CN101922047A - Gap promoter library and application thereof - Google Patents

Abstract

The invention relates to a GAP promoter library and application thereof. The invention discloses a nucleic acid sequence of each promoter in the GAP promoter library, a vector and a host cell which contain the nucleic acid sequence. The invention also discloses a method for screening a required mutation promoter. The invention establishes an effective screening model, obtains the mutation GAP promoter library with strength of graded distribution, and can realize continuous fine adjustment on expression of a target gene.

Description

GAP promoter library and uses thereof

Technical field

The invention belongs to biological technical field; More specifically, the present invention relates to be used for the GAP promoter library of pichia spp.

Background technology

The metabolic engineering (Metabolic Engineering) of optimizing the cellular metabolism network by genetic manipulation is becoming a very important forward position of biological chemical field research direction.But, in the face of in the microorganism cells by gene, albumen, metabolite, various signaling molecule and the complex dynamic network that interacts and forms between them, the analysis of metabolic process and regulation and control are complexity and difficult very.Have only by genetic expression being carried out accurate fine setting and study the influence of its pair cell phenotype and metabolism stream, could therefrom parse the metabolism node of crucial Gong transformation.Therefore, accurate " amount of opening " formula gene fine setting is to carry out metabolic engineering to study very important advanced means, and it is conducted a research has important scientific meaning application space widely.

Promotor (Promoter) is the most frequently used element of gene expression regulation.But, no matter be composing type (Constitutive), or induction type (Inducible) promotor, all can't in the scope of a broad, carry out the successive regulation and control to genetic expression intensity.Although inducible promoter can be by induction time and the expression of regulatory gene to a certain extent of inductor concentration, but the essence of this adjusting is " switch " control still, the beginning of can only regulatory gene transcribing and stopping promptly to be regulated the length of the time of transcribing and the height of non-transcribed intensity.And the inductor concentration effect often just increases the cell count of genetic expression in the colony but not the expression level of each individual cells, the homogeneity that does not embody.In addition, consider from the angle of practical application in industry that because the price of inductor is generally more expensive, and cell has high susceptibility to inductor, its operability is not strong.Just because of these defectives, in the last few years software engineering researchers invent promoter library (Promoter Library) in order to as to the more flexible and accurate regulation and control instrument of genetic expression.

Promoter library is exactly that the promotor base sequence of regulating and control genetic transcription is suddenlyd change, by reporter gene (Reporter Gene, as green fluorescent protein GFP gene, galactosidase gene LacZ etc.) expression level, the manual activation subclass zoarium of a series of varying strengths of obtaining of screening.Because the base sequence of promotor directly influences the intensity that its regulatory gene is transcribed, so as long as constructed library comprises enough abundant mutant nucleotide sequence, the screening amount is enough big, just can therefrom filter out a series of sudden change promotors with different regulation and control intensity, formation can be implemented the library that " amount of opening " declines and transfer to its downstream gene.

Promoter library promptly is applied to the research of metabolic engineering after occurring, and has shown its strong functions in many-side.At first, promoter library has been realized genetic expression " amount of the opening " accent that declines, and significantly is better than utilizing " switch " formula regulation and control of single promotor.People such as Solem utilize promoter library, in Lactococcus lactis (Lactococculs latis), not only to glycolytic pathway pfk gene, also two other gene (pyk and Idh) that is positioned at same operon have been realized the expression regulation of strength increase.Secondly, promoter library can be used for metabolic analysis, makes people can locate metabolism control node more accurately.Keobmann etc. utilize promoter library regulation and control F in the research of intestinal bacteria glycolytic pathway ₁-ATP synthetic enzyme is expressed, and the hydrolysis that discovery improves the gentle ATP of ATP enzyme running water gradually can make the glycolysis-flux improve 70%, shows that the main regulation and control factor of glycolytic pathway is the ATP level, and the enzyme that is not each reaction of approach itself is lived.The 3rd, promoter library also can be used for seeking the restrictive factor of polygene regulation and control route of synthesis.Alper etc. research lycopene synthetic the time, discovery improves dxs gene (deoxy-xylulose-p synthase in wild bacterium, deoxidation-lyxulose phosphate synthetic enzyme) expression, can only improve the output of lycopene to a certain extent, and expressing in the reorganization bacterium of these two enzymes in route of synthesis downstream excessively, constantly strengthen dxs genetic expression lycopene output is improved constantly, illustrate that deoxidation-lyxulose phosphate synthetase activity is the restrictive factor of reorganization bacterium route of synthesis.The 4th, promoter library also can be used for determining the optimization gene regulating level of metabolism control.Nevoigt etc. find when analyzing glycerol 3-phosphate desaturase (GPDH) gene GPD1 to the influencing of yeast saccharomyces cerevisiae glycerine productive rate, when changing 2 times that are no more than its wild-type by the enzyme ratio of sudden change promotor control GPDH is alive, the biomass of thalline and glycerine productive rate all with the active positive correlation of GPDH, but crossing of multi-copy gene expressed, not only can not make the corresponding increase of glycerine productive rate, also cell growth produces and suppresses, and therefore can accurately finely tune gene expression dose to reach optimization control by the sudden change promoter library in Metabolically engineered.

As seen, by making up promoter library, will " amount of opening " decline and transfer genetic expression to become possibility, at metabolic analysis with in transforming, broken through originally can only and cross by gene knockout (Knock out) express (Over expression) two kinds non-" opening " promptly the means of " pass " realize the genotypic disturbance of pair cell (Perturbation), can be by analyzing and control its influence to phenotype and metabolism distributions to the accurate fine setting of target gene expression carrying out gradient type.In addition, also can develop into the different promoters that uses in the library, a plurality of expression of gene are regulated and control simultaneously the utilization of this instrument.Therefore, promoter library is becoming metabolic engineering research to systems analysis and the developing effective research tool of global optimization, will greatly promote the research level in this field.

Summary of the invention

The object of the present invention is to provide GAP promoter library that is used for pichia spp and uses thereof.

Another object of the present invention is to provide the screening mutant GAP method of promotor.

In a first aspect of the present invention, a kind of mutant GAP promoter library is provided, and described promoter library comprises the promotor of nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ IDNO:6 or the SEQ ID NO:7.

In a preference, the promotor of nucleotide sequence has the intensity of the startup destination gene expression that weakens successively shown in described SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ IDNO:4, SEQ ID NO:5, SEQ ID NO:6 and the SEQ ID NO:7.

In another preference, the promotor of nucleotide sequence is an enhancement type GAP promotor with respect to wild-type GAP promotor shown in the described SEQ ID NO:1; The promotor of nucleotide sequence shown in described SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 is a reduction type GAP promotor with respect to wild-type GAP promotor.

In a second aspect of the present invention, a kind of carrier is provided, described carrier contains the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7, as promoter element.

In a preference, described carrier also contains the goal gene that is operably connected with described promoter element.

In another preference, described goal gene includes, but is not limited to: proteic gene, reporter gene (as green fluorescent protein, luciferase gene or galactosidase gene LacZ) that structure gene, coding have specific function.

In another preference, described goal gene is positioned at the downstream of promoter element, and with the interval of described promotor less than 2000bp; Preferable less than 1000bp; More preferably less than 500bp, as less than 200bp, less than 100bp, less than 50bp.

In a third aspect of the present invention, provide a kind of genetically engineered host cell, described cell:

Contain described carrier; Or

Be integrated with the nucleic acid of the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 in its genome.

In a preference, described cell is pichia spp (Pichia Pastoris) cell.

In a fourth aspect of the present invention, the purposes of described mutant GAP promoter library is provided, be used to provide mutant GAP promotor, described mutant GAP promotor operability ground is connected with goal gene, regulate the expression of goal gene.

In a fifth aspect of the present invention, a kind of method of screening mutant GAP promotor is provided, described mutant GAP promotor changes (comprise strengthening and express or the reduction expression) with respect to the intensity of wild-type GAP promotor, startup destination gene expression, and described method comprises:

(1) provide recombinant expression vector 1, described recombinant expression vector 1 contains GAP promoter mutation body sequence, and the reporter gene sequence that links to each other with described GAP promoter mutation body series of operations; With this recombinant expression vector 1 transformed host cell, obtain recombinant host cell 1, with this recombinant host cell 1 of BMD culture medium culturing;

(2) provide recombinant expression vector 2, described recombinant expression vector 2 contains wild-type GAP promoter sequence, and the reporter gene sequence that links to each other with described wild-type GAP promoter sequence operability; With these recombinant expression vector 2 transformed host cells, obtain recombinant host cell 2, with this recombinant host cell 2 of BMD culture medium culturing;

(3) observe described recombinant host cell 1 and express the situation of reporter gene, if with respect to recombinant host cell 2, the expression intensity of recombinant host cell 1 reporter gene changes (preferably having the variation of statistical significance), and then the GAP promoter mutation body that recombinant expression vector 1 carries in this recombinant host cell 1 is required mutant GAP promotor.

