of sample in the deep-well plates
600Be 0.2-1) and be transferred to 96 orifice plates, so that the mensuration of reporter protein fluorescence intensity and cell density, so cell density is too high and be unfavorable for follow-up experimental implementation (OD
600Detect with fluorescence intensity), utilize BSM and BMD cultivation 60h after, OD
600Scope all in 10, only needs 10 times of OD of diluted sample
600=0.2-1 is convenient to detect, so BMD is applicable to that with BSM 48 hole depth orifice plates screen in four kinds of substratum.
When detecting four kinds of substratum BMD, BSM, BMDY, YPD, find that the BSM substratum disturbs minimum (BSM:537 (RFU) to fluorescent strength determining to GFP fluorescence intensity detection interference; PBS:460 (RFU)), secondly be BMD:616 (RFU).Aseptic culture medium BMDY and YPD are the most by force 100 times of PBS (460/RFU) through the fluorescence microplate reader fluorescence intensity.Therefore substratum BMD and BSM help reporter protein GFP fluorescent strength determining, and BMDY and YPD are too big for the interference that detects, and are inappropriate for 48 hole depth orifice plate screening culture medium.
Seeing that BSM and BMD substratum disturb minimum to the GFP fluorescent strength determining and utilize these two kinds of substratum cell densities to be unlikely to too high; Mainly examined or check these two kinds of substratum subsequently reorganization bacterium GFP has been expressed influence; Experimental result shows: consistent with BMD with YPD substratum reorganization bacterium expression GFP level, and obviously be weaker than the former with the level of BSM reorganization bacterium expression GFP.Therefore, utilize 48 hole depth orifice plates screening promoter library, optimum medium is BMD.
Prove through experiment: express the reorganization bacterium of GFP, work as OD
600In the 0.2-1 scope, its GFP fluorescence intensity and cell density OD
600Linear; It is irrelevant not express GFP contrast detected fluorescence intensity of bacterium and cell density; Can be through calculating than fluorescence intensity, the reorganization bacterium of GFP and the difference of the GFP fluorescence intensity of contrast bacterium are expressed in assessment, thus assessment reorganization bacterium regulation and control GFP expression promoter intensity.
Utilize 48 hole depth orifice plates following as the screening implement operating process of promoter library:
(1) it is big or small that the single bacterium colony that at first will coat the mutant bacteria on the MD screening flat board is cultured to the about 3mm of diameter.
(2) protect kind of a plate
600 μ L YPD are adorned in every hole in the 48 hole depth orifice plates, on the picking MD flat board the single bacterium colony of diameter 3mm to orifice plate, the corresponding hole of single bacterium colony; 30 ℃, 200rpm cultivates 24h; Every then hole adds 60% glycerine, 300 μ L, 30 ℃, 200rpm; Cultivate 30min, be prepared into the master plate of glycerine preservation, at last master-plate is placed-80 to preserve so that follow-up experiment is used.
(3) cultivate in advance
900 μ L BMD (0.2% glucose) are adorned in the every hole of culture plate 48 hole depth orifice plates in advance; Get bacterium liquid 30 μ L that master-plate cultivates 24h to the orifice plate of corresponding preparatory culture plate, 30 ℃, 200rpm; Cultivate 36h, in advance cell density basically identical (OD between each hole in each deep hole of culture plate
600Homogeneity).
(4) screening
900 μ L BMD (1% glucose) are adorned in the every hole of screen plate 48 hole depth orifice plates, from the hole of preparatory culture plate, get 30 μ L bacterium liquid to screen plate, and 30 ℃, 200rpm cultivates 36h, utilizes screen plate to filter out the reconstitution cell with different promoters intensity.
