CN114774461B

CN114774461B - Application of Ash1p as negative regulatory factor in improving protein expression in host cell

Info

Publication number: CN114774461B
Application number: CN202210354723.6A
Authority: CN
Inventors: 姚冬生; 林香娜; 刘大岭; 谢春芳; 丁伟秋
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2022-04-06
Filing date: 2022-04-06
Publication date: 2023-05-26
Anticipated expiration: 2042-04-06
Also published as: CN114774461A

Abstract

The invention relates to application of a transcription regulatory factor expressed by eukaryotic genes, in particular to application of a transcription regulatory factor Ash1p of a constitutive promoter Pgap. The invention discloses application of Ash1p as a negative regulatory factor in improving protein expression in a host cell, wherein the amino acid sequence of the Ash1p is encoded by an Ash1 gene with a nucleotide sequence of SEQ ID NO. 1; the application is to improve the expression of proteins in host cells by knocking out the Ash1 gene. The application of the invention can enhance the transcription regulation of the constitutive promoter Pgap in the Pichia pastoris expression system by reducing the repression effect, thereby improving the expression efficiency and the yield of the target protein.

Description

Application of Ash1p as negative regulatory factor in improving protein expression in host cell

Technical Field

The invention belongs to the fields of molecular biology and bioengineering, relates to application of a transcription regulatory factor of eukaryotic gene expression, and in particular relates to application of a transcription regulatory factor Ash1p of a constitutive promoter Pgap.

Background

Promoters are one of the most important elements regulating gene expression, P _AOX1 Promoters (inducible) and Pgap promoters (constitutive) are the most representative promoters in pichia pastoris exogenous protein expression.

The methanol-inducible Pichia expression system is a common expression system currently used for expressing most heterologous proteins, however, not all exogenous proteins are suitable for methanol-inducible expression and methanol has great potential safety hazards in large-scale production. Compared with methanol induction, the constitutive pichia pastoris expression system does not use methanol induction when expressing heterologous proteins, but most of constitutive promoters have relatively weak strength, and cannot obtain higher protein yield, so that the application of the constitutive pichia pastoris expression system is limited.

Aiming at the defect of methanol induction, the optimization and transformation of the pichia pastoris expression system are in recent years becoming research hot spots. In promoter engineering studies, a new promoter library is currently constructed mainly by various methods. Among them, there are many studies by _AOX1 Deletion or insertion of cis-acting elements, point mutation of 5' UTR or core promoter region, etc. to engineer P _AOX1 Thereby leading to P _AOX1 But these modifications do not seem to eliminate well the inhibition caused by high levels of glucose and glycerol, etc. instead of carbon sources, and far from reaching the level of industrial application. For construction of Pgap library, the only study was that Qin et al constructed GAP promoter library by random mutation through error-prone PCR, but the method was random and could not explain the regulation of Pgap. With the application of transcriptome data analysis, the development work of the promoter is greatly improved. With respect to regulation and enhancement of P _AOX1 There have been many reports on the study on the expression intensity of methanol, which has been suggested to be able to control a plurality of trans-acting elements (mainly focused on P _AOX1 Transcription regulatory factor of promoter or carbon source repression-related transcription factor, etc.), or subcellular localization, at the level of transcription, of P _AOX1 Thereby affecting the expression of genes related to methanol metabolic pathways. Nevertheless, participate in P _AOX1 The regulation mechanism is complex, and partial carbon source de-repression is not superior to traditional methanol induction in protein expression. At present, research on promoter regulation is mainly focused on PAOX1, while for research on exploring transcriptional regulation of Pgap, only Ozge Ata and the like are currently used, a high-expression rhGH strain of a promoter variant is constructed by deleting or copying a Transcription Factor Binding Site (TFBS) in a targeted manner, and reports on enhancing the yield of target proteins expressed by the Pgap promoter through improvement of transcriptional regulation of the Pgap promoter are almost blank in the published literature.

According to the report of the literature, when the Ash1p is positioned in the cell nucleus in the saccharomyces cerevisiae, the transcription of the HO gene can be closed, the transformation of mating type of the saccharomyces cerevisiae is affected, and the Ash1 gene is estimated to be PAS_chr1-1_0414 (with the sequence number of NC_ 012963.1) in the pichia pastoris through comparison, but the function of the Ash1p on transcription regulation has not been reported at present.

