CN112481265A

CN112481265A - Bacillus subtilis artificial terminator and application thereof

Info

Publication number: CN112481265A
Application number: CN202011451933.4A
Authority: CN
Inventors: 周哲敏; 崔文璟; 林巧; 胡瑞淳; 肖琪; 朱怡炫; 温云哲; 刘续; 钟先格
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-12-09
Filing date: 2020-12-09
Publication date: 2021-03-12
Anticipated expiration: 2040-12-09
Also published as: CN116286814A; CN112481265B; CN116622702A

Abstract

The invention discloses a bacillus subtilis artificial terminator and application thereof, belonging to the technical field of genetic engineering. The invention firstly characterizes the activity of different terminators, and then measures the termination efficiency of the terminators by using different terminator measuring platforms to obtain a series of novel terminators capable of improving the yield of target protein, wherein a green fluorescent protein gene is used as an upstream gene of the terminator, a red fluorescent protein gene is used as a downstream gene of the terminator, and the regulation level of the terminator on the upstream and downstream genes is characterized. The results show that these novel terminators are excellent in both the effect of increasing the expression level of the upstream gene and the effect of suppressing the expression level of the downstream gene. A series of different terminators are applied to the expression of recombinant proteins of nattokinase and pullulanase, and results show that the terminators are beneficial to improving the enzyme activity of the proteins and the protein expression level, so that the terminators have important application value in the production of target proteins in bacillus subtilis.

Description

Bacillus subtilis artificial terminator and application thereof

Technical Field

The invention relates to a bacillus subtilis artificial terminator and application thereof, belonging to the technical field of genetic engineering.

Background

A transcription terminator is a sequence of RNA located downstream of a gene or operon and responsible for the dissociation of RNA polymerase and the release of transcribed RNA, which serves to terminate transcription. In prokaryotes, transcription terminators are of two types, one type being protein factor dependent, and need to function with the aid of protein factors, and consume ATP; the other is a hairpin structure which does not depend on any protein factors and only depends on the reverse palindrome of the hairpin structure and poly-U, also called an internal terminator. Transcription terminators are often located at the 3' end of genes due to their specific secondary structure and thus play an important role in maintaining the stability of mRNA and increasing the half-life of mRNA. Termination of transcription by a terminator is to cause RNA polymerase to be separated from a transcription complex, and thus the efficiency of use of RNA polymerase can be improved and the expression level of a gene can also be increased. Previously, the research on terminators has mainly focused on Escherichia coli, and only a small part of the literature mentions the use in other microorganisms, such as Saccharomyces cerevisiae, etc.

Bacillus subtilis is a production host widely used as food enzyme preparation and important nutritional chemicals. Therefore, the terminator which can regulate and control gene expression in the bacillus subtilis, is stable and high in activity has important application value for preparing target protein, especially protein used in the field of food, and therefore, how to obtain a high-efficiency, good-compatibility and protein expression-adjustable bacillus subtilis artificial terminator subsystem becomes a research hotspot.

Disclosure of Invention

In order to obtain an efficient and good-compatibility bacillus subtilis artificial terminator system capable of regulating protein expression, the invention provides an element for regulating gene expression, wherein the element is a T5 terminator, a T24 terminator, a T31 terminator, a T42 terminator and a T52 terminator, and nucleotide sequences are respectively shown as SEQ ID No. 1-SEQ ID No. 5.

Use of a terminator as claimed in claim 1 for gene expression, wherein the terminator is placed downstream of the gene to be expressed and co-expressed with the gene.

In one embodiment of the invention, the gene is a gene encoding nattokinase or a gene encoding aspartate lyase.

The invention also provides a vector containing the element.

The invention also provides a genetic engineering bacterium for expressing the vector.

The invention also provides a method for regulating and controlling the expression of the target protein in the bacillus subtilis, and the element and the target protein gene are co-expressed.

In one embodiment of the present invention, the Bacillus subtilis comprises Bacillus subtilis 168, Bacillus subtilis WB400, Bacillus subtilis WB600 or Bacillus subtilis WB 800.

In one embodiment of the invention, the protein of interest comprises an enzyme.

The invention also provides the application of the regulatory element or the genetic engineering bacteria in preparing target protein.

The invention also provides the application of the regulatory element or the genetic engineering bacteria in the fields of food, pharmacy or chemical industry.