The structure in embodiment 3, GAP promoter mutation library
In order to make up promoter library, obtain the sudden change promotor that promotor strength range broad and promotor intensity become graded, must obtain having the promotor of abundant sudden change and the method for quick effectively screening two mutants.Fallibility PCR (EP-PCR) is a kind of easy method of in dna sequence dna, making sudden change apace at random.Its ultimate principle is (like dNTP and Mg through some component concentrations in the change conventional P CR reaction system
2+Concentration), make base to a certain extent random error introduce and create the variety of sequence.The key of fallibility PCR is to select suitable mutation frequency, and the frequency of general useful sudden change is very low, and most sudden changes are deleterious or neutral.When mutation frequency is too high, almost can't screen useful sudden change; When mutation frequency is too low, the wild-type that any sudden change does not then take place will be preponderated in mutagenized populations, also be difficult to screen the ideal two mutants.When 1.5~5 base generation base replacements were arranged in the general 1kb target gene, the mutagenesis result was the most desirable.So the inventor's top priority is to confirm the EP-PCR reaction conditions of mutation frequency in 1%~5% (GAP is 500bp, and by 1%~5% calculating, the base mutation number is 5~25) scope.In order effectively to screen effective two mutants fast, with the expression of sudden change promoter regulation reporter gene gfp, make up mutation expression carrier and corresponding reorganization bacterium, the bacterium of will recombinating places 48 deep-well plates to cultivate, and utilizes fluorescence microplate reader to carry out high-flux fast screening.
1, the sudden change of GAP promotor
A lot of researchs show that the mutation rate of fallibility PCR receives the influence of Taq enzyme fidelity.Add Mn
2+After, Taq enzyme fidelity is along with Mg in the reaction system
2+Concentration increase and reduce.The matched proportion density of different dNTP also influences Taq enzyme fidelity.Wherein, Mn
2+The common 0.5mM of concentration, and Mg
2+Concentration along with different to the requirement of mutation rate, have different concentration, be generally 2~10mM.In order to optimize the reaction conditions of fallibility PCR, to reach the mutation rate (1%~5%) that needs, the inventor is with different Mg
2+Concentration: 4mM, 6mM, 8mM and 10mM have carried out fallibility PCR reaction, each Mg respectively
2+Concentration is respectively selected ten mutant clon order-checkings and is added up its mutation rate.Mg
2+The mutation rate that ionic concn is produced when being 4mM is low has only 0.7%, and Mg
2+The mutation rate that ionic concn produces during for 10mM is 1.5% more moderately can satisfy requirement of experiment.Reach 4.1% through three-wheel EP-PCR mutation rate.The Mg of 4mM, 6mM, 8mM and 10mM
2+Concentration fallibility PCR reaction mutation rate is respectively 0.3%, 0.7%, 0.8%, 1.5%.
In order to increase the mutation rate of fallibility PCR, the inventor on the basis of first round fallibility PCR, carried out again second with the fallibility PCR of third round.Consider the mutation rate that experiment hope reaches, in the experiment, the Mn of EP-PCR reaction system
2+, dATP, dGTP, dCTP, constant 0.5mM, 0.2mM, 0.2mM, 1mM, the 1mM of being respectively of dTTP concentration fixed.Every Mg that takes turns fallibility PCR
2+Ionic concn all is decided to be 10mM.Second is respectively the recovery product that first round EP-PCR and second takes turns EP-PCR with the template of third round EP-PCR.Through three-wheel EP-PCR, mutation rate can reach 3%-4.1%.
2, the structure in GAP promoter mutation library
(1) structure of recombinant yeast pichia pastoris cell bank
The promotor GAP of sudden change uses restriction enzyme SpeI and Not I double digestion respectively, with this fragment with equally behind SpeI and Not I double digestion carrier pGHg be connected respectively, transform DH5 α, D/G is cloned in the acquisition mixing
1stHg, D/G
2ndHg and D/G
3rdHg.The final reorganization mixing plasmid pG that obtains
1stHg, pG
2ndHg and pG
3rdHg.Reorganization mixes plasmid and uses Restriction Enzyme BspeI linearization for enzyme restriction respectively, and electricity changes pichia spp GS115, obtains transformant G/G
1stHg, G/G
2ndHg and G/G
3rdHg.It is dull and stereotyped to transform back coating MD, is inverted for 30 ℃ and cultivates 3~5 days, occurs up to mono-clonal.Adopt bacterium colony PCR to identify transformant, the PCR the primer is respectively GAP primer and gfp R.The theoretical size of positive colony PCR band about 800bp (like Figure 12).All positive reorganization bacterium are built into pichia spp GAP sudden change promotor cell bank.