In a preference, described host cell is pichia spp (Pichia Pastoris) cell.

In another preference, described reporter gene is selected from but is not limited to: green fluorescent protein (GFP), synergic green fluorescent protein (EGFP) or galactosidase gene LacZ.

In another preference, the culture condition of described recombinant host cell 1 and recombinant host cell 2 is: 30 ± 2 ℃, and 200 ± 100rpm.

In another preference, the described recombinant host cell 1 of step (1) is identical with described recombinant host cell 2 culture condition of step (2).

In another preference, in the step (3), if with respect to recombinant host cell 2, the expression intensity of recombinant host cell 1 reporter gene takes place significantly to strengthen (as strengthening more than 10%, preferable enhancing is more than 20%, better enhancing is more than 30%), then the GAP promoter mutation body that recombinant expression vector 1 carries in this recombinant host cell 1 is an enhancement type GAP promotor with respect to wild-type GAP promotor.

In another preference, in the step (3), if with respect to recombinant host cell 2, significantly reduction takes place (as weakening more than 10% in the expression intensity of recombinant host cell 1 reporter gene, preferable reduction is more than 20%, better reduction is more than 30%), then the GAP promoter mutation body that recombinant expression vector 1 carries in this recombinant host cell 1 is a reduction type GAP promotor with respect to wild-type GAP promotor.

In another preference, in step (1) or (2), comprising with the method for BMD culture medium culturing recombinant host cell (recombinant host cell 1 or recombinant host cell 2):

(a) cultivated this recombinant host cell in advance 30-50 hour (more preferably 36-48 hour) with the BMD culture medium A; Wherein, glucose concn 0.2 ± 0.05% in the described BMD culture medium A;

(b) will transfer to BMD substratum B through pre-incubated recombinant host cell, cultivate 30-65 hour (preferably 36-48 hour); Wherein, glucose concn 1 ± 0.2% among the described BMD substratum B.

In another preference, described reporter gene is green fluorescent protein (GFP), and in the step (2), the method for observing the situation of described recombinant host cell expression reporter gene comprises: the fluorescence intensity of measuring the substratum that contains described recombinant host cell.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1, recombinant plasmid pGHg make up synoptic diagram.

Fig. 2, recombinant plasmid are identified.

A, recombinant plasmid pGAPZAgfp enzyme are cut with PCR and are verified.Swimming lane 1:Not I and the checking of SalI double digestion; Swimming lane 2: with primer GFP F and GFP R PCR checking; M:DNA marker.

B, recombinant plasmid pGAPg enzyme are cut checking.M:DNA Marker; Swimming lane 1:SpeI and the checking of Not I double digestion.

C, recombinant plasmid pGHg enzyme are cut with PCR and are verified.

M:DNA Marker; Swimming lane 1:SpeI and the checking of Not I double digestion; Swimming lane 2: with primer GAP primer and GFP R PCR checking.

Fig. 3, plasmid pGH collection of illustrative plates and structure synoptic diagram.

Fig. 4, recombinant plasmid pGH enzyme are cut with PCR and are verified.Swimming lane 1:PCR checking; Swimming lane 2: recombinant plasmid pGH cuts through the HindIII enzyme; M:DNA Marker.

Fig. 5, fluorescence microplate reader and and reorganization bacterium G/GHg expression GFP fluorescence intensity.

A, fluorescence microplate reader GFP fluorescence intensity.

B, cells were tested by flow cytometry GFP fluorescence intensity.1:G/GH; 2 and 3:G/GHg.

Different substratum BMD, BSM, BMDY, YPD are to the influence of reorganization bacteria growing in Fig. 6, the 48 hole depth orifice plates.

A, reorganization bacterium G/PHg are in 30 ℃, and 200rpm cultivates 60h, measures cell density OD ₆₀₀

B, reorganization bacterium G/GHg are in 30 ℃, and 200rpm cultivates 60h, measures cell density OD ₆₀₀

Fig. 7, different substratum are expressed influence to reorganization bacterium GFP.Flow cytometer detects reorganization bacterium G/PHg and through different substratum GFP is expressed influence with contrast bacterium G/PH.1.YPD cultivate contrast bacterium G/PH; 2.YPD cultivate G/PHg; 3.BMD cultivate G/PHg; 4.BSM cultivate G/PHg.

Fig. 8, screening model synoptic diagram.

The different vaccination amount is to reorganization bacterium G/PHg, G/GHg and the influence of contrast bacteria growing in Fig. 9, the pre-culture plate of 48 deep-well plates.

Different vaccination amount reorganization bacterium G/GHg growing state relatively in A, the pre-culture plate of 48 deep-well plates.Every hole dress BMD (0.2%) 900 μ L, 30 ℃, 200rpm cultivates 48h.GHg1: inoculum size 10 μ L; GHg2: inoculum size 20 μ L; GHg3: inoculum size 30 μ L.

Different vaccination amount reorganization bacterium G/PHg growing state relatively in B, the pre-culture plate of 48 deep-well plates.Every hole dress BMD (0.2%) 900 μ L, 30 ℃, 200rpm cultivates 48h.PHg1: inoculum size 10 μ L; PHg2: inoculum size 20 μ L; PHg3: inoculum size 30 μ L.

Different vaccination amount contrast bacteria growing situation relatively in C, the pre-culture plate of 48 deep-well plates.Every hole dress BMD (0.2%) 900 μ L, 30 ℃, 200rpm cultivates 48h.C1: inoculum size 10 μ L; C2: inoculum size 20 μ L; C3: inoculum size 30 μ L.

Figure 10, different vaccination time are adorned 900 μ L BMD (1%) substratum to reorganization bacterium G/PHg, G/GHg in the every hole of screen plate 48 hole depth orifice plate growth effect screen plate 48 deep-well plates, cultivate 24h, 36h, 48h in the pre-culture plate and inoculate 30 μ L respectively to the screening flat board, 30 ℃, 200rpm cultivates 60h and measures cell density OD ₆₀₀

Figure 11, be seeded to screen plate 48 hole depth orifice plate different vaccination amounts to reorganization bacteria growing influence from pre-culture plate.

Figure 12, reorganization bacterium G/G ^LstHgfp, G/G ^2ndHgfp, G/G ^3thThe HgfpPCR checking.

(A) swimming lane 1-10:G/G ^1stHgfp; Swimming lane 11-17:G/G ^2ndHgfp; M:DNA Marker.

(B) swimming lane 1-10:G/G ^3thHgfp; Swimming lane 11-13:G/G ^2ndHgfp; M:DNA Marker.

The expression of Figure 13, pGAP sudden change library regulation and control green fluorescent protein in recombinant yeast pichia pastoris shown test tube cultivation flow cytometer detected result.

Figure 14, the comparison of G1-G7 sequencing result.

Embodiment

The inventor has made up a mutant GAP promoter library based on the GAP promotor by extensive and deep research, and this library comprises one group of isolating promotor, and the intensity that each promotor starts destination gene expression presents Gradient distribution.Promoter library of the present invention can be realized the continuous fine adjustment to destination gene expression.Finished the present invention on this basis.

Term

As used herein, described " promotor " is meant a kind of nucleotide sequence, and the upstream (5 ' end) that it is present in the goal gene encoding sequence usually can be transcribed into mRNA by the guiding nucleus acid sequence.Usually, promotor provides RNA polymerase and correct initial recognition site of transcribing necessary other factor.

As used herein, described " GAP promoter library " is meant and contains the nucleic acid aggregate that the present invention screens a series of mutant GAP promotors that obtain.

As used herein, described " GAP promotor " abbreviates pGAP or P as _GAP

As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, described " being operably connected " or " operability links to each other " is meant functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promotor is placed in the specific position with respect to the goal gene nucleotide sequence, makes transcribing of nucleotide sequence be subjected to the guiding of this promotor, thereby promotor is " operably connected " on this nucleotide sequence.

