CN114774461A

CN114774461A - Application of Ash1p as negative regulatory factor in improving protein expression in host cell

Info

Publication number: CN114774461A
Application number: CN202210354723.6A
Authority: CN
Inventors: 姚冬生; 林香娜; 刘大岭; 谢春芳; 丁伟秋
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2022-04-06
Filing date: 2022-04-06
Publication date: 2022-07-22
Anticipated expiration: 2042-04-06
Also published as: CN114774461B

Abstract

The invention relates to application of a transcription regulatory factor expressed by a eukaryotic gene, in particular to application of a transcription regulatory factor Ash1p of a constitutive promoter Pgap. The invention discloses application of Ash1p as a negative regulatory factor in improving protein expression in a host cell, wherein the amino acid sequence of Ash1p is coded by an Ash1 gene of which the nucleotide sequence is SEQ ID NO. 1; the application is to improve the expression of protein in a host cell by knocking out the Ash1 gene. The application of the invention can enhance the transcription regulation of a constitutive promoter Pgap in a pichia pastoris expression system by reducing the repression effect, thereby improving the expression efficiency and the yield of target protein.

Description

Application of Ash1p as negative regulatory factor in improving protein expression in host cell

Technical Field

The invention belongs to the field of molecular biology and bioengineering, relates to application of a transcription regulatory factor expressed by a eukaryotic gene, and particularly relates to application of a transcription regulatory factor Ash1p of a constitutive promoter Pgap.

Background

The promoter is one of the most important elements for regulating gene expression, P_AOX1Promoters (inducible) and Pgap promoters (constitutive) are the most representative promoters in the expression of Pichia pastoris foreign proteins.

The expression system of methanol-induced pichia is a common expression system for expressing most of heterologous proteins at present, however, not all the heterologous proteins are suitable for methanol-induced expression, and methanol has great potential safety hazard in large-scale production. Compared with methanol induction, methanol induction is not used when a constitutive pichia pastoris expression system expresses heterologous proteins, but most constitutive promoters are relatively weak in strength, and high protein yield cannot be obtained, so that the application of the constitutive pichia pastoris expression system is limited.

Aiming at the defects of methanol induction, the optimization and modification of a pichia pastoris expression system are a research hotspot in recent years. In the research of promoter modification, a new promoter library is mainly constructed by various methods at present. Among them, there are many studies by P_AOX1Modification of P by deletion or insertion of cis-acting element, point mutation of 5' UTR or core promoter region, or the like_AOX1Thereby resulting in P_AOX1But these modifications do not appear to be able to eliminate well the inhibition caused by alternative carbon sources such as high levels of glucose and glycerol and are far from the level of industrial application. For the construction of the Pgap library, the only research is that Qin and the like construct the GAP promoter library by random mutation through error-prone PCR, but the method is random and cannot explain the regulation and control of Pgap. With the application of transcriptome data analysis, the promoter development work is greatly improved. In relation to the regulation and enhancement of P_AOX1There are many reports on the expression intensity-related studies, and the current studies show that methanol can regulate multiple trans-acting elements (mainly focusing on P)_AOX1Transcription regulatory factor of promoter or carbon source repression related transcription factor, etc.) or subcellular localization, regulating P at the transcription level_AOX1Thereby affecting the expression of the gene related to the methanol metabolic pathway. Nevertheless, participation P_AOX1The regulation mechanism is complex, partial derepression of a carbon source cannot exceed the traditional methanol induction in protein expression. At present, researches on promoter regulation are mainly focused on PAOX1, but for researches on exploring Pgap transcriptional regulation, only Ozge Ata and the like construct a high-expression rhGH strain of a promoter variant by specifically deleting or replicating a Transcription Factor Binding Site (TFBS), and reports that the yield of target protein expressed by a Pgap promoter is enhanced by improving the transcriptional regulation of the Pgap promoter in a public document are almost blank.

According to literature reports, when Ash1p is located in cell nucleus in Saccharomyces cerevisiae, the transcription of HO gene can be closed, the conversion of mating types of Saccharomyces cerevisiae is influenced, and through comparison, the Ash1 gene in Pichia pastoris is presumed to be PAS _ chr1-1_0414 (the sequence number is NC _012963.1), but the function of Ash1p on transcriptional regulation is not reported at present.