(2) sudden change promoter library screening
Utilize the screening implement of 48 hole depth orifice plates, filter out reconstitution cell with different promoters intensity according to the operating process of Fig. 8 as promoter library.Utilize 7 48 deep-well plates to have screened 300 sudden change promotor reconstitution cells, obtained the P that intensity becomes Gradient distribution
GAPThe sudden change library, table 1 is regulated and control the expression intensity of green fluorescent protein in recombinant yeast pichia pastoris through the fluorescence microplate reader detected result for promoter library.And 7 sudden change promotors in the promoter library that will suddenly change are cloned into the order-checking of T carrier through PCR.Sequencing result such as Figure 14 suddenly change 7 sudden change promotors in the promoter library (G1, G2, G3, G4, G5, G6, G7) polynucleotide sequence all there are differences, and can reach a conclusion, the difference of sudden change promotor intensity is because the sudden change of pGAP sequence causes really in the library.
Table 1, pGAP sudden change library regulation and control green fluorescent protein are expressed in recombinant yeast pichia pastoris
The sudden change promotor | G1 | pGAP(WT) | G2 | G3 | G4 | G5 | G6 | G7 |
F/OD 600 | 234.3 | 187.7 | 164.3 | 124.6 | 92.6 | 66 | 34 | 1.3 |
With G1, G2, G3; G4, G5, G6 and G7 cell cultivate with test tube after flow cytometer detects the GFP fluorescence intensity; Like Figure 13; Its result is consistent with the fluorescence microplate reader detected result, it is thus clear that can 48 deep-well plates, 900 μ L be amplified to test tube 3mL, has proved that again the difference of sudden change promotor intensity is because the sudden change of pGAP sequence causes really in the library.The acquisition of promoter library can guarantee institute's regulate gene expression is carried out gradient adjusting, implements controlled gene disturbance and systems analysis.
(3) sudden change promoter sequence analysis
Through to the sudden change promoter library in G1 (SEQ ID NO:1), G2 (SEQ ID NO:2), G3 (SEQ ID NO:3), G4 (SEQ ID NO:4); G5 (SEQ ID NO:5), Figure 14 is seen in the sequential analysis of G6 (SEQ ID NO:6) and G7 (SEQ ID NO:7), finds that the base of these 7 sudden change promoter mutations distributes average; Mutation rate is respectively: 3.35%, 2.31%, 1.89%; 2.73%, 1.26%, 2.10% and 2.52%.Therefore, the sudden change of promotor is abundanter in the constructed sudden change promoter library.
To sum up, through Mg in the adjustment EP-PCR reaction system
2+Concentration has obtained moderate EP-PCR mutation rate, works as Mg
2+When concentration was 10mM, the EP-PCR mutation rate reached 1.3%.Through three-wheel EP-PCR, the mutation rate of base is in the 1.3%-4% scope.
Present embodiment has been accomplished the structure and the screening of GAP promoter library; Through detection to reorganization cell expressing GFP albumen fluorescence; Obtain the promotor that a series of intensity gradients change, also screened the promotor strength ratio slightly high muton of promotor GAP intensity that do not suddenly change.According to The selection result, the back promotor of will suddenling change checks order through the PCR clone from reconstitution cell, analyzes its mutation rate and position, finds that the base of sudden change is all different.Experimental result shows: 7 sudden change promotor polynucleotide sequences in the sudden change promoter library all there are differences, and can reach a conclusion, and the difference of sudden change promotor intensity is because the sudden change of pGAP sequence causes really in the library; Detect through fluorescence microplate reader and flow cytometer, pGAP sudden change library regulation and control green fluorescent protein expression amount in recombinant yeast pichia pastoris seemingly changes in gradient.