As used herein, " goal gene " is meant and can instructs the gene of expressing by promotor of the present invention.The present invention has no particular limits suitable goal gene, for example includes but not limited to: proteic gene, enzyme, reporter gene (as green fluorescent protein, luciferase gene or galactosidase gene LacZ) that structure gene, coding have specific function.

As used herein, described " enhancement type GAP promotor " is meant with respect to its intensity that starts destination gene expression of wild-type GAP promotor (its sequence is shown in SEQ ID NO:8) and significantly strengthens, for example strengthen more than 10%, preferable enhancing is more than 20%, better enhancing is more than 30%, as strengthens more than 50%, strengthens more than 80% or strengthen more than 100%.Its intensity that starts destination gene expression can learn that the detection of expression amount is a technology well known to those skilled in the art by the gene expression amount of testing goal.

As used herein, described " reduction type GAP promotor " is meant with respect to its intensity that starts destination gene expression of wild-type GAP promotor and significantly weakens, for example weaken more than 10%, preferable reduction is more than 20%, better reduction is more than 30%, as weaken more than 50%, reduction is more than 80% or weaken more than 100%.

As used herein, " external source " or " allogenic " is meant from the relation between two of different sources or many nucleic acid or the protein sequence.For example, if the combination of promotor and target gene sequences is not naturally occurring usually, then promotor is an external source for this goal gene.Particular sequence is " external source " for cell or organism that it inserted.

Promoter library

In order to realize continuous fine adjustment to genetic expression, the inventor is through extensive studies, screened one group of mutant GAP promotor, the promotor that comprises nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7, constitute promoter library, the intensity that each promotor starts destination gene expression presents Gradient distribution, is used for instructing destination gene expression under varying strength.The acquisition of promoter library can guarantee that the destination gene expression of being regulated and control is carried out gradient to be regulated, and implements controlled gene disturbance and systems analysis.

Promotor of the present invention can be operatively connected on the goal gene, and this goal gene can be external source (allos) for promotor.Described goal gene can be any nucleotide sequence (as a kind of structural nucleotide sequence) usually, and described goal gene optimized encoding has the albumen of specific function, and for example some has the albumen of key property or function.

For example, when being used for the research of expression intensity, described goal gene includes but not limited to: green fluorescent protein, synergic green fluorescent protein, luciferase gene or galactosidase gene LacZ etc." green fluorescent protein " has endogenous fluorophor, is being subjected to UV-light or can efficiently launching apparent green glow when blue-light excited, and seeing that light is difficult for cancellation." synergic green fluorescent protein " is the albumen after green fluorescent protein is improved.The instrument that " luciferase " expresses situation as a kind of representational indicator can be indicated the expression conditions that is instructed by promotor well.

As optimal way of the present invention, can from promoter library of the present invention, select the promotor of varying strength, respectively they are operably connected with goal gene to be studied, or with goal gene and described promotor is exercisable connects in the suitable carriers, take suitable mode to import in the host cell, thereby obtain the wherein different a series of cells of destination gene expression amount.Can learn the function or the purposes of this goal gene by metabolism situation, phenotype variation, protein expression situation or the interaction situation of analyzing these cells, the variation of various signaling molecules etc.

As optimal way of the present invention, described goal gene can be a kind of for a certain cell the disappearance or the insufficient gene of expression amount, this goal gene can be operably connected with enhancing GAP promotor of the present invention, or with goal gene and promotor of the present invention is exercisable connects in the suitable carriers, take suitable mode to import in this cell, thereby express goal gene high-levelly.

Promotor of the present invention can also be operably connected on the target gene sequences that is modified, and this goal gene is external source (allos) with respect to promotor.Described goal gene can be modified and produce various desired characteristics.For example, goal gene can be modified increases contents of essential amino acids, improves the translation of aminoacid sequence, change the modification (as phosphorylation site) after translating, outside the translation product transporte to cells, improve proteic stability, insert or delete cell signal etc.

In addition, promotor and goal gene can be designed to reduce specific gene.This generally is to realize that by promotor is connected on the target gene sequences this sequence oppositely is directed with antisense.Those of ordinary skill in the art is familiar with this antisense technology.Any nucleotide sequence can be conditioned by this way.

Carrier and host cell

Any promotor and/or the target gene sequences that come from promoter library of the present invention can be comprised in the recombinant vectors.

As a kind of mode, described recombinant vectors comprises promotor of the present invention, comprises multiple clone site or at least one restriction enzyme site in the downstream of described promotor.When needs are expressed goal gene, goal gene is connected in the suitable multiple clone site or restriction enzyme site, thereby goal gene is operably connected with promotor.

As a kind of mode, described recombinant vectors comprises (from 5 ' to 3 ' direction): the promotor that the guiding goal gene is transcribed, and goal gene.If desired, described recombinant vectors can also comprise 3 ' transcription terminator, 3 ' polymerized nucleoside acidifying signal, other untranslated nucleotide sequence, transhipment and target nucleotide sequence, resistance selective marker, enhanser or operation.

The method that is used to prepare recombinant vectors is well-known to those skilled in the art.Term " expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, mammalian cell virus or other carriers.In a word, as long as it can duplicate in host and stablize, any plasmid and carrier all are can be adopted.Preferably, described expression vector is the expression vector that yeast cell is suitable for.

Method well-known to those having ordinary skill in the art can be used to make up the expression vector that contains promotor of the present invention and/or target gene sequences.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, as Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein (GFP) etc.

Except containing promotor of the present invention, also can contain one or more other promotors in the recombinant vectors.Described other promotor for example is: tissue-specific, composing type or induction type.

Comprise the above-mentioned suitable promotor and the carrier of goal gene, can be used to transform appropriate host cell, so that it can marking protein.

Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: yeast, intestinal bacteria, the histocyte of animal, vegetable cell etc.Persons skilled in the art all know how to select appropriate carriers and host cell.As optimal way of the present invention, described host cell is a yeast cell, and more preferably, described host cell is the pichia spp cell.

Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Another kind method is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.

Screening method

The present invention also provides a kind of method of screening mutant GAP promotor, described mutant GAP promotor is with respect to wild-type GAP promotor, the intensity that starts destination gene expression changes (comprise strengthening and express or the reduction expression), described method comprises: under same culture conditions, cultivate respectively by GAP promoter mutation body and start the host cell of destination gene expression and the host cell that starts destination gene expression by wild-type GAP promotor, the expression intensity (or expression amount) that compares goal gene in two kinds of cells, compare expression intensity generation noticeable change if GAP promoter mutation body starts destination gene expression with wild-type GAP promotor startup destination gene expression, then this GAP promoter mutation body is required mutant GAP promotor.

In the above-mentioned screening method, preferred host cell is a yeast cell, more preferably is the pichia spp cell.The condition of culturing yeast cell is that those skilled in the art are known, has no particular limits among the present invention; Preferably, the condition of culturing yeast cell is 30 ± 2 ℃, 200 ± 100rpm.

The inventor finds under study for action, although multiple substratum all can be used for the cultivation of host cell among the present invention (as yeast cell), utilizes different culture medium culturing host cells, and is influential for the susceptibility or the accuracy of follow-up screening.Therefore, the inventor finds finally that at contrasting in the multiple substratum and selecting the BMD substratum is suitable for screening method of the present invention most.The BMD substratum is the known substratum of those skilled in the art, and its prescription is as follows: YNB (yeast basis nitrogenous source) 26.8g/L, vitamin H 0.2g/L, glucose (Dextrose) 10g/L, 100mM phosphate buffered saline buffer (pH 6.0) preparation.

In the screening method of the present invention, at different screening stages, the inventor also regulates the concentration of glucose wherein.Therefore, as optimal way of the present invention, comprise with the method for BMD culture medium culturing recombinant host cell: (a) cultivated this recombinant host cell in advance 30-50 hour (more preferably 36-48 hour) with the BMD culture medium A; Wherein, glucose concn 0.2 ± 0.05% in the described BMD culture medium A; (b) will transfer to BMD substratum B through pre-incubated recombinant host cell, cultivate 30-65 hour (preferably 36-48 hour); Wherein, glucose concn 1 ± 0.2% among the described BMD substratum B.

The method of measuring the expression of reporter gene in the culture system is a technology well known to those skilled in the art, also can make adjustment according to the difference of reporter gene.As optimal way of the present invention, described reporter gene is green fluorescent protein (GFP), and the method for measuring this report expression of gene situation comprises: measure the fluorescence intensity in the culture system.

