CN102146346B - Saccharomyces cerevisiae and constructing method and application of saccharomyces cerevisiae - Google Patents
Saccharomyces cerevisiae and constructing method and application of saccharomyces cerevisiae Download PDFInfo
- Publication number
- CN102146346B CN102146346B CN 201010556943 CN201010556943A CN102146346B CN 102146346 B CN102146346 B CN 102146346B CN 201010556943 CN201010556943 CN 201010556943 CN 201010556943 A CN201010556943 A CN 201010556943A CN 102146346 B CN102146346 B CN 102146346B
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- seq
- yeast
- pcr amplification
- plasmid puc18
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a saccharomyces cerevisiae and a preparation method and application of the saccharomyces cerevisiae, in particular to an IAH1 gene overexpression saccharomyces cerevisiae strain obtained by genetic engineering technological transformation and a constructing method of the saccharomyces cerevisiae, belonging to the technical field of biological engineering. The saccharomyces cerevisiae AU2 is preserved in the China General Microbiological Culture Collection Center on November 22, 2010, and the culture preservation number is CGMCC No. 4355. The saccharomyces cerevisiae AU2 has good genetic stability, avoids gene elimination during continuous passage for 20 times and has stable performance indexes.
Description
Technical field
One Accharomyces cerevisiae and preparation method thereof and application, particularly the Wine brewing yeast strain of the IAH1 gene overexpression that obtains through the genetic engineering technique transformation of a strain with and construction process, belong to technical field of bioengineering.
Background technology
The ester class is the meta-bolites of cereuisiae fermentum in the brewage process (Saccharomyces cerevisiae), to influencing one of topmost compound of beer flavor.The change of ester class concentration can have influence on the local flavor of beer in the beer.Therefore can obtain differently flavoured beer through the concentration that changes the ester class.Regulation and control ester class forms and mainly carries out through controlling following factor in the present brewing industry: yeast strain, wheat juice composition, dissolved oxygen amount, pressure, leavening temperature, inoculum size, main ferment time, storage wine time etc.But the change of these Externality is less to the metabolic influence of yeast self, and is also less to the concentration affects of ester class in the final beer.And, break the ester class metabolic balance of itself through regulating the expression of the key enzyme in the ester class metabolic process in the cereuisiae fermentum, the local flavor of outstanding certain or a few kinds of esters is with giving beer unique local flavor.Though change the composition of raw material, can change the local flavor that is brewed beer such as adding fruit juice, vegetables juice etc., obtain the beer of flavour, it is unilateral, mellow inadequately that the local flavor that this method is introduced shows slightly.
The beer prodn bacterial strain is transformed, and the encoding sox of overexpression esterase improves the expression level of esterase, thereby changes the ester class level in the beer, and the method for screening the yeast strain that can brewage peculiar flavour beer in this way is domestic also less than report.
Summary of the invention
The present invention is directed to the deficiency of prior art, an Accharomyces cerevisiae and construction process thereof and application are provided.
One Accharomyces cerevisiae (Saccharomyces cerevisiae) AU2; This bacterial strain on November 22nd, 2010 was preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center; Address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, culture presevation number: CGMCC NO.4355.
Yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2 cell is an oval, and bacterium colony is a white, and smooth surface is moistening, neat in edge.Its optimum growth temperature is 30 ℃, and the righttest growth pH is 5.5.