Disclosure of Invention

The invention mainly aims to solve the problems and defects of the expression of heterologous proteins in host cells and provides a transcription factor Ash1p for regulating the expression of the heterologous proteins in the host cells, which can enhance the transcription regulation of a constitutive promoter Pgap in a pichia pastoris expression system by reducing the repression effect, thereby improving the expression efficiency and the yield of the target proteins.

In a first aspect of the present invention there is provided the use of Ash1p as a negative regulator for increasing protein expression in a host cell, the amino acid sequence of Ash1p being encoded by an Ash1 gene having the nucleotide sequence SEQ ID NO. 1; the application is to improve the expression of proteins in host cells by knocking out the Ash1 gene.

According to the use of the invention, the host cell is selected from the group consisting of: pichia pastoris, saccharomyces cerevisiae and candida glycerinogenes.

According to the prior art, pichia pastoris, saccharomyces cerevisiae, candida glycerogenes and the like can accept a yeast expression vector using Pgap as a promoter for expressing heterologous proteins, and thus can be used as a host cell of the present invention.

In a second aspect of the present invention, there is provided a gene expression cassette for regulating expression of a heterologous protein in a host cell, wherein Pgap is used as a promoter and the Ash1 gene is knocked out.

In a third aspect of the invention, there is provided a vector comprising the gene expression cassette of the invention.

In a fourth aspect of the invention, there is provided a host cell comprising a gene expression cassette according to the invention, or comprising a vector according to the invention.

In a fifth aspect of the invention, there is provided a method of enhancing protein expression in a host cell comprising: providing a host cell according to the invention, culturing the host cell under conditions suitable for expression of the heterologous protein, and isolating the expressed protein from the culture medium.

The invention discloses by experiments: knocking out an Ash1 gene in a heterologous protein synthesis path with Pgap as a promoter, and forming a transcription factor Ash1p (Ash 1 protein) after translation of the sequence to participate in reverse regulation of the Pgap promoter so as to remove repressed expression of a subsequent exogenous gene with the Pgap as the promoter, thereby realizing non-induced mass accumulation of a target protein.

The invention can construct a gene expression cassette taking Pgap as a promoter and knocking out an Ash1 gene, and the knocking-out of an Ash1 transcription inhibitor can enhance the transcription of a pichia pastoris constitutive promoter Pgap promoter so as to ensure that the exogenous gene in the gene expression cassette is efficiently expressed in pichia pastoris (or other yeasts which can accept the Pgap as the promoter), and can obviously improve the expression intensity of the exogenous gene.

Drawings

FIG. 1 is a map of an Ash1 gene knockout expression cassette; a diagram is Kan gene replacement knockout expression cassette; panel b shows a complete knockout expression cassette.

FIG. 2 shows the growth rate of xylanase xynB expressed by the strain (Pichia pastoris) of the invention, wherein the control group is a non-knocked-out strain; clone 1 and clone 2 were Ash1 knock-out strains.

Detailed Description

The technical scheme of the invention will be further described in detail below with reference to specific embodiments. It is to be understood that the following examples are illustrative only and are not to be construed as limiting the scope of the invention. All techniques implemented based on the above description of the invention are intended to be included within the scope of the invention.

Unless otherwise indicated, the starting materials and reagents used in the following examples were either commercially available or may be prepared by known methods. The molecular cloning techniques used in the following examples are described in J.Sambucus et al, code "molecular cloning Experimental guidelines", or according to the manufacturer's recommendations.

Herein, ash1p means a protein expressed by Ash1 gene.

Example 1: construction of Kan Gene replacement transcription repressor Ash1 Gene knockout expression cassette 1, amplification of upstream homology arm

The invention takes the genome sequence of pichia pastoris as a reference, adopts software DNAMAN 8 to design and synthesize two oligonucleotide primers, and amplifies the upstream homology arm sequence of Ash1 (SEQ ID NO: 1) by a PCR method.