Major advantage of the present invention is:

(1) the present invention has obtained a series of promotors by a large amount of screenings, and the intensity that they start destination gene expression presents Gradient distribution, thereby has set up the GAP promoter library;

(2) the present invention is by making up promoter library, will " amount of opening " decline and transfer genetic expression to become possibility, at metabolic analysis with in transforming, broken through originally can only and cross by gene knockout express two kinds non-" opening " promptly the means of " pass " realize the genotypic disturbance of pair cell, can be by analyzing and control its influence to phenotype and metabolism distributions to the accurate fine setting of target gene expression carrying out gradient type.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The structure of embodiment 1, reorganization bacterium G/GHg

Utilize green fluorescent protein (GFP) as the GAP promotor intensity of reporter gene with its expression of description regulation and control.In order to make up the reporter gene expression carrier, the promotor of being convenient to suddenly change is inserted, at first utilize the expression of primary without the GAP promoter regulation reporter gene gfp of sudden change, make up GFP reporter gene expression carrier pGHg and corresponding reorganization bacterium G/GHg, and make up the carrier pGH that does not contain the GFP gene and recombinate bacterium G/GH in contrast, investigate the expression of GFP.

1, the structure of expression vector pGHg and evaluation

(1) structure of recombinant plasmid pGAPZAgfp and evaluation

With reference to Fig. 1, (SEQ ID NO:15) is template with the complete synthesis gfp gene of chemistry, with primer GFP F (AAT GCGGCCGCAAACCC AAGCTTATGTCTAAAGGTGAAGAAT (SEQ ID NO:9)) and GFP R (GAC GTCGACGCTCCC AAGCTTTTATTTG TACAATTCATCC (SEQ ID NO:10)) amplifying target genes gfp, through restriction enzyme Not I and SalI double digestion, plasmid pGAPZ A (contains wild-type GAP promotor; Available from Invitrogen company) cut with the quadrat method enzyme.The gfp fragment is connected acquisition recombinant plasmid pGAPZAgfp with vector plasmid pGAPZA behind double digestion.Recombinant plasmid pGAPZAgfp carries out PCR with primer GFP F and GFP R and identifies the about 750bp of purpose fragment gfp; Not I and SalI digestion with restriction enzyme are identified, downcut the about 750bp of purpose fragment gfp (as Fig. 2 A).

(2) structure of recombinant plasmid pGAPg and evaluation

Plasmid pGAPZ A is a template, positive-sense strand primer GAP F BSpe (AGA AGATCTTCG ACTAGTTTTTTGTAGAAATGTCTTGGT (SEQ ID NO:11)) and antisense strand primer GAP R Not (TTA GCGGCCGCAATAGTTGTTCAATTGATTGAAA (SEQ ID NO:12)), the GAP promoter fragment that amplification obtains is cut through BglII and NotI enzyme, connects the carrier pGAPZAgfp that cuts through with the quadrat method enzyme, obtains recombinant plasmid pGAPg.Recombinant plasmid pGAPg identifies with SpeI and Not I digestion with restriction enzyme, downcuts GAP promotor and carrier segments and is respectively 500bp and 3kb (as Fig. 2 B).

(3) structure of recombinant plasmid pGHg and evaluation

Plasmid pGAPg cuts through the BglII enzyme, and dephosphorylation.PAO815 plasmid (available from the Invitrogen company) fragment (HIS4 of 4.0kb and 3 ' AOX fragment) of cutting with restriction enzyme BglII and BamH I enzyme, this fragment with cut through the BglII enzyme and dephosphorization acid after plasmid pGAPg be connected, obtain plasmid pGHg, SpeI and Not I digestion with restriction enzyme are identified, downcut the about 500bp of purpose fragment; Identify the about 750bp of purpose fragment (as Fig. 2 C) with primer GAP primer (TTTCAATCAATTGAACAACTAT (SEQ ID NO:13)) and GFP R (GCAAATGGCATTCTGACATCC (SEQ ID NO:14)) PCR.

2, the structure of recombinant plasmid pGH and evaluation

Recombinant plasmid pGHg cuts through restriction enzyme HindIII enzyme, returns by the 6.8kb carrier segments through connecting acquisition plasmid pGH, plasmid construction synoptic diagram such as Fig. 3 certainly.Identify recombinant plasmid pGH with GAP promotor positive-sense strand primer GAP F BSpeI and 3 ' AOX primer PCR, the about 750bp of purpose fragment, restriction enzyme HindIII enzyme cut checking plasmid pGH, and linearization plasmid is about 6.8kb, as Fig. 4.

3, the structure of genetic engineering bacterium G/GHg and G/GH

Behind the recombinant plasmid pGHg and pGH usefulness Restriction Enzyme BspeI linearization for enzyme restriction that build, with ethanol sedimentation method deposit D NA, reclaim back electricity commentaries on classics pichia spp GS115 (available from Invitrogen company) respectively, coating MD flat board, be inverted for 30 ℃ and cultivated 3～5 days, occur up to mono-clonal.Adopt bacterium colony PCR to identify transformant.

10 genetic engineering bacterium G/GHg that select on the MD flat board are inoculated in the 3mL YPG substratum, and 30 ℃, 220rpm cultivates 16h, get 1mL bacterium liquid guarantor and plant 1mL bacterium liquid 5000rpm, centrifugal collection thalline, the deionization washing once with the resuspended thalline of 20% glycerine, is preserved so that the subsequent analysis of sample for-20 ℃.Remaining bacterium liquid is used to measure cell concentration (OD ₆₀₀).

(1) fluorescence microplate reader detects the GFP fluorescence intensity

Bacterium liquid is diluted to OD with PBS (pH7.0) ₆₀₀Be 1, dilution back sample is got 250 μ L to 96 orifice plates, uses fluorescence microplate reader to detect GFP fluorescence intensity (excitation wavelength: 488nm, emission wavelength: 505nm), and detect OD ₆₀₀When detecting the GFP fluorescence intensity, remove background interference in contrast with the genetic engineering bacterium G/GH that does not express GFP.The GFP of G/GH and G/GHg is respectively 2246.5 (RFU) and 2349.3 (RFU) than fluorescence intensity level, as Fig. 5 A, than fluorescence intensity F/OD ₆₀₀(RFU/OD ₆₀₀) be that fluorescence intensity level is than last corresponding cell density OD ₆₀₀

(2) cells were tested by flow cytometry GFP fluorescence intensity

Thalline is diluted to OD with PBS (pH7.0) ₆₀₀Be 0.2, then through cells were tested by flow cytometry cell GFP fluorescence intensity (same testing conditions under with genetic engineering bacterium G/GH as blank).Shown in Fig. 5 B, utilize flow cytometer can detect the characteristic fluorescence of GFP, the reorganization bacterium G/GHg of structure can utilize the expression of GAP promoter regulation reporter gene gfp, and the GFP that expresses has activity.As seen, can characterize its expression promoter intensity of regulation and control by the fluorescence intensity that detects GFP.

To sum up, the inventor has successfully made up expression vector pGHg, utilizes constitutive promoter GAP regulation and control reporter gene gfp to express, and make up do not contain the GFP gene carrier pGH in contrast.GFP expression vector pGHg changed among the pichia spp GS115 obtain G/GHg, detect GFP fluorescence by PCR, flow cytometer and fluorescence microplate reader, verified that the gfp gene has successfully been changed over to the reorganization bacterium and has been subjected to promotor GAP regulating and expressing to provide activated green fluorescent protein.With GS115 is the host, changes the control vector pGH that does not express gfp over to, and the bacterium G/GH that obtains recombinating by changing over to of PCR checking carrier pGH, obtains contrast reorganization bacterium G/GH.

The foundation of embodiment 2, screening model

1, screening culture medium determines

(1) different substratum influence the GFP fluoroscopic examination

With the negative contrast of PBS, investigate of the influence of different substratum to the GFP fluoroscopic examination.

Aseptic BMD, BMDY, YPD, BSM substratum (referring to the operational manual of Invitrogen company: A Manualof Methods for Expression of Recombinant Proteins in Pichia pastoris) and PBS respectively get 250 μ L and add in 96 orifice plates and measure fluorescence intensity (excitation wavelength: 488nm, emission wavelength: 505nm) through fluorescence microplate reader.Found that the BSM substratum disturbs minimum (BSM:537 (RFU) to fluorescent strength determining; PBS:460 (RFU)), secondly be BMD:616 (RFU).Aseptic culture medium BMDY and YPD are the strongest through the fluorescence microplate reader fluorescence intensity, are respectively: 47581 (RFU) and 46499 (RFU) exceed PBS and detect more than 100 times of fluorescence.

