CN113073108B

CN113073108B - Quorum sensing type bidirectional regulation and control system and application thereof

Info

Publication number: CN113073108B
Application number: CN202110453615.XA
Authority: CN
Inventors: 史锋; 刘海艳; 李永富
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-04-26
Filing date: 2021-04-26
Publication date: 2022-10-11
Anticipated expiration: 2041-04-26
Also published as: CN113073108A

Abstract

The invention discloses a quorum sensing type bidirectional regulation and control system and application thereof, and belongs to the field of genetic engineering. The quorum sensing positive regulation system can automatically and inducibly up-regulate target genes, and the activation multiple reaches 6.35 times. The quorum sensing negative regulation system can self-induce the down-regulated target gene, and the inhibition rate reaches 36-96%. The invention obtains 18 population density dependent promoters P with different strengths by screening _srfA M, expression intensity of which is native type P _srfA 0.4-1.5 times of the promoter. The quorum sensing bidirectional dynamic regulation system can simultaneously self-inducibly up-regulate and down-regulate the expression of different or same target genes. The screened population density-dependent mutant promoter is applied to a population induction type self-induction system, and the expression of a target gene in corynebacterium glutamicum can be regulated and controlled more flexibly and in a self-induction manner.

Description

Quorum-sensing bidirectional regulation and control system and application thereof

Technical Field

The invention relates to a quorum sensing type bidirectional regulation and control system and application thereof, and belongs to the field of genetic engineering.

Background

Corynebacterium glutamicum is a recognized food-safe production strain, is applied to the biological production of more than 70 products such as amino acids, organic acids, alcohols, proteins and the like, and has a yield value of more than one billion yuan. For corynebacterium glutamicum, the traditional genetic modification strategies mainly include gene overexpression, gene knockout and the like, which can improve the productivity of the strain to a certain extent, but have a certain limit, and influence the growth of the strain and cause burden on the cell growth. In recent years, several synthetic biological tools have been gradually applied to the dynamic regulation and metabolic engineering of Corynebacterium glutamicum, such as the branched-chain amino acid and methionine biosensor Lrp-P _brnFE Lysine biosensor LysG-P _lysE Shikimic acid biosensor ShiR-P _shiA However, there are limited dynamic regulatory elements of this type endogenous in C.glutamicum. Therefore, it is necessary to find new dynamic regulatory elements which can be applied to Corynebacterium glutamicum.

The quorum sensing system is an auto-induction system in organisms that regulates gene expression as cell density increases, and does not require the addition of exogenous inducers, but rather utilizes fine cellsAutoinducers secreted by the cells themselves. There are three main types of autoinducers: homoserine Lactones (AHLs) secreted by gram-negative bacteria, auto-inducible peptides (AIP) secreted by gram-positive bacteria, and AI-2 mediating communication between gram-negative and positive bacterial species. The autoinducer from the ComQXPA quorum sensing system of the gram-positive bacterium Bacillus subtilis belongs to the AIP molecular class. The system consists of4 genes comX, comQ, comP and comA, wherein comX codes for a leader peptide (Pre-ComX) with 55 amino acid residues, and the leader peptide is modified by the coding product isoprene transferase ComQ of comQ gene to generate active isoprenoid polypeptide pheromone ComX consisting of 10 amino acid residues at the C terminal. As the bacteria grow and population density increases, the ComX pheromone molecule released extracellularly accumulates. When a certain threshold is reached, the pheromone ComX binds to the transmembrane protein histidine kinase ComP and activates this enzyme, promoting its autophosphorylation. Phosphorylated ComP then transfers phosphate groups to ComA regulatory proteins and activates the proteins. The activated ComA protein then binds to the promoter of the downstream target gene and activates the expression of the downstream target gene, and P _srfA Is one of the target promoters of the ComQXPA system.

Small molecule regulatory RNAs (sRNA) are non-coding RNAs with sequence length of 50-200 nucleotides, and are mainly used as regulatory factors to maintain stable translation and information transmission. One type of sRNA forms a secondary structure to recruit an RNA molecular chaperone Hfq, targets mRNA in a base pairing mode, promotes hybridization between sRNA and mRNA, and inhibits translation. At the same time, hfq recruits ribonuclease E (rnase) to accelerate mRNA degradation. Thus, the hfq-sRNA system can inhibit gene expression. Malayne et al introduced the hfq-sRNA system into Corynebacterium glutamicum to negatively regulate the expression of the green fluorescent protein gene gfp with an inhibition rate of 86.7%, and further applied the system to the inhibition regulation of other genes in the glutamate synthesis pathway, thereby increasing the yield of the metabolite glutamate. The hfq-sRNA system is coupled with a quorum sensing system, so that a set of self-induced down-regulation system suitable for the Corynebacterium glutamicum is developed, and metabolic engineering of the Corynebacterium glutamicum can be better served.

The quorum sensing system is applied to metabolic engineering, and gene expression can be automatically regulated without adding an inducer, so that the quorum sensing system is an economic and ideal technical means. At present, various quorum sensing systems have been developed in literature reports and applied to metabolic engineering regulation of escherichia coli, bacillus subtilis, saccharomyces cerevisiae and the like. However, the development and use of quorum-sensing regulatory elements in C.glutamicum is still open. Therefore, the modification of a heterologous quorum-sensing self-induction system and the introduction of the quorum-sensing self-induction system into corynebacterium glutamicum are good gene loop modification strategies, can enrich the types of dynamic regulatory elements of corynebacterium glutamicum, and promote the metabolic engineering modification of corynebacterium glutamicum. Therefore, how to obtain an available and effective quorum-sensing self-induction tool for corynebacterium glutamicum and realize automatic and dynamic regulation of gene expression is still an important technical problem.