Advantageous effects

The invention firstly characterizes the activity of a single terminator, and finds that the expression quantity of upstream GFP is improved by 1.98 times and the expression quantity of downstream mcherry is reduced by 33.8 times when the T31 terminator is added compared with the case of not adding the terminator. And taking the green fluorescent protein gene as an upstream gene of the terminator, taking the red fluorescent protein gene as a downstream gene of the terminator, and representing the regulation level of the terminator on the upstream and downstream genes. The results show that the terminators have good effect on inhibiting the downstream gene expression level, for example, when the T42 terminator with the lowest termination efficiency is added, the downstream mCherry expression level is reduced by 1.43 times compared with the control. The terminator of the invention is put in different gene environments, the measured termination efficiency is almost unchanged, and the aim of inhibiting the expression quantity of downstream genes can be achieved. The target proteins with different expression amounts are obtained by taking terminators with different termination strengths as 3' end elements of gene expression, which has important application value for producing the target proteins in bacillus subtilis.

Drawings

FIG. 1: the termination efficiency of the terminators is characterized in that G-mch-5, G-mch-24, G-mch-31, G-mch-42 and G-mch-52 represent the termination efficiency of each terminator determined after inserting the terminators T5, T24, T31, T42 and T52 between GFP and mcherry of the plasmid pBp43-GFP-mcherry, respectively.

FIG. 2: characterization of terminator termination efficiency reporter gene expression levels, where M: protein molecular weight standards; g-mch-0: no terminator is added; g-mch-5, G-mch-24, G-mch-31, G-mch-42, and G-mch-52 show the expression levels of upstream and downstream proteins in different elements measured after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry of plasmid pBp43-GFP-mcherry, respectively.

FIG. 3: characterization of fluorescence intensity of GFP upstream of terminator, wherein control represents the reference plasmid, and G-mch-5, G-mch-24, G-mch-31, G-mch-42, and G-mch-52 represent fluorescence intensities of GFP upstream of each terminator measured after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry of plasmid pBp43-GFP-mcherry, respectively.

FIG. 4: and (3) characterization of the fluorescence intensity of the mchery downstream of the terminator, wherein control represents a reference plasmid, and G-mch-5, G-mch-24, G-mch-31, G-mch-42 and G-mch-52 represent the fluorescence intensity of the mchery downstream of each terminator measured after inserting the terminators T5, T24, T31, T42 and T52 between the GFP and the mchery of the plasmid pBp 43-GFP-mchery, respectively.

FIG. 5: verification of terminator element compatibility, wherein inRBS-5, inRBS-24, inRBS-31, inRBS-42 and inRBS-52 respectively represent the termination efficiency of each terminator determined after inserting the terminators T5, T24, T31, T42 and T52 between GFP and mcherry of plasmid pBp 43-GFP-ins-mcherry.

FIG. 6: characterization of terminator termination efficiency reporter gene expression levels, where M: protein molecular weight standards; inRBS-0: no terminator is added; InRBS-5, inRBS-24, inRBS-31, inRBS-42 and inRBS-52 respectively represent the expression levels of upstream and downstream proteins measured in different elements after terminators T5, T24, T31, T42 and T52 are inserted between GFP and mcherry of plasmid pBp 43-GFP-ins-mcherry.

FIG. 7: characterization of fluorescence intensity of GFP upstream of terminator, wherein control represents the reference plasmid, and inRBS-5, inRBS-24, inRBS-31, inRBS-42 and inRBS-52 represent the fluorescence intensity of GFP upstream of each terminator measured after insertion of the terminators T5, T24, T31, T42 and T52 between GFP and mcherry of the plasmid pBp43-GFP-ins-mcherry, respectively.

FIG. 8: characterization of the mCherry fluorescence intensity downstream of the terminator, wherein control represents the reference plasmid, wherein inRBS-5, inRBS-24, inRBS-31, inRBS-42 and inRBS-52 represent the mChery fluorescence intensities downstream of each terminator, which were measured after inserting the terminators T5, T24, T31, T42 and T52 between GFP and mChery of the plasmid pBp 43-GFP-ins-mChery, respectively.

FIG. 9: the terminator is used for characterization of the expression quantity of the nattokinase, wherein M: protein molecular weight standards; NK-0: no terminator is added; NK-5, NK-24, NK-31, NK-42 and NK-52 represent the expression levels of nattokinase at the upstream of each terminator, which were measured after addition of terminators T5, T24, T31, T42 and T52 to the 3' -end of the nattokinase gene, respectively.