The construction process of above-mentioned yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2, step is following:
(1) DNA with cereuisiae fermentum is that template is carried out pcr amplification; Primer sequence is shown in SEQ ID NO.1 and SEQ ID NO.2; Obtain the promotor PGK1P of gene PGK1; Use restriction endonuclease Kpn I and BamH I double digestion promotor PGK1P and plasmid pUC18 (available from the precious biotechnology in Dalian ltd) then, after connecting with ligase enzyme again, obtain plasmid pUC18-P;
(2) DNA with cereuisiae fermentum is that template is carried out pcr amplification; Primer sequence is shown in SEQ ID NO.3 and SEQ ID NO.4; Obtain the IAH1 gene fragment; Plasmid pUC18-the P that uses restriction endonuclease BamH I and Sma I double digestion IAH1 gene fragment and step (1) to make then after connecting with ligase enzyme, obtains plasmid pUC18-PI again;
(3) DNA with cereuisiae fermentum is that template is carried out pcr amplification; Primer sequence is shown in SEQ ID NO.5 and SEQ ID NO.6; Obtain the terminator fragment of ADH1 gene; Use the terminator fragment of restriction endonuclease Sma I and EcoR I double digestion ADH1 gene and plasmid pUC18-PI that step (2) makes then, after connecting with ligase enzyme again, obtain plasmid pUC18-PIT;
(4) with plasmid pUG6 (available from EUROSCARF company; Genebank number: AF298793) carry out pcr amplification for template; Primer sequence obtains the KanMX gene fragment shown in SEQ ID NO.7 and SEQ ID NO.8, the plasmid pUC18-PIT that uses restriction endonuclease Sal I and Kpn I double digestion KanMX gene fragment and step (3) to make then; After connecting with ligase enzyme again, obtain plasmid pUC18-KPIT;
(5) plasmid pUC18-KPIT and the yeast integration plasmid YIP-5 that step (4) are made carry out double digestion with restriction endonuclease Sal I and EcoR I respectively, connect with ligase enzyme then, obtain carrier YIP-KPIT;
(6) the carrier YIP-KPIT electric shock transformed saccharomyces cerevisiae competent cell that step (5) is made; The brewing yeast cell coating screening that transforms is dull and stereotyped; Clone son behind 28 ℃ of cultivation 72h and identify, choose positive strain, promptly get yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2.
The pcr amplification condition is in the said step (1): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 45s, 30 circulations; Last 72 ℃ are extended 7min.
The pcr amplification condition is in the said step (2): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 45s, 30 circulations; Last 72 ℃ are extended 7min.
The pcr amplification condition is in the said step (3): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 30 circulations; Last 72 ℃ are extended 7min.
The pcr amplification condition is in the said step (4): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 75s, 30 circulations; Last 72 ℃ are extended 7min.
The dull and stereotyped component of screening is following in the said step (6): 1% yeast extract, 2% peptone, 2% glucose, 2% agar, 500 μ g/mL G418, excess water.
Above-mentioned cereuisiae fermentum is available from Angel Yeast Co.,Ltd, trade name: Angel beer high activity dried yeast, article No.: 80000005.
The application of above-mentioned yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2 in brewage.
Bacterial strain yeast saccharomyces cerevisiae according to the invention (Saccharomyces cerevisiae) AU2 genetic stability is good, and phenomenon is lost in continuous passage 20 times not producer, and each item performance index are stable.
Description of drawings
Fig. 1 is PGK1P, ADH1T, the segmental agarose gel electrophoresis figure of IAH1 gene amplification;
4500,3000,2250,1500,1000,750,500 wherein: 1 swimming lane: DNA Marker (each segmental length from top to bottom:, 250bp), 2 swimming lanes: PGK1P, 3 swimming lanes: ADH1T, 4 swimming lanes: IAH1 gene;
Fig. 2 is the agarose gel electrophoresis figure of KanMX amplified fragments;
4500,3000,2250,1500,1000,750,500 wherein: 1 swimming lane: DNA Marker (each segmental length from top to bottom:, 250bp), 2 swimming lanes: KanMX amplified fragments;
Fig. 3 is the PCR of plasmid pUC18-KPIT and the agarose gel electrophoresis figure that enzyme is cut evaluation;
4500,3000,2250,1500,1000,750,500 wherein: 1 swimming lane: DNA Marker (each segmental length from top to bottom:, 250bp); 2 swimming lanes: PGK1P+IAH1+ADH1T; 3 swimming lanes: KanMX+PGK1P+IAH1+ADH1T, the Sal I of 4 swimming lanes: pUC18-KPIT and EcoR I double digestion;
Fig. 4 be plasmid YIP5-KPIT PCR and the enzyme agarose gel electrophoresis figure that cuts evaluation;
4500,3000,2250,1500,1000,750,500 wherein: 1 swimming lane: DNA Marker (each segmental length from top to bottom:, 250bp); 2 swimming lanes: the KanMX+PGK1P+IAH1+ADH1T fragment of pcr amplification; The Sal I of 3 swimming lanes: YIP5-KPIT and EcoR I double digestion;
Fig. 5 is the agarose gel electrophoresis figure that the unitary PCR of IAH1 genetic expression identifies in the strains A U2 genome;
2000,1000,750,500,250 wherein: 1 swimming lane: DNA Marker (each segmental length from top to bottom:, 100bp); 2 swimming lanes: PGK1P+IAH1+ADH1T; 3 swimming lanes: PGK1P+IAH1; 5 swimming lanes: IAH1+ADH1T;
Fig. 6 is the agarose gel electrophoresis figure that strains A U2 mitotic stability detects;
4500,3000,2250,1500,1000,750,500 wherein: 1 swimming lane: DNA Marker (each segmental length from top to bottom:, 250bp); 2-11 swimming lane: the unitary pcr amplified fragment of IAH1 genetic expression of 10 bacterium colonies of picking at random.