Disclosure of Invention

The invention mainly aims to solve the problems and defects of heterologous protein expression in a host cell, and provides a transcription factor Ash1p for regulating the heterologous protein expression in the host cell, which can enhance the transcription regulation of a constitutive promoter Pgap in a pichia pastoris expression system by reducing repression, thereby improving the expression efficiency and yield of target protein.

In a first aspect of the invention, there is provided use of Ash1p as a negative regulator in increasing protein expression in a host cell, the amino acid sequence of Ash1p is encoded by the Ash1 gene having the nucleotide sequence of SEQ ID No. 1; the application is to improve the expression of protein in a host cell by knocking out the Ash1 gene.

According to the use of the invention, the host cell is selected from: pichia pastoris, Saccharomyces cerevisiae, Candida glycerinogenes.

According to the reports of the existing documents, pichia, saccharomyces cerevisiae, candida glycerinogenes and the like can all accept yeast expression vectors taking Pgap as a promoter to express heterologous proteins, so that the pichia, saccharomyces cerevisiae, candida glycerinogenes and the like can be used as host cells of the invention.

In a second aspect of the invention, a gene expression cassette for regulating expression of a heterologous protein in a host cell is provided, wherein Pgap is used as a promoter and Ash1 gene is knocked out.

In a third aspect of the invention, a vector is provided, which comprises the gene expression cassette of the invention.

In a fourth aspect of the invention, there is provided a host cell comprising the gene expression cassette of the invention, or comprising the vector of the invention.

In a fifth aspect of the invention, there is provided a method of enhancing protein expression in a host cell, comprising: providing a host cell according to the invention, culturing said host cell under conditions suitable for expression of said heterologous protein, and isolating the expressed protein from the culture medium.

The invention discloses through experiments: knocking out the Ash1 gene in a heterologous protein synthesis path with Pgap as a promoter, forming a transcription factor Ash1p (Ash1 protein) after the sequence is translated to participate in the reverse regulation of the Pgap promoter, and removing the repression expression of a subsequent exogenous gene with the Pgap as the promoter, thereby realizing the non-induced mass accumulation of the target protein.

The gene expression cassette which takes Pgap as a promoter and knocks out the Ash1 gene can be constructed, and the knockout of the Ash1 transcription inhibiting factor can enhance the transcription of a Pichia pastoris constitutive promoter Pgap promoter, so that the exogenous gene in the gene expression cassette is efficiently expressed in Pichia pastoris (or other yeasts which can accept Pgap as a promoter), and the expression strength of the exogenous gene can be obviously improved.

Drawings

FIG. 1 is an Ash1 gene knockout expression cassette map; a picture is a Kan gene substitution knockout expression cassette; panel b is a full knockout expression cassette.

FIG. 2 shows the growth rate of xylanase xynB expressed by the strain of the invention (Pichia pastoris), wherein the control group is an un-knocked-out strain; clone 1 and clone 2 were Ash1 knock-out strains.

Detailed Description

The technical solution of the present invention will be further described in detail with reference to specific embodiments. It is to be understood that the following examples are only illustrative and explanatory of the present invention and should not be construed as limiting the scope of the present invention. All the technologies realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention.

Unless otherwise indicated, the raw materials and reagents used in the following examples are all commercially available products or can be prepared by known methods. The molecular cloning techniques employed in the following examples are described in the molecular cloning guidelines, compiled by J.Sammlung et al, or as recommended by the manufacturer.

Herein, Ash1p represents a protein expressed by Ash1 gene.

Example 1: construction of Kan Gene replacement transcription inhibitor Ash1 Gene knockout expression cassette 1, amplification of upstream homology arm

The invention takes the genome sequence of Pichia pastoris as reference, adopts software DNAMAN 8 to design and synthesize two oligonucleotide primers, and amplifies the upstream homology arm sequence of Ash1(SEQ ID NO:1) by a PCR method.

The two PCR primers were as follows:

1-F：ACTTACGAGCTCGACAGGCAAATCATTCA(SEQ ID NO:4)

1-R：ACTTACGCGGATCCGCGCGTATTTAGCTACAATC(SEQ ID NO:5)

underlined bases are SacI restriction enzyme cutting sites and BamHI restriction enzyme cutting sites respectively.