FIG. 10: the terminator is used for characterization of the expression amount of the aspartase, wherein M: protein molecular weight standards; AspA-0: no terminator is added; AspA-5, AspA-24, AspA-31, AspA-42 and AspA-52 respectively represent the amounts of aspartase expression upstream of each terminator, which were measured after addition of the terminators T5, T24, T31, T42 and T52 to the 3' -end of the aspartase gene.

Detailed Description

The following examples refer to the following media:

Luria-Bertani (LB) liquid Medium: 10g/L peptone, 5g/L yeast extract, 10g/L NaCl, pH 7.0. LB solid medium: 1.5% agar powder was added to the LB liquid medium.

Terrific-Broth (TB) medium 12g/L peptone, 24g/L yeast extract, 4g/L NaCl, 17mM KH₂PO₄，72mM K₂HPO₄，pH 7.0。

SP I medium (20 mL): 9.8mL of SP-A solution, 9.8mL of SP-B solution, 200. mu.L of 50% glucose solution, and 200. mu.L of 100 XCAYE solution, which were mixed as they are.

SP II medium (6 mL): 5.88mL SP I Medium, 60. mu.L 50mM CaCl₂Solution, 60 μ L of 250mM MgCl2 solution, ready to use.

SP-A solution: 4g/L (NH)₄)₂SO₄，28g/L K₂HPO₄·3H₂O，12g/L KH₂PO₄2g/L of sodium citrate dihydrate.

SP-B solution: 0.4g/L MgSO₄·7H₂O。

100 × CAYE solution: 20g/L Casamino acid, 100g/L Yeast Extract.

100 × EGTA solution: 3.8g/L ethylene glycol bis (2-aminoethyl ether) tetraacetic acid (EGTA).

LB liquid culture medium and LB solid culture medium containing 1.5% agar are used for screening, culturing and characterizing thalli. TB medium was used for secretory expression of NK.

The transformation method of Bacillus subtilis 168 involved in the following examples was as follows:

selecting a single colony of bacillus subtilis 168, inoculating the single colony into 2mL of SP I culture medium, and shaking the mixture at 37 DEG CCulturing for 12-14h to obtain seed liquid; inoculating the seed solution into 5mL SP I medium according to the inoculation amount of 1% (v/v), and measuring OD after shaking culture at 37 ℃ for 4-5h₆₀₀. When OD is reached₆₀₀When the inoculation amount is 1.0 percent, transferring the bacterial liquid into 2mL of SP II culture medium according to the inoculation amount of 1 percent (v/v), and incubating for 1.5 hours at 37 ℃ and in a shaking table at 200 rpm; adding 20 μ L of 100 XEGTA (ethylene glycol bis (alpha-aminoethyl ether) tetraacetic acid) solution into the tube, culturing in a shaker at 37 deg.C and 200r/min for 10min, and subpackaging with 500 μ L per 1.5mL centrifuge tube; adding proper plasmid which is verified to be correct through sequencing into the tube, uniformly blowing, sucking and placing in a shaking table at 37 ℃ and 200r/min for culturing for 2 h; after the culture is finished, sucking 100 mu L of bacterial liquid, uniformly coating the bacterial liquid on a corresponding selective plate, and culturing at 37 ℃ overnight for 12-14 h.

The detection methods referred to in the following examples:

fluorescence detection of green fluorescent protein GFP:

centrifuging a detection sample at 12000r/min for 5min, collecting thalli, washing with PBS buffer solution for 3 times, finally resuspending the bacteria solution with the PBS buffer solution with the same volume, taking 200 mu L to a 96-hole enzyme label plate, and placing the plate into a Synergy TM H4 fluorescence microplate reader for fluorescence detection. The program is set as follows: detecting the concentration of the thallus at 600 nm; excitation at 495nm, emission at 525nm, gain at 60, and fluorescence intensity measured.

And (3) carrying out fluorescence detection on red fluorescent protein mCherry:

centrifuging a red fluorescent protein mcherry fluorescence detection sample at 12000 rpm for 5min, collecting thalli, washing the thalli for 3 times by PBS buffer solution, using PBS suspension thalli with the same volume, taking 200 mu L to a 96-hole enzyme label plate, and placing the enzyme label plate into a Synergy TM H4 fluorescent enzyme label instrument to detect fluorescence. The program is set as follows: detecting the concentration of the thallus at 600 nm; excitation light 587nm, emission light 610nm, gain 80, detection of fluorescence intensity.