Embodiment
Below in conjunction with Figure of description and embodiment the present invention is done further elaboration, but institute of the present invention protection domain is not limited thereto.
Cereuisiae fermentum described in the embodiment is the Angel beer high activity dried yeast available from Angel Yeast Co.,Ltd, article No.: 80000005; Plasmid pUG6 is available from EUROSCARF company, and all available from the precious biotinylated biomolecule in Dalian Engineering Co., Ltd, reaction conditions is referring to the working instructions of said product for restriction endonuclease Kpn I, BamH I, Sma I, EcoR I, Sal I and ligase enzyme.
The unitary structure of IAH1 genetic expression that has strong promoter
Each segmental being cloned in the plasmid pUC18 is carried out in the expression cell formation process.Each step clone's flow process is: pcr amplification is treated cloned sequence, and------connection of fragment and plasmid behind the double digestion---connects product and is transformed into the bacillus coli DH 5 alpha competent cell and clone sub the evaluation after---it is dull and stereotyped to be coated with the LB that contains 100 μ g/mL penbritins---37 ℃ cultivated 16h to use the specified restriction endonuclease of each step to carry out the double digestion of fragment and plasmid.
1, the segmental clone of PGK1 gene promoter
Be designed for the primer of amplification yeast saccharomyces cerevisiae self PGK1 gene promoter:
P1:CC/GGTACC/CTTCAACTCAAGACGCACAG (shown in the SEQ ID NO.1) introduces Kpn I (restriction enzyme site is zone between two oblique lines, down together);
P2:GG/GGATCC/TGTTTTATATTTGTTGTAAAAAGTAG (shown in the SEQ ID NO.2) downstream add the BamH I.
DNA with Angel beer high activity dried yeast is that template is carried out pcr amplification, and condition is: 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 45s, 30 circulations; Last 72 ℃ are extended 7min.
Obtain the promotor PGK1P (as shown in Figure 1) of gene PGK1; Use restriction endonuclease Kpn I and BamH I double digestion promotor PGK1P and plasmid pUC18 then, connect with ligase enzyme again, connect product and be transformed into the bacillus coli DH 5 alpha competent cell; After coating contains the LB flat board of 100 μ g/mL penbritins; Cultivate 16h for 37 ℃, the picking positive strain obtains plasmid pUC18-P.
2, the clone of IAH1 gene fragment
Be designed for the primer of amplification IAH1 gene fragment:
I1:GCC/GGATCC/ATGGATTACGAGAAGTTTCT (shown in the SEQ ID NO.3) introduces BamH I site;
I2:GCC/CCCGGG/TCAAGACATTATGTTACATC (shown in the SEQ ID NO.4) introduces Sma I site.
DNA with Angel beer high activity dried yeast is that template is carried out pcr amplification, and condition is: 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 45s, 30 circulations; Last 72 ℃ are extended 7min.
Obtain IAH1 gene fragment (as shown in Figure 1); Use restriction endonuclease BamH I and Sma I double digestion IAH1 gene fragment and plasmid pUC18-P then, connect with ligase enzyme again, connect product and be transformed into the bacillus coli DH 5 alpha competent cell; After coating contains the LB flat board of 100 μ g/mL penbritins; Cultivate 16h for 37 ℃, the picking positive strain obtains plasmid pUC18-PI.
3, the clone of ADH1 gene terminator
Be designed for the segmental primer of amplifying ADH 1 gene terminator:
T1:GG/CCCGGG/GCGAATTTCTTATG (shown in the SEQ ID NO.5) introduces Sma I site,
T2:GG/GAATTC/GCATATCTACAATTGGG (shown in the SEQ ID NO.6) introduces EcoR I site
The DNA of Angel beer high activity dried yeast is that template is carried out pcr amplification, and condition is: 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 30 circulations; Last 72 ℃ are extended 7min.
Obtain the terminator fragment (as shown in Figure 1) of ADH1 gene; Use the terminator fragment and the plasmid pUC18-PI of restriction endonuclease Sma I and EcoR I double digestion ADH1 gene then, connect with ligase enzyme again, connect product and be transformed into the bacillus coli DH 5 alpha competent cell; After coating contains the LB flat board of 100 μ g/mL penbritins; Cultivate 16h for 37 ℃, the picking positive strain obtains plasmid pUC18-PIT.