All documents in that the present invention mentions are all quoted as a reference in this application, are just quoted such as a reference separately as each piece document.Should be understood that in addition after having read above-mentioned teachings of the present invention, those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
< 110>East China University of Science
< 120>GAP promoter library and uses thereof
<130>092605
<160>15
<170>PatentIn?version?3.3
<210>1
<211>477
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>mutant GAP promotor
<400>1
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccgtctctg?aaatatctgg 60
ctccgttgca?actccgaacg?acctgcaggc?aacgtaaaat?tctctggggt?aaaacctaaa 120
tgtggagtaa?tggaaccagg?aacgtctctt?cccttctctc?tccttccacc?gcccgttact 180
gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgtt 240
cttcccagca?ttacgttgcg?ggtaatacgg?aggtcgagta?cccgacctag?cagcccaggg 300
atggaaaagt?cccagccgtc?gctggcaata?atagcgggcg?gacgcatgcc?atgagtttat 360
tggagaccac?cagaatcgaa?tataaaaggc?gaacaccttt?cccaatgttg?gtttctcctg 420
acccaaagac?tttaaatcta?atttatctgt?ccctatttca?atcaattgaa?caactat 477
<210>2
<211>477
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>mutant GAP promotor
<400>2
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60
ctccgttgca?actcagaaca?acctgctggc?tacgtaaaat?tctccggggt?aaaacttaaa 120
tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgctacc 180
gtccctagga?aattttactc?tgctggagag?ctccttctac?tgcccccttg?cagcaatgct 240
cttcccagca?ttacgatgcg?ggtaaagcgg?aggtcgtgta?cccgacctag?cagcccaggg 300
atggaaaagt?cccggccgtc?gctggcaata?gtagcgggcg?gacgcatgtc?atgagattat 360
tggaaaccac?caggatcgaa?tataaaaggc?gaacaccttt?cccaattttg?gtttctcctg 420
acccaaagac?tttaaattta?atttatttgt?ccctgtttca?atcaattgaa?caactat 477
<210>3
<211>477
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>mutant GAP promotor
<400>3
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccgtctctg?aaatatctgg 60
ctccgttgca?actccgaacg?acctgctggc?aacgtaaaat?tctccggggt?aaaacttaaa 120
tgtggggtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccact?gcccgttacc 180
gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?ctgcaacgct 240
cttccaagca?ttgcgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300
atggaaaagt?cccggccgac?gctggcaata?atagcgggcg?gacgcatgtc?atgagattat 360
tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccttt?cccgattttg?gtttctcctg 420
acccaaagac?tttaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477
<210>4
<211>477
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>mutant GAP promotor
<400>4
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60
ctccgttgca?actccgaacg?acctgctggc?aacgtaagat?actccgaggt?aaaacttaaa 120
tgtggagtaa?tggaaccaga?aacgtctctt?cctttctctc?tccttccacc?gcccgttacc 180
gtccctagga?agttttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgct 240
cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcttgta?cccgacctag?cagcccaggg 300
atggaaaagt?cccggccgtt?gctggcaata?atagcgggcg?gacgcatgtc?atgagattac 360
tggaaaccac?cagaatcgaa?cataaaaggc?gaacacctgt?cctaaattag?gtttctcctg 420
acccaaagac?tttaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477
<210>5
<211>477
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>mutant GAP promotor
<400>5
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60
ctccgttgca?actccgaacg?acctgcgggc?aacgtaaaat?tctccggggt?aaaacttaaa 120
tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180
gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgct 240
cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300
atggaatagt?cccggccgtc?gctggcaata?atagcgggcg?gacgcatgtc?atgagattac 360
tggaaaccac?ctgaatcgat?tataaaaggc?gaacaccttt?cccaattttg?gtttctcctg 420
acccaaagac?ttcaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477
<210>6
<211>477
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>mutant GAP promoter sequence
<400>6
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60
ctccgttgca?actccgaacg?acctgctggc?aacgtaaaat?tctccggggt?aaaactttaa 120
tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180
gtccctagga?aattttactc?tgcgggagag?cttctcctac?ggcccccttg?cagcaatgct 240
ctccccagaa?ttacgtcgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300
atggaaaagt?cccggccgtc?gctggcaata?atagcgggcg?ggcgcatgtc?atgagactat 360
tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccttt?ccctattttg?gtttctcctg 420