Termination efficiency measurement method:

here we quantify the proportion of the transcriptional extension complex that does not pass through the terminator element by the Termination Efficiency (TE). The TE value of the terminator element which disrupts all the arriving transcription complexes is 100. The TE of the spacer sequences for GFP and mCherry is 0. Because the protein level of the expressed fluorescent reporter gene cannot be directly used to measure the TE value. We used downstream mcherry (FI)_DW) And upstream GFP (FI)_UP) The ratio of fluorescence of (A) to (B) to estimate the terminator read-Through (TR). Namely TR-FI_DW/FI_UP. Reference readthrough values (TR) were established using standardized test sequences (i.e., GFP and mCherry spacer sequences)_REF) Then all TR measurements are normalized: TR (transmitter-receiver)_NORM＝TR/TR_REFAnd estimating the termination efficiency by the following method, TE 100 (1-TR)_NORM)。

SDS-PAGE detection method:

taking out the preserved glycerol strain, streaking to a TB solid plate, culturing at 37 ℃ overnight, picking out a single colony to a test tube, and culturing at 37 ℃ for 8-10 h. According to the initial cell density OD₆₀₀0.05 to 50mL of TB medium in a 250mL conical flask, and cultured at 37 ℃ and 200r/min for 24 h.

SDS-PAGE detection of Nattokinase:

sucking 1mL of fermentation liquid, centrifuging at 12000r/min for 2min, sucking 200 mu L of supernatant, adding 50 mu L of 5 × Loading buffer, boiling in a water bath for 10min, and Loading for detection.

SDS-PAGE detection of aspartate lyase:

taking out 1mL of culture solution in the culture medium, centrifuging at 12000r/min for 2min, collecting thallus, washing with 1 XPBS buffer solution for 3 times, adding TE buffer solution containing 1mg/mL lysozyme for suspension, and bathing at 37 deg.C for 2 h. And (4) carrying out ultrasonic crushing for 3s and 2s until the bacterial suspension is clear and transparent. Centrifuging at 12000r/min for 20min, collecting 200 μ L supernatant, adding 50 μ L5 × Loading buffer, boiling in water bath for 10min, and detecting.

Example 1: construction of terminator plasmid and recombinant expression of fluorescent protein

The method comprises the following specific steps:

(1) a pBp43-GFP-mcherry (G-mch) plasmid is used as a template (a construction method is disclosed in a patent application text with a publication number of CN 111662906A), a whole plasmid PCR is carried out by using a primer insulator-F/R synthesized by the company, a spacer sequence (the sequence is AATTAACAACTGATTCTGAATTCAAAAAATATCATTTGTGATTTGTTTAAAGAAAACGATTTAAAAATTTAAAA) is inserted between GFP and mcherry genes, and the whole plasmid PCR is carried out by using the primer insulator-F/R, so that a reference plasmid (pBp 43-GFP-inRBS-mcherry (abbreviated as inRBS) for measuring the termination efficiency of a new terminator is obtained.

(2) Annealing the synthesized primer sequence with the enzyme cutting site by temperature gradient to form a double chain, connecting the annealed DNA double chain sequence with a reference plasmid pBp 43-GFP-inRBS-mchery by using BamH I and SacII to obtain a fragment, using T4 ligase to construct a plasmid carrying terminators T5, T24, T31, T42 or T52 (shown in table 2), and performing DNA sequencing, wherein the DNA sequencing result shows that the terminators are successfully connected to the enzyme cutting site between GFP and mchery of the plasmids pBp 43-GFP-mchery and pBp 43-GFP-inRBS-mchery, thereby proving that a new shuttle vector of Escherichia coli-Bacillus subtilis is successfully constructed; obtaining recombinant plasmids respectively: pBp43-GFP-T5-mcherry, pBp43-GFP-T24-mcherry, pBp43-GFP-T31-mcherry, pBp43-GFP-T42-mcherry, pBp 43-GFP-T52-mcherry; pBp 43-GFP-T5-inRBS-mchery, pBp 43-GFP-T24-inRBS-mchery, pBp 43-GFP-T31-inRBS-mchery, pBp 43-GFP-T42-inRBS-mchery, pBp 43-GFP-T52-inRBS-mchery.