4, the clone of KanMX resistant gene
Be designed for the segmental primer of amplification KanMX:
K1:GG/GTCGAC/CAGCTGAAGCTTCGTACGC (shown in the SEQ ID NO.7) introduces Sal I site;
K2:CC/GGTACC/GCATAGGCCACTAGTGGATCTG (shown in the SEQ ID NO.8) introduces Kpn I site.
With plasmid pUG6 is that template is carried out pcr amplification, and condition is: 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 75s, 30 circulations; Last 72 ℃ are extended 7min.
Obtain KanMX gene fragment (Fig. 2); Use restriction endonuclease Sal I and Kpn I double digestion KanMX gene fragment and plasmid plasmid pUC18-PIT then, connect with ligase enzyme again, connect product and be transformed into the bacillus coli DH 5 alpha competent cell; After coating contains the LB flat board of 100 μ g/mL penbritins; Cultivate 16h for 37 ℃, the picking positive strain obtains plasmid pUC18-KPIT (qualification result is as shown in Figure 3).
5, the clone of KanMX-PGK1P-IAH1 gene-ADH1T in yeast integration plasmid YIP-5
Plasmid pUC18-KPIT and yeast integration plasmid YIP-5 that step (4) is made carry out double digestion with restriction endonuclease Sal I and EcoR I respectively; Connect with ligase enzyme then; Connect product and be transformed into the bacillus coli DH 5 alpha competent cell, after coating contains the LB flat board of 100 μ g/mL penbritins, cultivate 16h for 37 ℃; The picking positive strain obtains carrier YIP-KPIT (qualification result is as shown in Figure 4).
1, the structure of Wine brewing yeast strain AU2
With the carrier YIP-KPIT electric shock transformed saccharomyces cerevisiae competent cell that embodiment 1 makes, electric shock conversion condition: voltage 1.5kV; Electric capacity 25 μ F; Resistance 200 Ω; Time 5msec, the brewing yeast cell coating screening of conversion is dull and stereotyped, clones son behind 28 ℃ of cultivation 72h and identifies, promptly gets yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2.The component of screening flat board is following: 1% yeast extract, 2% peptone, 2% glucose, 2% agar, 500 μ g/mL G418, excess water.
Clone's is identified and is adopted following steps:
Use primer P1:CC/GGTACC/CTTCAACTCAAGACGCACAG
And I2:GCC/CCCGGG/TCAAGACATTATGTTACATC
And I1:GCC/GGATCC/ATGGATTACGAGAAGTTTCT
And T2:GG/GAATTC/GCATATCTACAATTGGG
Carry out pcr amplification respectively and verify the integrity of the IAH1 genetic expression unit (PGK1P-IAH1-ADH1T) that is incorporated on the brewing yeast cell karyomit(e).
And use primer P1:CC/GGTACC/CTTCAACTCAAGACGCACAG
And T2:GG/GAATTC/GCATATCTACAATTGGG
The IAH1 that increases complete expresses unit segment and checks order, and verifies the unitary exactness of IAH1 genetic expression (as shown in Figure 5) that is incorporated on the genes of brewing yeast group DNA.The pcr amplification condition is with embodiment 1.
The unitary sequence of IAH1 genetic expression of sequencing result and design is compared, and the then explanation strain construction that conforms to fully is correct, obtains yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2.
2, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2 Detection of Stability
With yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) the AU2 cultivation of on the YEPD inclined-plane, going down to posterity; Cultivate and to be forwarded to a new inclined-plane behind the 3d; Go down to posterity and detect after 20 times; The result shows that the IAH1 expression of gene unit that is incorporated on the karyomit(e) is stable, and producer is not lost phenomenon (as shown in Figure 6).
The experiment of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2 brewage lab scale
AU2 extremely to inoculate Angel beer high activity dried yeast and yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) respectively
To the test tube that the 5ml wort is housed; Cultivate 2d in 28 ℃ of incubators; Change the 250ml triangular flask that the 50ml wort is housed over to, change in the 1L triangular flask that the 650mL wort is housed behind 25 ℃ of cultivation 2d, 20 ℃ fermented 6 days; In 2 ℃ of refrigerators, placed 4 days the concentration of ester class during gas chromatographic detection recipient bacterium and transformant brew beer then.The result shows that the ester class concentration during recipient bacterium and transformant brew beer has than big-difference, and fruit-like flavour that transformant brews beer is outstanding.The result sees attached list 1.