The PCR reaction system is shown in Table 1 below.

Table 1:

components	Volume (mu L)
		2×Q5 Master Mix	12.5
Primer F(10μM)	1.25
		Primer R(10μM)	1.25
Template DNA	1(100ng)
		ddH₂O	9ul
Total volume	25ul

The PCR program was set up as in Table 2 below.

Table 2:

the PCR amplification product was subjected to 1% agarose gel electrophoresis, and gel recovery was carried out using a DNA recovery kit to obtain a fragment of about 729 bp.

2. Amplification of downstream homology arms

The invention takes the genome sequence of pichia pastoris as reference, adopts software DNAMAN 8 to design and synthesize two oligonucleotide primers, and amplifies the sequence of the downstream homology arm of Ash1 by a PCR method.

The two PCR primers were as follows:

2-F:ACTTACCGGAATTCCGGTCACTAACTGTATACT(SEQ ID NO:6)

2-R:ACTTATTTGCGGCCGCTTTAACAATCAAGAGGACATACTT(SEQ ID NO:7)

the underlined bases are EcoRI and NotI restriction endonuclease cut sites respectively.

The PCR reaction system and PCR program set up the amplification method for the upstream homology arms as described above.

The PCR amplification product was subjected to 1% agarose gel electrophoresis, and gel recovery was carried out using a DNA recovery kit to obtain a fragment of about 745 bp.

3. Amplification of Kan Gene

In the invention, the Kan gene (kanamycin resistance gene which can express G418 resistance in a cell) of a ppic3.5k plasmid (from Invitrogen company) is used as a reference, two oligonucleotide primers are designed and synthesized by adopting software DNAMAN 8, and the Kan gene is amplified by a PCR method.

The two PCR primers were as follows:

3-F:ACTTACGCGGATCCGCGATGAGCCATATTCAAC(SEQ ID NO:8)

3-R:ACTTACCGGAATTCCGGTTAGAAAAACTCATCGAG(SEQ ID NO:9)

underlined bases are BamHI and EcoRI restriction enzyme cutting sites respectively.

The PCR reaction and PCR program were set as described above.

After the PCR amplification product was subjected to 1% agarose gel electrophoresis, gel recovery was carried out using a DNA recovery kit to obtain a fragment of about 816 bp.

4. Ligation of the ppic3.5k vector to the Kan fragment

The ppic3.5K plasmid and the Kan gene PCR product were digested with restriction enzymes EcoRI and BamHI, respectively, at 37 ℃ for 20min under the conditions shown in Table 3 below.

Table 3:

components	Volume (μ L)
		10 XCutsmart buffer	1
Plasmid	1 (about 200ng)
		EcoRI、BamHI	0.2
ddH₂O	7.6
		Total volume	10

After electrophoresis of the enzyme digestion product on 1% agarose gel, two target fragments were recovered respectively and ligated by T4DNA ligase, the ligation system is shown in Table 4 below.

Table 4:

and (2) connecting for 12h by using ligase at 16 ℃, transforming DH5a competent cells by using a connection product, amplifying, extracting plasmids by using a plasmid extraction kit, carrying out double enzyme digestion by using EcoRI and BamHI, carrying out electrophoresis, and indicating that two bands of 9kb and 816bp exist, wherein the successful connection is indicated, and the DNA sequencing is carried out to determine the gene as Kan.

5. The upstream homology arm fragment is connected with a ppi3.5k-Kan carrier

The upstream homologous arm fragment and the ppi3.5k-Kan vector are obtained by double digestion with restriction enzymes SacI and BamHI respectively and purification and recovery.

The method for connecting the upstream homology arm fragment and the ppi3.5k-Kan vector is the same as that in step 4, the electrophoresis result after the double digestion with SacI and BamHI shows that two bands of 9kb and 750bp are displayed, the connection is successful, and the upstream homology arm fragment (the sequence is SEQ ID NO:2) is determined by DNA sequencing.

6. The downstream homology arm fragment is connected with a ppic3.5k- (upstream homology arm) -Kan carrier

The downstream homology arm fragment and the ppic3.5k- (upstream homology arm) -Kan vector are obtained by double digestion, purification and recovery of restriction enzymes EcoRI and NotI respectively.