BMD, BMDY, YPD, BSM substratum and PBS prescription are as follows:

BMD (1% glucose): YNB 26.8g/L, vitamin H 0.2g/L, glucose (Dextrose) 10g/L, the preparation of 100mM potassium phosphate buffer, pH 6.0.

BMD (0.2% glucose): YNB 26.8g/L, vitamin H 0.2g/L, glucose (Dextrose) 2g/L, the preparation of 100mM potassium phosphate buffer, pH 6.0.

BMDY: peptone 20g/L, yeast extract 10g/L, YNB 26.8g/L, vitamin H 0.04g/L, glucose (Dextrose) 10g/L, the preparation of 100mM potassium phosphate buffer, pH 6.0.

YPD (1% glucose): peptone 20g/L, yeast extract 10g/L, glucose 10g/L.

BSM:(NH ₄) ₂SO ₄7.0g/L, CaSO ₄0.46g/L, K ₂SO ₄9.1g/L, MgSO ₄7H ₂O 7.5g/L, glucose (Dextrose) 10g/L, PTM ₁12mL/L.K with 0.2M ₂HPO ₄/ KH ₂PO ₄The damping fluid preparation, pH5.5.

PTM wherein ₁: CuSO ₄5H ₂O 6g/L, K1 0.08g/L, MnSO ₄H ₂O 3g/L, Na ₂MoO ₄2H ₂O0.2g/L, H ₃BO ₃0.02g/L, ZnSO ₄7H ₂O 20g/L, FeSO ₄7H ₂O 65g/L, CoCl ₂6H ₂O 0.5g/L, vitamin H 0.04g/L, H ₂SO ₄5mL/L.

PBS:pH7.0:NaCl 8g/L, KCl 0.2g/L, Na ₂HPO ₄1.42g/L, KH ₂PO ₄0.27g/L hydrochloric acid is transferred pH to 7.0.

(2) different substratum are to the influence of thalli growth

The inventor has examined or check four kinds of substratum BMD, BSM, BMDY, YPD (carbon source is 1% glucose) respectively to reorganization bacterium G/PHg and G/GHg growth effect.900 μ l substratum are adorned in the every hole of 48 hole depth orifice plates, and every kind of substratum is done three parallel multiple holes.48 hole depth orifice plates were cultivated 36 hours, got 30 μ L and were seeded to another the 48 hole depth orifice plate that contains corresponding substratum, and 30 ℃, 200rpm cultivates 60h, measures cell density OD ₆₀₀, result such as Fig. 6.As seen, no matter be G/PHg and G/GHg reorganization bacterium, YPD and BMDY are the most favourable to thalli growth in four kinds of substratum, OD behind the cultivation 60h ₆₀₀Reach about 17; Comparatively speaking, cell density OD behind BSM and the BMD cultivation 60h ₆₀₀Be respectively 12 and 9.

(3) different substratum are expressed influence to reorganization bacterium GFP

In view of BSM and BMD substratum disturb minimum (BSM:537 (RFU) to the GFP fluorescent strength determining; BMD:616 (RFU)), this experiment has mainly been examined or check BSM and BMD substratum (glucose content is 1%) GFP has been expressed influence.900 μ L substratum are adorned in the every hole of 48 hole depth orifice plates, and every kind of substratum is done three parallel multiple holes respectively, and G/PHg, G/PH, G/GHg and G/GH cultivate 36h through 48 deep-well plates and inoculate 30 μ L respectively to another 48 deep-well plates that corresponding substratum is housed, 30 ℃, 200rpm cultivates 60h, measures cell density OD ₆₀₀, (excitation wavelength: 488nm, emission wavelength: 505nm), flow cytometer detects the GFP fluorescence intensity to measure fluorescence intensity through fluorescence microplate reader.

Relatively recombinate bacterium G/GHg and contrast bacterium G/GH respectively after BSM and BMD cultivate 60h GFP than fluorescence intensity (F/OD ₆₀₀), as seen: when with the BSM culture medium culturing, G/GHg is almost more consistent than fluorescence intensity with the GFP of contrast bacterium G/GH, can't distinguish; When with the BMD culture medium culturing, the GFP of G/GHg and contrast bacterium G/GH differs about 300 (RFU/OD than fluorescence intensity ₆₀₀), can distinguish substantially, the GFP of G/GHg is 2456 (RFU/OD than fluorescence intensity ₆₀₀), it is 2155 (RFU/OD that G/GH detects than fluorescence intensity ₆₀₀).

Relatively recombinate bacterium G/PHg and contrast bacterium G/PH respectively after BSM and BMD cultivate 60h than fluorescence intensity (F/OD ₆₀₀), as seen: no matter be with BSM substratum or BMD substratum, the GFP of G/PHg and contrast bacterium G/PH can significantly distinguish than fluorescence intensity is equal, when utilizing the BMD substratum, and G/PHg (8029 (RFU/OD ₆₀₀)) detected than fluorescence intensity (2246 (RFU/OD with contrast bacterium G/PH ₆₀₀)) difference is more remarkable in 4500 (RFU/OD ₆₀₀); The less about 1500 (RFU/OD of both differences when comparatively speaking, using the BSM substratum ₆₀₀), the GFP of G/PHg is 3528 (RFU/OD than fluorescence intensity ₆₀₀), G/GH is detected to be 1982 (RFU/OD than fluorescence intensity ₆₀₀).Same, cultivate G/PHg and the contrast bacterium G/PH fluorescence intensity of 60h through BSM and BMD through the flow cytometer detection, the result is with consistent through the result that fluorescence microplate reader detects with 96 orifice plates, and it is the same to express the GFP effect with BMD substratum and use YPD substratum, as Fig. 7.

2, screening conditions determines

(1) protects kind of a plate and be inoculated into the influence of pre-cultivation (pre-culture) different vaccination amount cell growth

900 μ L BMD (0.2% glucose) are adorned in the pre-every hole of culture plate 48 hole depth orifice plates, get 10 μ L, 20 μ L, 30 μ L bacterium liquid to pre-culture plate from protecting kind of a plate (masterplate) respectively, 30 ℃, 200rpm, cultivate 48h, cell density OD is surveyed in every interval 12h (0h, 12h, 24h, 36h, 48h) sampling ₆₀₀, as Fig. 8.

The main examination of this experiment is seeded to screen plate 48 hole depth orifice plate different vaccination amounts to reorganization bacterium G/PHg, G/GHg and the influence of contrast bacteria growing from pre-cultivation.Experimental result shows: though initial inoculation amount difference (10 μ L～30 μ L), but the growth of reorganization bacterium is not had influence.To reorganization bacterium G/PHg, G/GHg and contrast bacterium, growth curve trend was consistent as Fig. 9 A-C when the initial inoculation amount was 10 μ L, 20 μ L or 30 μ L.As can be seen from Figure 9, no matter inoculate what are, different reorganization bacterium all transits to the stage of stable development from logarithmic phase after cultivating 24h, and the 48h cell stops growing, though to the 48h cell density downtrending is arranged a little, cell density OD ₆₀₀Finally maintain same level (OD ₆₀₀=3.5～4.0).So, the initial inoculation weight range 10 μ L～30 μ L all can, consider convenient experimental operation (volley of rifle fire minimum range is 30 μ L), it is 30 μ L that inoculum size is adopted in follow-up experiment.

(2) the pre-cultivation is seeded to the influence of screen plate different vaccination time cell growth

900 μ L BMD (1% glucose) are adorned in the every hole of screen plate 48 hole depth orifice plates, respectively with cultivate 24h, 36h in the pre-culture plate, 48h bacterium liquid is got 30 μ L bacterium liquid to screen plate, 30 ℃, 200rpm, cultivate 60h, cell density OD is surveyed in every interval 12h (0h, 12h, 24h, 36h, 48h, 60h) sampling ₆₀₀

The main examination of this experiment is seeded to the 48 hole depth orifice plate different vaccination times of screen plate to reorganization bacterium G/PHg, G/GHg growth effect from pre-culture plate.Experimental result shows: pre-culture plate is cultivated 24h, 36h, 48h inoculates 30 μ L respectively to screen plate, even the inoculation time difference but to the growth did not influence of reorganization bacterium, is cultivated the mycetocyte density OD that respectively recombinates behind the 60h through screen plate ₆₀₀Finally reach same level (OD ₆₀₀=8.3～8.5).As seen, inoculation time does not have influence in 24h～48h scope to the reorganization bacteria growing, but considers that pre-culture plate cultivation 48h has just reached the stage of stable development and OD ₆₀₀Finally maintain same level (OD ₆₀₀=3.5～4.0) (as Figure 10), thus 36h for to be seeded to screen plate 48 deep-well plates optimum time points from pre-culture plate, follow-up experiment adopts inoculation time to be 36h.