The ester class concentration contrast that is brewed beer in subordinate list 1 recipient bacterium and the experiment of transformant brewage lab scale
Claims (8)
1. an Accharomyces cerevisiae (Saccharomyces cerevisiae) AU2, this bacterial strain on November 22nd, 2010 were preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, culture presevation number: CGMCC NO.4355.
2. the construction process of the described yeast saccharomyces cerevisiae of claim 1 (Saccharomyces cerevisiae) AU2, step is following:
(1) DNA with cereuisiae fermentum is that template is carried out pcr amplification; Primer sequence is shown in SEQ ID NO.1 and SEQ ID NO.2; Obtain the promotor PGK1P of gene PGK1; Use restriction endonuclease Kpn I and BamH I double digestion promotor PGK1P and plasmid pUC18 then, after connecting with ligase enzyme again, obtain plasmid pUC18-P;
(2) DNA with cereuisiae fermentum is that template is carried out pcr amplification; Primer sequence is shown in SEQ ID NO.3 and SEQ ID NO.4; Obtain the IAH1 gene fragment; Plasmid pUC18-the P that uses restriction endonuclease BamH I and Sma I double digestion IAH1 gene fragment and step (1) to make then after connecting with ligase enzyme, obtains plasmid pUC18-PI again;
(3) DNA with cereuisiae fermentum is that template is carried out pcr amplification; Primer sequence is shown in SEQ ID NO.5 and SEQ ID NO.6; Obtain the terminator fragment of ADH1 gene; Use the terminator fragment of restriction endonuclease Sma I and EcoR I double digestion ADH1 gene and plasmid pUC18-PI that step (2) makes then, after connecting with ligase enzyme again, obtain plasmid pUC18-PIT;
(4) be that template is carried out pcr amplification with plasmid pUG6; Primer sequence is shown in SEQ ID NO.7 and SEQ ID NO.8; Obtain the KanMX gene fragment; Plasmid pUC18-the PIT that uses restriction endonuclease Sal I and Kpn I double digestion KanMX gene fragment and step (3) to make then after connecting with ligase enzyme, obtains plasmid pUC18-KPIT again;
(5) plasmid pUC18-KPIT and the yeast integration plasmid YIP-5 that step (4) are made carry out double digestion with restriction endonuclease Sal I and EcoR I respectively, connect with ligase enzyme then, obtain carrier YIP-KPIT;
(6) the carrier YIP-KPIT electric shock transformed saccharomyces cerevisiae competent cell that step (5) is made; The brewing yeast cell coating screening that transforms is dull and stereotyped; Clone son behind 28 ℃ of cultivation 72h and identify, choose positive strain, promptly get yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) AU2;
Said cereuisiae fermentum is available from Angel Yeast Co.,Ltd, trade name: Angel beer high activity dried yeast, article No.: 80000005.
3. construction process as claimed in claim 2 is characterized in that, the pcr amplification condition is in the said step (1): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 45s, 30 circulations; Last 72 ℃ are extended 7min.
4. construction process as claimed in claim 2 is characterized in that, the pcr amplification condition is in the said step (2): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 45s, 30 circulations; Last 72 ℃ are extended 7min.
5. construction process as claimed in claim 2 is characterized in that, the pcr amplification condition is in the said step (3): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 30 circulations; Last 72 ℃ are extended 7min.
6. construction process as claimed in claim 2 is characterized in that, the pcr amplification condition is in the said step (4): 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 75s, 30 circulations; Last 72 ℃ are extended 7min.
7. construction process as claimed in claim 2 is characterized in that, the dull and stereotyped component of screening is following in the said step (6): 1% yeast extract, 2% peptone, 2% glucose, 2% agar, 500 μ g/mL G418, excess water.