The two PCR primers were as follows:

1-F：ACTTACGAGCTCGACAGGCAAATCATTCA(SEQ ID NO:4)

1-R：ACTTACGCGGATCCGCGCGTATTTAGCTACAATC(SEQ ID NO:5)

the underlined bases are SacI and BamHI restriction enzyme sites respectively.

The PCR reaction system is shown in Table 1 below.

Table 1:

component (A)	Volume (mu L)
		2×Q5 Master Mix	12.5
Primer F(10μM)	1.25
		Primer R(10μM)	1.25
Template DNA	1(100ng)
		ddH ₂ O	9ul
Total volume of	25ul

The PCR procedure was set forth in Table 2 below.

Table 2:

after electrophoresis of the PCR amplification product by 1% agarose gel, gel recovery was performed by using a DNA recovery kit to obtain a fragment of about 729 bp.

2. Amplification of downstream homology arms

The invention takes the genome sequence of pichia pastoris as a reference, adopts software DNAMAN 8 to design and synthesize two oligonucleotide primers, and amplifies the downstream homology arm sequence of Ash1 by a PCR method.

The two PCR primers were as follows:

2-F:ACTTACCGGAATTCCGGTCACTAACTGTATACT(SEQ ID NO:6)

2-R:ACTTATTTGCGGCCGCTTTAACAATCAAGAGGACATACTT(SEQ ID NO:7)

the underlined bases are EcoRI and NotI restriction endonuclease cleavage sites respectively.

The PCR reaction system and the PCR procedure set the amplification method of the upstream homology arm as described above.

After electrophoresis of the PCR amplified product by 1% agarose gel, gel recovery was performed by using a DNA recovery kit to obtain a fragment of about 745 bp.

3. Amplification of Kan Gene

The present invention uses Kan gene (kanamycin resistance gene, which can make cells show G418 resistance in eukaryotes) of ppic3.5k plasmid (derived from Invitrogen company) as reference, two oligonucleotide primers are designed and synthesized by using software DNAMAN 8, and the Kan gene is amplified by PCR method.

The two PCR primers were as follows:

3-F:ACTTACGCGGATCCGCGATGAGCCATATTCAAC(SEQ ID NO:8)

3-R:ACTTACCGGAATTCCGGTTAGAAAAACTCATCGAG(SEQ ID NO:9)

the underlined bases are BamHI and EcoRI restriction enzyme sites, respectively.

The PCR reaction system and the PCR procedure were set as described above.

After electrophoresis of the PCR amplified product by 1% agarose gel, gel recovery was performed by using a DNA recovery kit to obtain a fragment of about 816 bp.

4. Ligation of the ppic3.5k vector with the Kan fragment

The ppic3.5K plasmid and the PCR product of the Kan gene were digested with restriction enzymes EcoRI and BamHI at 37℃for 20min, respectively, under the conditions shown in Table 3 below.

Table 3:

component (A)	Volume (mu L)
		10 XCutsmart buffer	1
Plasmid	1 (about 200 ng)
		EcoRI、BamHI	0.2
ddH ₂ O	7.6
		Total volume of	10

The two target fragments were recovered after electrophoresis on a 1% agarose gel, and ligated with T4DNA ligase, with the ligation system shown in Table 4 below.

Table 4:

ligation was performed at 16℃for 12h with ligase, DH5a competent cells transformed with the ligation product, plasmids were extracted with a plasmid extraction kit, and after double digestion with EcoRI and BamHI, running electrophoresis showed two bands of 9kb and 816bp, indicating successful ligation, and DNA sequencing was performed to determine Kan gene.

5. The upstream homology arm fragment was ligated to ppi3.5k-Kan vector

The upstream homology arm fragment and ppi3.5k-Kan vector are respectively digested with restriction enzymes SacI and BamHI, purified and recovered.

The ligation of the upstream homology arm fragment with the ppi3.5k-Kan vector was carried out in the same manner as in step 4, and the electrophoresis result after double cleavage with SacI and BamHI showed that the ligation was successful as shown by the 9kb and 750bp bands, and the upstream homology arm fragment (SEQ ID NO: 2) was determined by DNA sequencing.

6. The downstream homology arm fragment was ligated to ppic3.5k- (upstream homology arm) -Kan vector

The downstream homology arm fragment and ppic3.5k- (upstream homology arm) -Kan vector are respectively digested with restriction endonuclease EcoRI and NotI, purified and recovered.