(3) pre-culture plate is seeded to the influence of screen plate different vaccination amount cell growth

900 μ L BMD1% are adorned in the every hole of screen plate 48 hole depth orifice plates, respectively pre-culture plate is cultivated 36h bacterium liquid and got 10 μ L, 20 μ L, 30 μ L, 50 μ L bacterium liquid to screen plate, 30 ℃, 200rpm, cultivate 60h, cell density OD is surveyed in every interval 12h (0h, 12h, 24h, 36h, 48h, 60h) sampling ₆₀₀

Relatively be seeded to screen plate 48 hole depth orifice plate different vaccination amounts to reorganization bacterium G/PHg, G/GHg and the influence of contrast bacteria growing from pre-culture plate, experimental result shows: pre-culture plate is cultivated 36h and is inoculated 10 μ L, 20 μ L, 30 μ L respectively to screen plate, though inoculum size difference but growth curve and no significant difference, cultivate 24h through screen plate and all carry out the transition to the stage of stable development for a long time, the 36h mycetocyte density OD that respectively recombinates behind the 60h from logarithm ₆₀₀All the time maintain about 8; When inoculum size is increased to 50 μ L, the stage of stable development, after this OD have just been reached in the 12h ₆₀₀Maintain 9 (as Figure 11).So, be seeded to screen plate 48 deep-well plates inoculum size scopes at 10～30 μ L from pre-culture plate, to the growth did not influence of reorganization bacterium, factor and consider convenient experimental operation (use the volley of rifle fire minimum range be 30 μ L) to sum up, it is 30 μ L that inoculum size is adopted in follow-up experiment.

3, result and discussion

Utilize 48 hole depth orifice plates screening promoter library, at first examined or check four kinds of substratum BMD, BSM, BMDY, YPD to the influence of reorganization bacteria growing, experimental result shows that YPD and BMDY are the most favourable to thalli growth in four kinds of substratum, OD behind the cultivation 60h ₆₀₀Reach about 17; Comparatively speaking, utilize BSM and BMD substratum 60h after, cell density OD ₆₀₀Lessly be respectively 12 and 9.After through the screening of 48 hole depth orifice plates, must be with the corresponding one by one dilution (OD of sample in the deep-well plates ₆₀₀Be 0.2-1) and be transferred to 96 orifice plates, so that the mensuration of reporter protein fluorescence intensity and cell density, so cell density is too high and be unfavorable for follow-up experimental implementation (OD ₆₀₀Detect with fluorescence intensity), utilize BSM and BMD to cultivate 60h after, OD ₆₀₀Scope all in 10, only needs 10 times of OD of diluted sample ₆₀₀=0.2-1 is convenient to detect, so BMD and BSM are applicable to the screening of 48 hole depth orifice plates in four kinds of substratum.

When detecting four kinds of substratum BMD, BSM, BMDY, YPD, find that the BSM substratum disturbs minimum (BSM:537 (RFU) to fluorescent strength determining to GFP fluorescence intensity detection interference; PBS:460 (RFU)), secondly be BMD:616 (RFU).Aseptic culture medium BMDY and YPD are the strongest through the fluorescence microplate reader fluorescence intensity to be 100 times of PBS (460/RFU).Therefore substratum BMD and BSM help reporter protein GFP fluorescent strength determining, and BMDY and YPD are too big for the interference that detects, and are unsuitable for 48 hole depth orifice plate screening culture medium.

In view of BSM and BMD substratum disturb minimum to the GFP fluorescent strength determining and utilize these two kinds of substratum cell densities to be unlikely to too high, mainly examined or check these two kinds of substratum subsequently reorganization bacterium GFP has been expressed influence, experimental result shows: consistent with BMD with YPD substratum reorganization bacterium expression GFP level, and obviously be weaker than the former with the level of BSM reorganization bacterium expression GFP.Therefore, utilize 48 hole depth orifice plates screening promoter library, optimum medium is BMD.

Prove by experiment: express the reorganization bacterium of GFP, work as OD ₆₀₀In the 0.2-1 scope, its GFP fluorescence intensity and cell density OD ₆₀₀Linear; It is irrelevant not express GFP contrast detected fluorescence intensity of bacterium and cell density; Can be by calculating than fluorescence intensity, the reorganization bacterium of GFP and the difference of the GFP fluorescence intensity of contrast bacterium are expressed in assessment, thus assessment reorganization bacterium regulation and control GFP expression promoter intensity.

Utilize 48 hole depth orifice plates as follows as the screening implement operating process of promoter library:

(1) the single bacterium colony that at first will coat the mutant bacteria on the MD screening flat board is cultured to the about 3mm size of diameter.

(2) protect kind of a plate

600 μ L YPD are adorned in every hole in the 48 hole depth orifice plates, the single bacterium colony of diameter 3mm is to orifice plate on the picking MD flat board, the corresponding hole of single bacterium colony, 30 ℃, 200rpm, cultivate 24h, every then hole adds 60% glycerine, 300 μ L, 30 ℃, 200rpm, cultivate 30min, be prepared into the master plate of glycerine preservation, at last master-plate is placed-80 to preserve so that follow-up experiment is used.

(3) the pre-cultivation

900 μ L BMD (0.2% glucose) are adorned in the pre-every hole of culture plate 48 hole depth orifice plates, get bacterium liquid 30 μ L that master-plate cultivates 24h to the orifice plate of corresponding pre-culture plate, 30 ℃, 200rpm, cultivate 36h, cell density basically identical (OD between each hole in pre-each deep hole of culture plate ₆₀₀Homogeneity).

(4) screening

900 μ L BMD (1% glucose) are adorned in the every hole of screen plate 48 hole depth orifice plates, get 30 μ L bacterium liquid to screen plate from the hole of pre-culture plate, and 30 ℃, 200rpm cultivates 36h, utilizes screen plate to filter out the reconstitution cell with different promoters intensity.

The structure in embodiment 3, GAP promoter mutation library

In order to make up promoter library, obtain the sudden change promotor that promotor strength range broad and promotor intensity become graded, must obtain having the promotor of abundant sudden change and the method for quick effectively screening mutant.Fallibility PCR (EP-PCR) is a kind of easy method of making sudden change apace in dna sequence dna at random.Its ultimate principle is (as dNTP and Mg by some component concentrations in the change conventional P CR reaction system ²⁺Concentration), make base to a certain extent random error introduce and create the diversity of sequence.The key of fallibility PCR is to select suitable mutation frequency, and the frequency of general useful sudden change is very low, and most sudden changes are deleterious or neutral.When mutation frequency is too high, almost can't screen useful sudden change; When mutation frequency is too low, the wild-type that any sudden change does not then take place will be preponderated in mutagenized populations, also be difficult to screen the ideal mutant.When having 1.5～5 base generation bases to replace in the general 1kb target gene, the result is the most desirable in mutagenesis.So the inventor's top priority is to determine the EP-PCR reaction conditions of mutation frequency in 1%～5% (GAP is 500bp, and by 1%～5% calculating, the base mutation number is 5～25) scope.In order effectively to screen effective mutant fast, with the expression of sudden change promoter regulation reporter gene gfp, make up mutation expression carrier and corresponding reorganization bacterium, the bacterium of will recombinating places 48 deep-well plates to cultivate, and utilizes fluorescence microplate reader to carry out high-flux fast screening.

1, the sudden change of GAP promotor

Studies show that much the mutation rate of fallibility PCR is subjected to the influence of Taq enzyme fidelity.Add Mn ²⁺After, Taq enzyme fidelity is along with Mg in the reaction system ²⁺Concentration increase and reduce.The matched proportion density of different dNTP also influences Taq enzyme fidelity.Wherein, Mn ²⁺The common 0.5mM of concentration, and Mg ²⁺Concentration along with requirement difference to mutation rate, have different concentration, be generally 2～10mM.In order to optimize the reaction conditions of fallibility PCR, to reach the mutation rate (1%～5%) that needs, the inventor is with different Mg ²⁺Concentration: 4mM, 6mM, 8mM and 10mM have carried out fallibility PCR reaction, each Mg respectively ²⁺Concentration is respectively selected ten mutant clon order-checkings and is added up its mutation rate.Mg ²⁺The mutation rate that ionic concn is produced when being 4mM is low has only 0.7%, and Mg ²⁺The mutation rate that ionic concn produces during for 10mM is 1.5% more moderately can satisfy requirement of experiment.Reach 4.1% through three-wheel EP-PCR mutation rate.The Mg of 4mM, 6mM, 8mM and 10mM ²⁺Concentration fallibility PCR reaction mutation rate is respectively 0.3%, 0.7%, 0.8%, 1.5%.