The method for connecting the downstream homology arm fragment and the ppic3.5k- (upstream homology arm) -Kan vector is the same as that in step 4, an electrophoresis result shows that two bands of 8kb and 750bp are generated after EcoRI and NotI double enzyme digestion, the connection is successful, and the downstream homology arm fragment is determined by DNA sequencing (the sequence is SEQ ID NO: 3).

Thus, the Kan gene is successfully constructed to replace the transcription repressing factor Ash1 gene knockout expression cassette (as shown in a diagram of figure 1).

Example 2: construction of complete transcription repressing factor Ash1 gene knockout expression cassette

The upper and lower homology arms of the Ash1 gene were amplified using primers 1-F, 1-R and 2-F, 2-R as in example 1, and the upstream and downstream homology arm fragments were ligated to the ppic3.5k vector by the above-described enzymatic ligation, creating a ppic3.5k- (upstream homology arm) - (downstream homology arm) knock-out cassette.

Example 3: pichia pastoris genome Ash1 knock-out

In order to improve the integration efficiency of the single copy expression cassette on the chromosome of pichia pastoris, the knockout expression cassette is linearized by restriction enzymes SacI and NotI and purified and recovered by a kit. The recipient bacterium of the experiment is pichia pastoris SMD1168 (recombinant bacterium containing xylanase xynB gene inserted after Pgap, EX6), the knockout expression cassette of example 1 is electrically transformed, and then screened by using a G418 plate containing 0.3mg/mL, and genome PCR identification is carried out. Example 2 knock-out expression cassettes were electrotransformed and screened using YPG plates and genomic PCR identification was performed.

The PCR product sequencing result shows that the screened strain is a positive clone which successfully knocks out the Ash 1.

Example 4: assay for heterologous protein expression driven by Pgap, a constitutive promoter in an Ash1 knockout strain

The positive clone 1 selected in example 1 and the positive clone 2 selected in example 2 were fermented at 28 ℃ and 200rpm for 72 hours. Meanwhile, pichia pastoris (EX6) containing xynB gene is used as a control, after culture for 72h, the supernatant is taken to carry out SDS-PAGE electrophoresis detection, and the expression level of xylanase xynB is analyzed.

As shown in FIG. 2, the expression level of the positive clone 1 picked after the Ash1p transcription factor is knocked out is increased by 109% compared with the control group, and the expression level of the positive clone 2 is increased by 58% compared with the control group.

SEQUENCE LISTING

<110> river-south university

Application of <120> Ash1p as negative regulatory factor in improving protein expression in host cell