The ligation of the downstream homology arm fragment with the ppic3.5k- (upstream homology arm) -Kan vector was carried out as shown in step 4, and the electrophoresis result after double digestion with EcoRI and NotI showed that the ligation was successful as shown by the two bands of 8kb and 750bp, and the downstream homology arm fragment (SEQ ID NO: 3) was determined by DNA sequencing.

Thus, the Kan gene replacement transcription inhibitor Ash1 gene knockout expression cassette is successfully constructed (shown as a diagram of figure 1).

Example 2: construction of transcription repressing factor Ash1 gene complete knockout expression cassette

As in example 1, the upper and lower homology arms of the Ash1 gene were amplified using primers 1-F, 1-R and 2-F, 2-R, and the upstream and downstream homology arm fragments were ligated to the ppic3.5k vector by the method of cleavage ligation described above, to construct a ppic3.5k- (upstream homology arm) - (downstream homology arm) knockout expression cassette.

Example 3: pichia pastoris genome Ash1 knockout

To increase the integration efficiency of the single copy expression cassette on the pichia chromosome, the knockout expression cassette was linearized with the restriction enzymes SacI, notI and recovered by purification with the kit. The recipient bacteria of this experiment were Pichia pastoris SMD1168 (recombinant bacteria already containing the xylanase xynB gene inserted after Pgap, EX 6), and the knockdown expression cassette of example 1 was screened after electrotransformation using a G418 plate containing 0.3mg/mL and identified by genomic PCR. Example 2 knockdown expression cassettes were screened using YPG plates after electrotransformation and genomic PCR identification was performed.

The result of sequencing by PCR products shows that the screened strain is a positive clone which is successfully knocked out Ash 1.

Example 4: determination of heterologous protein expression driven by constitutive promoter Pgap in Ash1 knockout Strain

The positive clone 1 selected in example 1 and the positive clone 2 selected in example 2 were fermented at 28℃and 200rpm for 72 hours. Meanwhile, pichia pastoris (EX 6) containing the xynB gene is used as a control, supernatant is taken after culturing for 72 hours, SDS-PAGE electrophoresis detection is carried out, and xylanase xynB expression level is analyzed.

As shown in FIG. 2, the expression level of the selected positive clone 1 is improved by 109% compared with that of the control group after the Ash1p transcription factor is knocked out, and the expression level of the positive clone 2 is improved by 58% compared with that of the control group.

SEQUENCE LISTING

<110> and university of south China

<120> Ash1p as negative regulatory factor for increasing protein expression in host cells