In order to increase the mutation rate of fallibility PCR, the inventor has carried out second and the fallibility PCR of third round again on the basis of first round fallibility PCR.Consider the mutation rate that experiment hope reaches, in the experiment, the Mn of EP-PCR reaction system ²⁺, dATP, dGTP, dCTP, constant 0.5mM, 0.2mM, 0.2mM, 1mM, the 1mM of being respectively of dTTP concentration fixed.Every Mg that takes turns fallibility PCR ²⁺Ionic concn all is decided to be 10mM.Second and the template of third round EP-PCR be respectively the recovery product that first round EP-PCR and second takes turns EP-PCR.Through three-wheel EP-PCR, mutation rate can reach 3%-4.1%.

2, the structure in GAP promoter mutation library

(1) structure of recombinant yeast pichia pastoris cell bank

The promotor GAP of sudden change uses restriction enzyme SpeI and Not I double digestion respectively, with this fragment with equally behind SpeI and Not I double digestion carrier pGHg be connected respectively, transform DH5 α, obtain to mix and clone D/G ^1stHg, D/G ^2ndHg and D/G ^3rdHg.The final reorganization mixing plasmid pG that obtains ^1stHg, pG ^2ndHg and pG ^3rdHg.Reorganization mixes plasmid and uses Restriction Enzyme BspeI linearization for enzyme restriction respectively, and electricity changes pichia spp GS115, obtains transformant G/G ^1stHg, G/G ^2ndHg and G/G ^3rdHg.Transform back coating MD flat board, be inverted for 30 ℃ and cultivated 3～5 days, occur up to mono-clonal.Adopt bacterium colony PCR to identify transformant, the PCR the primer is respectively GAP primer and gfp R.The theoretical size of positive colony PCR band about 800bp (as Figure 12).All positive reorganization bacterium are built into pichia spp GAP sudden change promotor cell bank.

(2) sudden change promoter library screening

Utilize the screening implement of 48 hole depth orifice plates, filter out reconstitution cell with different promoters intensity according to the operating process of Fig. 8 as promoter library.Utilize 7 48 deep-well plates to have screened 300 sudden change promotor reconstitution cells, obtained the P that intensity becomes Gradient distribution _GAPThe sudden change library, table 1 is regulated and control the expression intensity of green fluorescent protein in recombinant yeast pichia pastoris through the fluorescence microplate reader detected result for promoter library.And 7 sudden change promotors in the promoter library that will suddenly change are cloned into the order-checking of T carrier through PCR.Sequencing result such as Figure 14 suddenly change 7 sudden change promotors in the promoter library (G1, G2, G3, G4, G5, G6, G7) polynucleotide sequence all there are differences, and can reach a conclusion, the difference of sudden change promotor intensity is because the sudden change of pGAP sequence causes really in the library.

Table 1, pGAP sudden change library regulation and control green fluorescent protein are expressed in recombinant yeast pichia pastoris

With G1, G2, G3, G4, G5, G6 and G7 cell cultivate with test tube after flow cytometer detects the GFP fluorescence intensity, as Figure 13, its result is consistent with the fluorescence microplate reader detected result, as seen 48 deep-well plates, 900 μ L can be amplified to test tube 3mL, has proved that again the difference of sudden change promotor intensity is because the sudden change of pGAP sequence causes really in the library.The acquisition of promoter library can guarantee that institute's regulate gene expression is carried out gradient to be regulated, and implements controlled gene disturbance and systems analysis.

(3) sudden change promoter sequence analysis

By to the sudden change promoter library in G1 (SEQ ID NO:1), G2 (SEQ ID NO:2), G3 (SEQ ID NO:3), G4 (SEQ ID NO:4), G5 (SEQ ID NO:5), the sequential analysis of G6 (SEQ ID NO:6) and G7 (SEQIDNO:7), see Figure 14, the base distribution of finding these 7 sudden change promoter mutations is average, and mutation rate is respectively: 3.35%, 2.31%, 1.89%, 2.73%, 1.26%, 2.10% and 2.52%.Therefore, the sudden change of promotor is abundanter in the constructed sudden change promoter library.

To sum up, by adjusting Mg in the EP-PCR reaction system ²⁺Concentration has obtained moderate EP-PCR mutation rate, works as Mg ²⁺When concentration was 10mM, the EP-PCR mutation rate reached 1.3%.Through three-wheel EP-PCR, the mutation rate of base is in the 1.3%-4% scope.

Present embodiment has been finished the structure and the screening of GAP promoter library, by detection to reorganization cell expressing GFP albumen fluorescence, obtain the promotor that a series of intensity gradients change, also screened the promotor strength ratio slightly high muton of promotor GAP intensity that do not suddenly change.According to The selection result, the back promotor of will suddenling change checks order through the PCR clone from reconstitution cell, analyzes its mutation rate and position, finds that the base of sudden change is all different.Experimental result shows: 7 sudden change promotor polynucleotide sequences in the sudden change promoter library all there are differences, and can reach a conclusion, and the difference of sudden change promotor intensity is because the sudden change of pGAP sequence causes really in the library; Detect through fluorescence microplate reader and flow cytometer, pGAP sudden change library regulation and control green fluorescent protein expression amount in recombinant yeast pichia pastoris seemingly changes in gradient.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉East China University of Science

＜120〉GAP promoter library and uses thereof

<130>092605

<160>15

<170>PatentIn?version?3.3

<210>1

<211>477

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉mutant GAP promotor

<400>1

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccgtctctg?aaatatctgg 60

ctccgttgca?actccgaacg?acctgcaggc?aacgtaaaat?tctctggggt?aaaacctaaa 120

tgtggagtaa?tggaaccagg?aacgtctctt?cccttctctc?tccttccacc?gcccgttact 180

gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgtt 240

cttcccagca?ttacgttgcg?ggtaatacgg?aggtcgagta?cccgacctag?cagcccaggg 300

atggaaaagt?cccagccgtc?gctggcaata?atagcgggcg?gacgcatgcc?atgagtttat 360

tggagaccac?cagaatcgaa?tataaaaggc?gaacaccttt?cccaatgttg?gtttctcctg 420

acccaaagac?tttaaatcta?atttatctgt?ccctatttca?atcaattgaa?caactat 477

<210>2

<211>477

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉mutant GAP promotor

<400>2

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60

ctccgttgca?actcagaaca?acctgctggc?tacgtaaaat?tctccggggt?aaaacttaaa 120

tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgctacc 180

gtccctagga?aattttactc?tgctggagag?ctccttctac?tgcccccttg?cagcaatgct 240

cttcccagca?ttacgatgcg?ggtaaagcgg?aggtcgtgta?cccgacctag?cagcccaggg 300

atggaaaagt?cccggccgtc?gctggcaata?gtagcgggcg?gacgcatgtc?atgagattat 360

tggaaaccac?caggatcgaa?tataaaaggc?gaacaccttt?cccaattttg?gtttctcctg 420

acccaaagac?tttaaattta?atttatttgt?ccctgtttca?atcaattgaa?caactat 477

<210>3

<211>477

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉mutant GAP promotor

<400>3

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccgtctctg?aaatatctgg 60

ctccgttgca?actccgaacg?acctgctggc?aacgtaaaat?tctccggggt?aaaacttaaa 120

tgtggggtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccact?gcccgttacc 180

gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?ctgcaacgct 240

cttccaagca?ttgcgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300

atggaaaagt?cccggccgac?gctggcaata?atagcgggcg?gacgcatgtc?atgagattat 360

tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccttt?cccgattttg?gtttctcctg 420

acccaaagac?tttaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477

<210>4

<211>477

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉mutant GAP promotor

<400>4

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60

ctccgttgca?actccgaacg?acctgctggc?aacgtaagat?actccgaggt?aaaacttaaa 120

tgtggagtaa?tggaaccaga?aacgtctctt?cctttctctc?tccttccacc?gcccgttacc 180

gtccctagga?agttttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgct 240

cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcttgta?cccgacctag?cagcccaggg 300