(3) Transferring the obtained recombinant plasmid with correct sequencing verification into bacillus subtilis 168, performing static culture at 37 ℃ for 12-14h, then selecting a single colony to be cultured in 5mL of LB seed culture medium at 37 ℃; the cells were transferred to a 250mL Erlenmeyer flask containing 50mL LB medium at a final OD600 of 0.05 and cultured at 37 ℃ for 24h at 200 r/min.

In termination efficiency assay platform G-mch, the termination efficiency (FIG. 1 and Table 3), SDS-PAGE protein gel assay (FIG. 2) and fluorescence intensity (FIG. 3, FIG. 4; Table 4, Table 5) of the selected terminators were determined, indicating that there was a difference in the GFP and mCherry expression levels for the different terminators, indicating that the different terminators had different characteristics. The termination efficiency of the terminators T42, T52, T5, T24 and T31 is gradually increased, wherein the upstream GFP expression amount is increased by 1.98 times and the downstream mCherry expression amount is decreased by 33.9 times when the T31 terminator is added compared with the case of not adding the terminator;

in the termination efficiency assay platform inRBS, the termination efficiency (FIG. 5 and Table 6), SDS-PAGE protein gel assay (FIG. 6) and fluorescence intensity (FIG. 7, FIG. 8; Table 7, Table 8) of the selected terminators were determined to be consistent with those detected in the G-mch platform: wherein, when the T31 terminator is added, the upstream GFP expression level is increased by 3 times and the downstream mcherry expression level is decreased by 50 times compared with the case of not adding the terminator. Compared with the control, the protein expression of downstream mcherry is reduced along with the increase of the terminator termination efficiency, and the protein expression is consistent with the fluorescence measurement value.

This experiment shows that five terminators have strong compatibility.

TABLE 1 primer Table

TABLE 2 terminator sequences

TABLE 3 terminator termination efficiency (G-mch)

Terminator name	Termination Efficiency (TE)
		T5	85.09
T24	90.90
		T31	98.42
T42	43.33
		T52	58.07

TABLE 4 fluorescent intensity of terminator upstream GFP (G-mch)

Terminator name	Upstream GFP fluorescence intensity (FT)_GFP/OD₆₀₀)
		Control (G-mch)	10225
T5	18047
		T24	19032
T31	20214
		T42	13400
T52	17193

TABLE 5 luminescence intensity of mCherry downstream of terminator (G-mch)

Terminator name	Downstream mcherry fluorescence intensity (FT)_mcherry/OD₆₀₀)
		Control (G-mch)	11648
T5	2889
		T24	1922
T31	344
		T42	8157
T52	7613

TABLE 6 terminator termination efficiency (inRBS)

Terminator name	Termination Efficiency (TE)
		T5	88.87
T24	92.46
		T31	99.34
T42	48.71
		T52	72.69

TABLE 7 terminator upstream GFP fluorescence intensity (inRBS)

Terminator name	Upstream GFP fluorescence intensity (FT)_GFP/OD₆₀₀)
		Control (inRBS)	6533
T5	14350
		T24	15294
T31	19658
		T42	9346
T52	11643

TABLE 8 terminator downstream mCherry fluorescence intensity (inRBS)

Terminator name	Downstream mcherry fluorescence intensity (FT)_mcherry/OD₆₀₀)
		Control (inRBS)	14621
T5	3943
		T24	2600
T31	292
		T42	10770
T52	6988

Example 2: construction of nattokinase protein recombinant expression system by using terminator

(1) The primer sequences were synthesized by the company (see Table 9).

(2) Constructing a nattokinase protein recombinant expression system: PBP43-GFP-mcherry is taken as a template, a primer temp-NK-F/R is used, and a framework is obtained by PCR amplification; obtaining a PUT fragment by a PCR amplification method by taking pBS04-pro-NK as a template and NK-F/R as a primer; and performing double-fragment assembly (infusion assembly) on the fragment NK and the skeleton, then transforming JM109, finally obtaining a new plasmid and performing DNA sequencing, wherein the DNA sequencing result shows that the plasmid PBP43-NK-0term (not connected with the terminator of the invention) is successfully obtained, and the new Escherichia coli-Bacillus subtilis shuttle vector is successfully constructed.

(3) Using PBP43-NK-0term as a template and primers with different terminators, see Table 1, plasmids were obtained by whole plasmid PCR and DNA sequencing, which indicated successful plasmids PBP43-NK-5term, PBP43-NK-24term, PBP43-NK-31term, PBP43-NK-42term, PBP43-NK-52 term.