<130>

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 639

<212> DNA

<213> Pichia pastoris

<400> 1

atgcctcgca ataagactca agctgctaaa aagaagaatc cggaaaattt tagaagatct 60

gttgaatcag atgtctttac tgactccgaa gctcgtaatc ggctagcgtc tcaaccaaaa 120

aaaactgcga aatcaaaggt tcacaaacag agtcacttgg aagttaagaa agaacaaaga 180

tcggtacggt tgtatggaaa aaaaaaacca cttagagaat ataccgaaaa agaacttcat 240

attcctgtat taaacagagc catagttcct ggtgttgttc cgaaagctcg aggtaaaaag 300

ggaaagaagt ttgtggacga tcacgattct gtcgttttaa ccagacttgt caaacaaatc 360

aacgacaaaa aggacttgct gaacgagagt aaattagaga aatcacaacg tattgaagag 420

atccgtgagt taaagaaaca agaaattgaa aaaaaagagg agcttaagaa gcaaaaattg 480

gacgataaga aacaacagat taaatcgaag gccaatactg caagagctat tcgaagaagg 540

aacgccagag agcttgccag aaaggcgaag gaaaacgctg atgaaaaact aactactcgg 600

aacattaaaa aacctatcaa atctgtgtca tttgcttaa 639

<210> 2

<211> 729

<212> DNA

<213> Synthesis

<400> 2

acaggcaaat cattcatttc tatcctcgaa cttggatact aactattatg gaaaatgaac 60

aagtatcaaa acacgacttt tgatatcaag taaggatggc agaagtacag gcaagaatcg 120

ttgcacatat gaacaaagat cataaaattg ccctcgaaga ctatttatct gtttacggaa 180

acattgcaat tgatgataag atcgctaata ttactatgaa agacattgag ttggacaata 240

taactctaag ttttaaccat tttgacattg agtttcccat aataaaacca attccaatcg 300

atcctccgat gaaggatctc agtgaggcaa gaattagatt aaccgagatg gccaagtatt 360

gcgcctccaa gagaggattt tctcactttc aagtagcgga gattggatac ccagcatcat 420

tgggcgattt cactatctta ggggttctac tcattctgtt aacgggattt ttcattccaa 480

ctacactatt tcatggtatt ttacctgctc tacattgtcc aactgcactc gtttcgttct 540

tagctgccag cactaaatcc attttgattt gcacaatttt gatccattta cttgaaattc 600

agttagtatt gaaccccttg ctgaaaaagt accgagtgtc gttcgactac aaattagaat 660

ggtggttcct gactttcatt gacgggtatt tcacaattcg tcgattcaag aagattgtag 720

ctaaatacg 729

<210> 3

<211> 745

<212> DNA

<213> Synthesis

<400> 3

tcactaactg tatactaatt tttttttcgc ctatcgaaga ctattctgta tcatacatat 60

attaatcata atgcccgttt catttgtcta atactgtgca ctcgtaatcc ttttatggcg 120

ggatttataa gttgtacctg tagtacacaa acatggttta cctgcagttc tcgtcgccga 180

caatagtaaa gcccctattc agagattcaa tatccatcgg ggttgtgact ggttgatttt 240

aatcactcca atatggctag attcaaagcc gatcgcaata ctgaatcatg gtagcggcct 300

tgcgactcat aacattctat aatcccagca atgcttggct ttggtattcg aagacatgtc 360

gatctccaaa cctagaagac ctccaattct cgtcttgata aaactgtgtc gtactaaatc 420

ttcaaaaagg cttcgggtga ccagcaactg aagcaaaaat ttctgcaggt ggagcaaaca 480

actaagctag gttttcaata gcaacatact cacaatttgg aatggtttta tcaggaaaga 540

cctagttaat aagggaggta ccagcatgag cctcaagcat ataaaactgt caatccggtg 600

aaaatcacta aagcaggtac taatataacc taaaagaggc aaaaagtcta aatgtggtgc 660

cggtgctaca tattcatgtt cacagagtaa caaggatgat agttagccgt aaacaataaa 720

agtagaagta tgtcctcttg attgt 745

<210> 4

<211> 29

<212> DNA

<213> Synthesis

<400> 4

acttacgagc tcgacaggca aatcattca 29

<210> 5

<211> 34

<212> DNA

<213> Synthesis

<400> 5

acttacgcgg atccgcgcgt atttagctac aatc 34

<210> 6

<211> 33

<212> DNA

<213> Synthesis

<400> 6

acttaccgga attccggtca ctaactgtat act 33

<210> 7

<211> 40

<212> DNA

<213> Synthesis

<400> 7

acttatttgc ggccgcttta acaatcaaga ggacatactt 40

<210> 8

<211> 33

<212> DNA

<213> Synthesis

<400> 8

acttacgcgg atccgcgatg agccatattc aac 33

<210> 9

<211> 35

<212> DNA

<213> Synthesis

<400> 9

acttaccgga attccggtta gaaaaactca tcgag 35

Claims

1. By knocking outAsh1Use of a gene for increasing expression of a heterologous protein in a host cell, said gene comprisingAsh1The nucleotide sequence of the gene is SEQ ID NO. 1, the heterologous protein expression uses Pgap as a promoter, and the host cell is Pichia pastoris.

2. A method of enhancing expression of a heterologous protein in a host cell, comprising: by knocking outAsh1Genes to increase expression of a heterologous protein in a host cell, culturing the host cell under conditions suitable for expression of the heterologous protein, and isolating the expressed protein from the culture medium; the saidAsh1The nucleotide sequence of the gene is SEQ ID NO. 1, the heterologous protein expression uses Pgap as a promoter, and the host cell is Pichia pastoris.