acccaaagac?tttaaaatta?atttatttgt?ccctatttca?atcaattgaa?caactat 477
<210>7
<211>477
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>mutant GAP promoter sequence
<400>7
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60
ctccgttgca?actccgaacg?acctgctggc?aacgtagaat?tctccggggt?aaaacttaaa 120
tgtggagtaa?tggagccaga?gacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180
gtccctagga?aaatttactc?agctggagag?cttcttctac?ggcccccttg?cagcaatgct 240
cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300
gtggaaaagt?cccggccgtc?gctggcaata?ttagctggcg?gacgcatgtc?atgagactac 360
tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccatt?cccaattttg?gtttctcctg 420
acccaaagac?tttagattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477
<210>8
<211>477
<212>DNA
< 213>pichia spp (Pichia Pastoris)
<400>8
tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60
ctccgttgca?actccgaacg?acctgctggc?aacgtaaaat?tctccggggt?aaaacttaaa 120
tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180
gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgct 240
cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300
atggaaaagt?cccggccgtc?gctggcaata?atagcgggcg?gacgcatgtc?atgagattat 360
tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccttt?cccaattttg?gtttctcctg 420
acccaaagac?tttaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477
<210>9
<211>42
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>9
aatgcggccg?caaacccaag?cttatgtcta?aaggtgaaga?at 42
<210>10
<211>40
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>10
gacgtcgacg?ctcccaagct?tttatttgta?caattcatcc 40
<210>11
<211>39
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>11
agaagatctt?cgactagttt?tttgtagaaa?tgtcttggt 39
<210>12
<211>34
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>12
ttagcggccg?caatagttgt?tcaattgatt?gaaa 34
<210>13
<211>22
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>13
tttcaatcaa?ttgaacaact?at 22
<210>14
<211>21
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>14
gcaaatggca?ttctgacatc?c 21
<210>15
<211>717
<212>DNA
< 213>artificial sequence
<400>15
atgtctaaag?gtgaagaatt?attcactggt?gttgtcccaa?ttttggttga?attagatggt 60
gatgttaatg?gtcacaaatt?ttctgtctcc?ggtgaaggtg?aaggtgatgc?tacttacggt 120
aaattgacct?taaaatttat?ttgtactact?ggtaaattgc?cagttccatg?gccaacctta 180
gtcactactt?tcggttatgg?tgttcaatgt?tttgcgagat?acccagatca?tatgaaacaa 240
catgactttt?tcaagtctgc?catgccagaa?ggttatgttc?aagaaagaac?tatttttttc 300
aaagatgacg?gtaactacaa?gaccagagct?gaagtcaagt?ttgaaggtga?taccttagtt 360
aatagaatcg?aattaaaagg?tattgatttt?aaagaagatg?gtaacatttt?aggtcacaaa 420
ttggaataca?actataactc?tcacaatgtt?tacatcatgg?ctgacaaaca?aaagaatggt 480
atcaaagtta?acttcaaaat?tagacacaac?attgaagatg?gttctgttca?attagctgac 540
cattatcaac?aaaatactcc?aattggtgat?ggtccagtct?tgttaccaga?caaccattac 600
ttatccactc?aatctgcctt?atccaaagat?ccaaacgaaa?agagagacca?catggtcttg 660
ttagaatttg?ttactgctgc?tggtattacc?catggtatgg?atgaattgta?caaataa 717
Claims (7)
1. mutant GAP promoter library; It is characterized in that described promoter library is made up of the promotor of nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and the SEQ ID NO:7.
2. promoter library as claimed in claim 1; It is characterized in that the promotor of nucleotide sequence has the intensity of the startup destination gene expression that weakens successively shown in described SEQ ID NO:1, SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and the SEQ ID NO:7.
3. promoter library as claimed in claim 1 is characterized in that, the promotor of nucleotide sequence is an enhancement type GAP promotor with respect to wild-type GAP promotor shown in the described SEQ ID NO:1; The promotor of nucleotide sequence shown in described SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 is a reduction type GAP promotor with respect to wild-type GAP promotor.
4. carrier; It is characterized in that; Described carrier contains the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7, as promoter element.
5. a genetically engineered host cell is characterized in that, described cell:
Contain the described carrier of claim 4; Or
Be integrated with the nucleic acid of the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 in its genome.
6. host cell as claimed in claim 5 is characterized in that, described cell is pichia spp (Pichia Pastoris) cell.