atggaaaagt?cccggccgtt?gctggcaata?atagcgggcg?gacgcatgtc?atgagattac 360

tggaaaccac?cagaatcgaa?cataaaaggc?gaacacctgt?cctaaattag?gtttctcctg 420

acccaaagac?tttaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477

<210>5

<211>477

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉mutant GAP promotor

<400>5

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60

ctccgttgca?actccgaacg?acctgcgggc?aacgtaaaat?tctccggggt?aaaacttaaa 120

tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180

gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgct 240

cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300

atggaatagt?cccggccgtc?gctggcaata?atagcgggcg?gacgcatgtc?atgagattac 360

tggaaaccac?ctgaatcgat?tataaaaggc?gaacaccttt?cccaattttg?gtttctcctg 420

acccaaagac?ttcaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477

<210>6

<211>477

<212>DNA

＜213〉artificial sequence

<221>misc-feature

＜223〉mutant GAP promoter sequence

<400>6

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60

ctccgttgca?actccgaacg?acctgctggc?aacgtaaaat?tctccggggt?aaaactttaa 120

tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180

gtccctagga?aattttactc?tgcgggagag?cttctcctac?ggcccccttg?cagcaatgct 240

ctccccagaa?ttacgtcgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300

atggaaaagt?cccggccgtc?gctggcaata?atagcgggcg?ggcgcatgtc?atgagactat 360

tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccttt?ccctattttg?gtttctcctg 420

acccaaagac?tttaaaatta?atttatttgt?ccctatttca?atcaattgaa?caactat 477

<210>7

<211>477

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉mutant GAP promoter sequence

<400>7

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60

ctccgttgca?actccgaacg?acctgctggc?aacgtagaat?tctccggggt?aaaacttaaa 120

tgtggagtaa?tggagccaga?gacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180

gtccctagga?aaatttactc?agctggagag?cttcttctac?ggcccccttg?cagcaatgct 240

cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300

gtggaaaagt?cccggccgtc?gctggcaata?ttagctggcg?gacgcatgtc?atgagactac 360

tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccatt?cccaattttg?gtttctcctg 420

acccaaagac?tttagattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477

<210>8

<211>477

<212>DNA

＜213〉pichia spp (Pichia Pastoris)

<400>8

tttttgtaga?aatgtcttgg?tgtcctcgtc?caatcaggta?gccatctctg?aaatatctgg 60

ctccgttgca?actccgaacg?acctgctggc?aacgtaaaat?tctccggggt?aaaacttaaa 120

tgtggagtaa?tggaaccaga?aacgtctctt?cccttctctc?tccttccacc?gcccgttacc 180

gtccctagga?aattttactc?tgctggagag?cttcttctac?ggcccccttg?cagcaatgct 240

cttcccagca?ttacgttgcg?ggtaaaacgg?aggtcgtgta?cccgacctag?cagcccaggg 300

atggaaaagt?cccggccgtc?gctggcaata?atagcgggcg?gacgcatgtc?atgagattat 360

tggaaaccac?cagaatcgaa?tataaaaggc?gaacaccttt?cccaattttg?gtttctcctg 420

acccaaagac?tttaaattta?atttatttgt?ccctatttca?atcaattgaa?caactat 477

<210>9

<211>42

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>9

aatgcggccg?caaacccaag?cttatgtcta?aaggtgaaga?at?42

<210>10

<211>40

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>10

gacgtcgacg?ctcccaagct?tttatttgta?caattcatcc 40

<210>11

<211>39

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>11

agaagatctt?cgactagttt?tttgtagaaa?tgtcttggt 39

<210>12

<211>34

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>12

ttagcggccg?caatagttgt?tcaattgatt?gaaa 34

<210>13

<211>22

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>13

tttcaatcaa?ttgaacaact?at 22

<210>14

<211>21

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>14

gcaaatggca?ttctgacatc?c 21

<210>15

<211>717

<212>DNA

＜213〉artificial sequence

<400>15

atgtctaaag?gtgaagaatt?attcactggt?gttgtcccaa?ttttggttga?attagatggt 60

gatgttaatg?gtcacaaatt?ttctgtctcc?ggtgaaggtg?aaggtgatgc?tacttacggt 120

aaattgacct?taaaatttat?ttgtactact?ggtaaattgc?cagttccatg?gccaacctta 180

gtcactactt?tcggttatgg?tgttcaatgt?tttgcgagat?acccagatca?tatgaaacaa 240

catgactttt?tcaagtctgc?catgccagaa?ggttatgttc?aagaaagaac?tatttttttc 300

aaagatgacg?gtaactacaa?gaccagagct?gaagtcaagt?ttgaaggtga?taccttagtt 360

aatagaatcg?aattaaaagg?tattgatttt?aaagaagatg?gtaacatttt?aggtcacaaa 420

ttggaataca?actataactc?tcacaatgtt?tacatcatgg?ctgacaaaca?aaagaatggt 480

atcaaagtta?acttcaaaat?tagacacaac?attgaagatg?gttctgttca?attagctgac 540

cattatcaac?aaaatactcc?aattggtgat?ggtccagtct?tgttaccaga?caaccattac 600

ttatccactc?aatctgcctt?atccaaagat?ccaaacgaaa?agagagacca?catggtcttg 660

ttagaatttg?ttactgctgc?tggtattacc?catggtatgg?atgaattgta?caaataa 717

Claims (10)

1. mutant GAP promoter library, it is characterized in that described promoter library comprises the promotor of nucleotide sequence shown in SEQ IDNO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7.

2. promoter library as claimed in claim 1, it is characterized in that the promotor of nucleotide sequence has the intensity of the startup destination gene expression that weakens successively shown in described SEQ ID NO:1, SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and the SEQ ID NO:7.

3. promoter library as claimed in claim 1 is characterized in that, the promotor of nucleotide sequence is an enhancement type GAP promotor with respect to wild-type GAP promotor shown in the described SEQ ID NO:1; The promotor of nucleotide sequence shown in described SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 is a reduction type GAP promotor with respect to wild-type GAP promotor.

4. carrier, it is characterized in that, described carrier contains the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7, as promoter element.

5. a genetically engineered host cell is characterized in that, described cell:

Contain the described carrier of claim 4; Or

Be integrated with the nucleic acid of the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or the SEQ ID NO:7 in its genome.

6. host cell as claimed in claim 5 is characterized in that, described cell is pichia spp (PichiaPastoris) cell.

7. the purposes of the described mutant GAP promoter library of claim 1 is characterized in that, is used to provide mutant GAP promotor, and described mutant GAP promotor operability ground is connected with goal gene, regulates the expression of goal gene.

8. method of screening mutant GAP promotor, described mutant GAP promotor changes with respect to wild-type GAP promotor, the intensity that starts destination gene expression, it is characterized in that described method comprises:

(1) provide recombinant expression vector 1, described recombinant expression vector 1 contains GAP promoter mutation body sequence, and the reporter gene sequence that links to each other with described GAP promoter mutation body series of operations; With this recombinant expression vector 1 transformed host cell, obtain recombinant host cell 1, with this recombinant host cell 1 of BMD culture medium culturing;

(2) provide recombinant expression vector 2, described recombinant expression vector 2 contains wild-type GAP promoter sequence, and the reporter gene sequence that links to each other with described wild-type GAP promoter sequence operability; With these recombinant expression vector 2 transformed host cells, obtain recombinant host cell 2, with this recombinant host cell 2 of BMD culture medium culturing;

(3) observe described recombinant host cell 1 and express the situation of reporter gene, if with respect to recombinant host cell 2, the expression intensity of recombinant host cell 1 reporter gene changes, and then the GAP promoter mutation body that recombinant expression vector 1 carries in this recombinant host cell 1 is required mutant GAP promotor.

9. method as claimed in claim 8 is characterized in that, in step (1) or (2), comprises with the method for BMD culture medium culturing recombinant host cell:

(a) cultivated this recombinant host cell in advance 30-50 hour with the BMD culture medium A; Wherein, glucose concn 0.2 ± 0.05% in the described BMD culture medium A;

(b) will transfer to BMD substratum B through pre-incubated recombinant host cell, cultivate 30-65 hour; Wherein, glucose concn 1 ± 0.2% among the described BMD substratum B.

10. method as claimed in claim 8, it is characterized in that, described reporter gene is a green fluorescent protein, and in the step (2), the method for observing the situation of described recombinant host cell expression reporter gene comprises: the fluorescence intensity of measuring the substratum that contains described recombinant host cell.

Images