(4) Transferring the obtained recombinant plasmid with correct sequencing verification into bacillus subtilis 168, performing static culture at 37 ℃ for 12-14h, then selecting a single colony to be cultured in 5mL of TB seed culture medium at 37 ℃; according to the initial cell density OD₆₀₀The cells were transferred to a 250mL Erlenmeyer flask containing 50mL TB medium at 200r/min and 37 ℃ for 24 h.

(5) Taking the supernatant of the fermentation broth, and verifying the expression amount by SDS-PAGE (see FIG. 9); the expression level of NK-24 and NK-42 with addition of the terminator was slightly increased as compared with that without addition of the terminator.

TABLE 9 terminator primers Table

Example 3: construction of recombinant expression system of aspartase by using terminator

(1) The primer sequences were synthesized by the company (see Table 9).

(2) Construction of the recombinant expression system for aspartase: taking PBP43-GFP-mcherry as a template, and obtaining a framework through PCR amplification by using a primer AspA-v-F/R; an AspA fragment is obtained by a PCR amplification method by taking pBp43-ECAspA as a template and AspA-i-F/R as a primer. And carrying out double-fragment assembly (infusion assembly) on the fragment AspA and the skeleton, then transforming JM109, finally obtaining a new plasmid and carrying out DNA sequencing, wherein the DNA sequencing result shows that the plasmid PBP43-AspA-0term (not connected with the terminator of the invention) is successfully obtained, and the new Escherichia coli-Bacillus subtilis shuttle vector is successfully constructed.

(3) Plasmid was obtained by whole plasmid PCR using PBP43-AspA-0term as a template and primers with different terminators and DNA sequencing, which indicated successful acquisition of plasmids PBP43-AspA-5term, PBP43-AspA-24term, PBP43-AspA-31term, PBP43-AspA-42term, and PBP43-AspA-52 term.

(5) Taking a certain amount of fermentation liquor, and verifying the expression quantity by SDS-PAGE (see figure 10); compared with AspA-0 without the terminator, the expression levels of AspA-5 and AspA-31 are obviously improved, and are about 2-3 times.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> bacillus subtilis artificial terminator and application thereof

<130> BAA201240A

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 55

<212> DNA

<213> Artificial sequence

<400> 1

aaaaagagga gtagtgcctg agcagaggca ctaactcctc ttttgtcaat aacca 55

<210> 2

<211> 44

<212> DNA

<213> Artificial sequence

<400> 2

tgaaacagcc ctttctacgg gaagggctgt ttatattggg atgc 44

<210> 3

<211> 44

<212> DNA

<213> Artificial sequence

<400> 3

aaaaagactc cgtctaataa gacggagtct ttttttattt cgtt 44

<210> 4

<211> 41

<212> DNA

<213> Artificial sequence

<400> 4

agacgcggcc ggagtgcatc cggccgttct attgactaaa a 41

<210> 5

<211> 42

<212> DNA

<213> Artificial sequence

<400> 5

gcgaacaggg cttttttaga agccctgttt ttttattttt ct 42

Claims

1. An element for regulating gene expression, which is characterized in that the element is a T5, T24, T31, T42 and T52 terminator, and the nucleotide sequences are respectively shown as SEQ ID NO. 1-SEQ ID NO. 5.

2. Use of a terminator as claimed in claim 1 for gene expression, wherein the terminator is placed downstream of the gene to be expressed and co-expressed with the gene.

3. Use according to claim 1 or 2, wherein the gene is a gene encoding nattokinase or a gene encoding aspartate lyase.

4. A vector comprising the element of claim 1.

5. A genetically engineered bacterium expressing the vector of claim 4.

6. A method for regulating the expression of a target protein in Bacillus subtilis, wherein the element of claim 1 is co-expressed with a target protein gene.

7. The method of claim 6, wherein the Bacillus subtilis comprises Bacillus subtilis 168, Bacillus subtilis WB400, Bacillus subtilis WB600, or Bacillus subtilis WB 800.

8. The method of claim 6 or 7, wherein the protein of interest comprises an enzyme.

9. Use of the element of claim 1 or the genetically engineered bacterium of claim 5 for the preparation of a protein of interest.

10. Use of the element of claim 1 or the genetically engineered bacterium of claim 5 in the fields of food, pharmaceutical or chemical industry.