7. the purposes of the described mutant GAP promoter library of claim 1 is characterized in that, is used to provide mutant GAP promotor, and said mutant GAP promotor operability ground is connected with goal gene, regulates the expression of goal gene.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100531989A CN101922047B (en) | 2009-06-17 | 2009-06-17 | Gap promoter library and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100531989A CN101922047B (en) | 2009-06-17 | 2009-06-17 | Gap promoter library and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101922047A CN101922047A (en) | 2010-12-22 |
CN101922047B true CN101922047B (en) | 2012-12-26 |
Family
ID=43337246
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100531989A Expired - Fee Related CN101922047B (en) | 2009-06-17 | 2009-06-17 | Gap promoter library and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101922047B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102559726B (en) * | 2010-12-31 | 2013-10-09 | 华东理工大学 | Application of GAP (GTPase-Activating Protein) promoter library in regulation of metabolic pathway of S-adenosylmethionine |
CN106520905A (en) * | 2016-12-15 | 2017-03-22 | 天津大学 | Method for screening environmental stress response promoters |
CN114774461B (en) * | 2022-04-06 | 2023-05-26 | 暨南大学 | Application of Ash1p as negative regulatory factor in improving protein expression in host cell |
-
2009
- 2009-06-17 CN CN2009100531989A patent/CN101922047B/en not_active Expired - Fee Related
Non-Patent Citations (2)
Title |
---|
Franz S. Hartner et al.promoter library designed for fine-tuned gene expression in pichia pastoris.《nucleic acids research》.2008,第36卷(第12期), * |
Marjan De Mey et al.construction and model-based analysis of a promoter library for E. coli: an indispensable rool for metabolic engineering.《BMC biotechnology》.2007,第7卷 * |
Also Published As
Publication number | Publication date |
---|---|
CN101922047A (en) | 2010-12-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Rambosek et al. | Recombinant DNA in filamentous fungi: progress and prospects | |
CN105695485A (en) | Cas9 encoding gene used for mycelial fungus Crispr-Cas system, and application thereof | |
Furukawa et al. | Isolation and functional analysis of a gene, tcsB, encoding a transmembrane hybrid-type histidine kinase from Aspergillus nidulans | |
CN109477115A (en) | For Eukaryotic expression system | |
Gjermansen et al. | Towards diacetyl‐less brewers' yeast. Influence of ilv2 and ilv5 mutations | |
Rubio‐Texeira et al. | Highly efficient assimilation of lactose by a metabolically engineered strain of Saccharomyces cerevisiae | |
CN1938426A (en) | Generation of recombinant genes in saccharomyces cerevisiae | |
CN101922047B (en) | Gap promoter library and application thereof | |
Florea et al. | Elimination of marker genes from transformed filamentous fungi by unselected transient transfection with a Cre-expressing plasmid | |
CN110804561A (en) | Saccharomyces cerevisiae with high yield of C6-C10 ethyl ester and construction method and application thereof | |
CN104403957B (en) | Low protease A excretion yeast strain and its construction method under a kind of stress conditions | |
CN105349441B (en) | High sporogenic Trichoderma T23-Ovel1 bacterial strain and its construction method | |
CN102086455B (en) | Flocculation gene of flocculating yeast and expression product and application thereof | |
CN102226154B (en) | Hansenula polymorpha with double screening marker and application thereof | |
CN111621854A (en) | Trc promoter mutation library and application thereof | |
CN105274135A (en) | RNAi vector widely used for multi-plant gene silencing and application | |
CN107177622B (en) | A kind of Agrobacterium tumefaciens mediated Italian mould genetic transforming method | |
CN103917648B (en) | For being converted and select box and the method for Yeast transformants by homologous recombination | |
CN102884187B (en) | Comprise the nucleic acid construct of pyridine Nan Ping biological synthesis gene cluster and marker gene | |
CN101225402B (en) | Pichia yeast genetic engineering bacteria for producing glutathione and recombinant plasmid used for constructing the same | |
CN107723253A (en) | A kind of double-mass model cotransformation foreign gene cance high-expression gene engineering bacteria | |
CN102146346B (en) | Saccharomyces cerevisiae and constructing method and application of saccharomyces cerevisiae | |
CN112481265A (en) | Bacillus subtilis artificial terminator and application thereof | |
CN111269301A (en) | Banana transcription factors MaARF12 and MaARF24 and application thereof in inhibiting expression of MaSBE2.3 | |
CN112831517B (en) | Lycopene gene-mediated modification cloning vector and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121226 Termination date: 20150617 |
|
EXPY | Termination of patent right or utility model |