<130>

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 639

<212> DNA

<213> Pichia pastoris

<400> 1

atgcctcgca ataagactca agctgctaaa aagaagaatc cggaaaattt tagaagatct 60

gttgaatcag atgtctttac tgactccgaa gctcgtaatc ggctagcgtc tcaaccaaaa 120

aaaactgcga aatcaaaggt tcacaaacag agtcacttgg aagttaagaa agaacaaaga 180

tcggtacggt tgtatggaaa aaaaaaacca cttagagaat ataccgaaaa agaacttcat 240

attcctgtat taaacagagc catagttcct ggtgttgttc cgaaagctcg aggtaaaaag 300

ggaaagaagt ttgtggacga tcacgattct gtcgttttaa ccagacttgt caaacaaatc 360

aacgacaaaa aggacttgct gaacgagagt aaattagaga aatcacaacg tattgaagag 420

atccgtgagt taaagaaaca agaaattgaa aaaaaagagg agcttaagaa gcaaaaattg 480

gacgataaga aacaacagat taaatcgaag gccaatactg caagagctat tcgaagaagg 540

aacgccagag agcttgccag aaaggcgaag gaaaacgctg atgaaaaact aactactcgg 600

aacattaaaa aacctatcaa atctgtgtca tttgcttaa 639

<210> 2

<211> 729

<212> DNA

<213> Artificial Synthesis

<400> 2

acaggcaaat cattcatttc tatcctcgaa cttggatact aactattatg gaaaatgaac 60

aagtatcaaa acacgacttt tgatatcaag taaggatggc agaagtacag gcaagaatcg 120

ttgcacatat gaacaaagat cataaaattg ccctcgaaga ctatttatct gtttacggaa 180

acattgcaat tgatgataag atcgctaata ttactatgaa agacattgag ttggacaata 240

taactctaag ttttaaccat tttgacattg agtttcccat aataaaacca attccaatcg 300

atcctccgat gaaggatctc agtgaggcaa gaattagatt aaccgagatg gccaagtatt 360

gcgcctccaa gagaggattt tctcactttc aagtagcgga gattggatac ccagcatcat 420

tgggcgattt cactatctta ggggttctac tcattctgtt aacgggattt ttcattccaa 480

ctacactatt tcatggtatt ttacctgctc tacattgtcc aactgcactc gtttcgttct 540

tagctgccag cactaaatcc attttgattt gcacaatttt gatccattta cttgaaattc 600

agttagtatt gaaccccttg ctgaaaaagt accgagtgtc gttcgactac aaattagaat 660

ggtggttcct gactttcatt gacgggtatt tcacaattcg tcgattcaag aagattgtag 720

ctaaatacg 729

<210> 3

<211> 745

<212> DNA

<213> Artificial Synthesis

<400> 3

tcactaactg tatactaatt tttttttcgc ctatcgaaga ctattctgta tcatacatat 60

attaatcata atgcccgttt catttgtcta atactgtgca ctcgtaatcc ttttatggcg 120

ggatttataa gttgtacctg tagtacacaa acatggttta cctgcagttc tcgtcgccga 180

caatagtaaa gcccctattc agagattcaa tatccatcgg ggttgtgact ggttgatttt 240

aatcactcca atatggctag attcaaagcc gatcgcaata ctgaatcatg gtagcggcct 300

tgcgactcat aacattctat aatcccagca atgcttggct ttggtattcg aagacatgtc 360

gatctccaaa cctagaagac ctccaattct cgtcttgata aaactgtgtc gtactaaatc 420

ttcaaaaagg cttcgggtga ccagcaactg aagcaaaaat ttctgcaggt ggagcaaaca 480

actaagctag gttttcaata gcaacatact cacaatttgg aatggtttta tcaggaaaga 540

cctagttaat aagggaggta ccagcatgag cctcaagcat ataaaactgt caatccggtg 600

aaaatcacta aagcaggtac taatataacc taaaagaggc aaaaagtcta aatgtggtgc 660

cggtgctaca tattcatgtt cacagagtaa caaggatgat agttagccgt aaacaataaa 720

agtagaagta tgtcctcttg attgt 745

<210> 4

<211> 29

<212> DNA

<213> Artificial Synthesis

<400> 4

acttacgagc tcgacaggca aatcattca 29

<210> 5

<211> 34

<212> DNA

<213> Artificial Synthesis

<400> 5

acttacgcgg atccgcgcgt atttagctac aatc 34

<210> 6

<211> 33

<212> DNA

<213> Artificial Synthesis

<400> 6

acttaccgga attccggtca ctaactgtat act 33

<210> 7

<211> 40

<212> DNA

<213> Artificial Synthesis

<400> 7

acttatttgc ggccgcttta acaatcaaga ggacatactt 40

<210> 8

<211> 33

<212> DNA

<213> Artificial Synthesis

<400> 8

acttacgcgg atccgcgatg agccatattc aac 33

<210> 9

<211> 35

<212> DNA

<213> Artificial Synthesis

<400> 9

acttaccgga attccggtta gaaaaactca tcgag 35

Claims

Use of Ash1p as a negative regulator in increasing protein expression in a host cell, wherein the amino acid sequence of Ash1p is encoded by Ash1 gene having the nucleotide sequence of SEQ ID No. 1; the application is to increase the expression of a protein in a host cell by knocking out the Ash1 gene.
2. The use according to claim 1, wherein said host cell is selected from the group consisting of: pichia pastoris, Saccharomyces cerevisiae, Candida glycerinogenes.
3. A gene expression cassette for regulating expression of a heterologous protein in a host cell, wherein the gene expression cassette comprises a promoter Pgap in which the Ash1 gene is knocked out.
4. A carrier, characterized by: which contains the gene expression cassette of claim 2.
5. A host cell, characterized in that: comprising the gene expression cassette of claim 2 or comprising the vector of claim 3.
6. A method of enhancing protein expression in a host cell, comprising: providing a host cell according to claim 4, culturing said host cell under conditions suitable for expression of said heterologous protein, and isolating the expressed protein from the culture medium.