8. the application of the said yeast saccharomyces cerevisiae of claim 1 (Saccharomyces cerevisiae) AU2 in brewage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010556943 CN102146346B (en) | 2010-11-24 | 2010-11-24 | Saccharomyces cerevisiae and constructing method and application of saccharomyces cerevisiae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010556943 CN102146346B (en) | 2010-11-24 | 2010-11-24 | Saccharomyces cerevisiae and constructing method and application of saccharomyces cerevisiae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102146346A CN102146346A (en) | 2011-08-10 |
| CN102146346B true CN102146346B (en) | 2012-10-17 |
Family
ID=44420820
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010556943 Expired - Fee Related CN102146346B (en) | 2010-11-24 | 2010-11-24 | Saccharomyces cerevisiae and constructing method and application of saccharomyces cerevisiae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102146346B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710278A (en) * | 2013-12-25 | 2014-04-09 | 江南大学 | Industrial rice wine yeast metabolic engineering bacteria with low-yield urea and building method thereof |
| CN111100801B (en) * | 2019-09-09 | 2024-02-23 | 四川农业大学 | Furfural inhibitor tolerant yeast engineering strain, construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1932013A (en) * | 2005-09-13 | 2007-03-21 | 三得利株式会社 | Esterase gene and use thereof |
| CN101880635A (en) * | 2010-05-24 | 2010-11-10 | 中国农业科学院农产品加工研究所 | Saccharomyces cerevisiae mutant strain with high beta-dextran content and application thereof |
-
2010
- 2010-11-24 CN CN 201010556943 patent/CN102146346B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1932013A (en) * | 2005-09-13 | 2007-03-21 | 三得利株式会社 | Esterase gene and use thereof |
| CN101880635A (en) * | 2010-05-24 | 2010-11-10 | 中国农业科学院农产品加工研究所 | Saccharomyces cerevisiae mutant strain with high beta-dextran content and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Mariska Lilly.The effect of increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine and distillates.《Yeast》.2006,第23卷(第9期),641-659. * |
| 张强.啤酒酵母代谢工程研究进展.《中国生物工程杂志》.2009,第29卷(第12期),119-124. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102146346A (en) | 2011-08-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2222860B1 (en) | Method of modifying a yeast cell for the production of ethanol | |
| CN102016024B (en) | Yeast mutant and substance production method using the same | |
| CN102199556B (en) | Saccharomyces cerevisiae genetic engineering bacteria with high ester yield and construction method thereof | |
| CN105385615A (en) | Saccharomyces cerevisiae strain with high yield of ester and low yield of higher alcohol as well as building and application of saccharomyces cerevisiae strain | |
| CN106566779A (en) | Recombinant yeast strain, construction method and application thereof | |
| CN107709540A (en) | Novel warehouse Delhi A Ziweishi Pichia pastoris strains NG7 and application thereof | |
| CN104131005A (en) | High-ester-produced saccharomyces cerevisiae strain and method for seamlessly inserting promoter of high-ester-produced saccharomyces cerevisiae strain | |
| CN101631864A (en) | Method for preparing butanol through butyryl-coa as an intermediate using yeast | |
| US10947519B2 (en) | Yeast strains co-expressing exogenous glucoamylases, the method for obtaining said yeast strains and the use thereof to produce bioethanol | |
| CN106119140A (en) | One plant height tolerance Wine brewing yeast strain and construction method thereof | |
| CN104031854A (en) | Saccharomyces cerevisiae gene engineering strain for improving ethanol tolerance and construction method of saccharomyces cerevisiae gene engineering strain | |
| CN108485996B (en) | Novel ethyl acetate-producing saccharomyces cerevisiae strain and construction method thereof | |
| US20150225747A1 (en) | Mutant yeast strain with decreased glycerol production | |
| CN104403957B (en) | Low protease A excretion yeast strain and its construction method under a kind of stress conditions | |
| CN102146346B (en) | Saccharomyces cerevisiae and constructing method and application of saccharomyces cerevisiae | |
| CN101613707B (en) | Method for producing glutathione by use of metabolic engineering bacteria | |
| Sugiyama et al. | Overexpression of PkINO1 improves ethanol resistance of Pichia kudriavzevii N77-4 isolated from the Korean traditional fermentation starter nuruk | |
| CN101955891A (en) | Beer yeast engineering bacteria capable of improving beer foam property and preparation method | |
| CN104004760A (en) | Foreign protein expression device used for secretory expression in Aspergillus oryzae cells and Aspergillus oryzae genetically engineered bacteria | |
| CN107858368A (en) | The Wine brewing yeast strain and its construction method of one plant of appropriate production higher alcohol | |
| CN104630080B (en) | The yeast strain of low protease A excretion under one plant of stress conditions | |
| ES2776361T3 (en) | Strains of microorganism for the production of 2,3-butanediol | |
| CN108486176B (en) | Saccharomyces cerevisiae for producing ethyl lactate and construction method and application thereof | |
| US20210292734A1 (en) | Increased alcohol production from yeast producing an increased amount of active crz1 protein | |
| CN106434700B (en) | A kind of saccharomyces cerevisiae spt15 fixed point saturation gene mutation method improving alcohol yied |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121017 Termination date: 20141124 |
|
| EXPY | Termination of patent right or utility model |