Disclosure of Invention

[ problem ] to

The development and application of effective quorum sensing systems and automatic dynamic regulation of gene expression in corynebacterium glutamicum are still in the blank stage.

[ solution ]

The invention firstly uses the comQXPA operon derived from bacillus subtilis and the improved target promoter P thereof _srfA Introduced into Corynebacterium glutamicum SN01, the constructed ComQXPA quorum sensing system can regulate and control the expression of target genes in a quorum density dependent manner, with the increasing of cell density, pheromone molecules ComX are continuously accumulated outside cells, and target promoter P is activated in a positive correlation manner _srfA Thereby achieving cell density-dependent positive regulation of the target gene.

On the basis, an escherichia coli-derived hfq-sRNA expression cassette is designed and introduced to be subjected to population density dependent promoter P _srfA So as to construct a hfq-sRNA expression system based on ComQXPA quorum sensing, and activate P in a positive correlation mode along with the increase of population density _srfA A promoter that upregulates expression of the hfq-sRNA cassette, thereby enhancing expression of the target geneInhibition to achieve cell density dependent negative regulation of the target gene.

To better modify the ComQXPA population density-dependent up-and down-regulation process, P _srfA The promoter is used as a template, and the PCR mode is used for constructing P by using a large primer to mutate _srfA A promoter mutation library to obtain a series of mutant promoters P with different strengths _srfA And M. Selection of appropriately Strength mutant promoter P _srfA Mn respectively regulates and controls the expression of a first Target gene positioned on a Sensor plasmid and the expression of an hfq-sRNA box of a second Target gene positioned on a Target plasmid, and simultaneously realizes the bidirectional regulation effect of population density dependent up-regulation/positive regulation of the first Target gene and population density dependent down-regulation/negative regulation of the second Target gene.

The invention aims to provide a quorum sensing self-induction system which comprises a positive regulation type self-induction system, a negative regulation type self-induction system and a positive and negative bidirectional dynamic regulation system.

In one embodiment, the positive regulation type self-induction system comprises a Sensor module and a Target module,

the Sensor module contains a lrp-P acceptor _brnFE Biosensor regulated comQXPA operon,

the Target module contains a promoter P _srfA A first target gene that is regulated.

In one embodiment, the negative regulated self-induced system comprises a Sensor module and a Target module,

the Sensor module contains a lrp-P acceptor _brnFE The biosensor regulated comQXPA operon,

the Target module contains a promoter P _srfA Promoter P _tacM A first target gene, and an hfq-sRNA expression cassette for the first target gene; the sRNA on the Target module has the same expression direction with the hfq gene and has the opposite expression direction with the Target gene; the hfq gene is subjected to P _srfA The sRNA and the first target gene are controlled by the promoter P _tacM Regulating and controlling; the downstream of the sRNA is also connected with a MicC scaffold sequence; the terminator rrnB T1T2 is located in the MicC scaffold sequence and hfq geneIn between.

In one embodiment, the positive and negative bidirectional dynamic regulation and control system comprises a Sensor module and a Target module,

the Sensor module contains a promoter P _srfA A second target gene, lrp-P _brnFE A biosensor and comQXPA operon; the second target gene on the Sensor module is subjected to promoter P _srfA Regulation, comQXPA operon by lrp-P _brnFE The biological sensor is used for controlling the biological sensor,

the Target module contains a promoter P _srfA Promoter P _tacM A first target gene, and a hfq-sRNA expression cassette of the first target gene; the sRNA on the Target module has the same expression direction with the hfq gene, and the expression direction is opposite to that of the first Target gene; the hfq gene is subjected to a promoter P _srfA sRNA and the first target gene are regulated by promoter P _tacM Regulating and controlling; the downstream of the sRNA is also connected with a MicC scaffold sequence; the terminator rrnB T1T2 is located between the MicC scaffold sequence and the hfq gene.

In one embodiment, the promoter P _srfA The nucleotide sequence of (A) is shown in any one of SEQ ID NO. 3-21;

in one embodiment, the lrp-P _brnFE The nucleotide sequence of the biosensor is shown as SEQ ID NO. 22; the nucleotide sequence of the comQXPA operon is shown as SEQ ID NO. 23; the promoter P _tacM The nucleotide sequence of (A) is shown as SEQ ID NO. 24.

In one embodiment, the sRNA of the hfq-sRNA expression cassette has a sequence from the translation initiation site of the first target gene to base 24 or from the translation initiation site to base 24 following the signal peptide of the first target gene; the nucleotide sequence of the hfq gene is shown in SEQ ID NO. 25; the nucleotide sequence of the MicC scaffold sequence is shown as SEQ ID NO.26, and the nucleotide sequence of the terminator rrnB T1T2 is shown as SEQ ID NO. 27.

In one embodiment, the nucleotide sequences of the first and second target genes are coding regions of a target gene.

In one embodiment, the Sensor module and Target module are located on two plasmids, respectively; the Sensor module is located on the pDTW107 plasmid, and the Target module is located on the pJYW-5 plasmid, respectively.

It is a second object of the present invention to provide cells containing the above quorum-sensing self-induction system.

In one embodiment, the cell is corynebacterium glutamicum.

In one embodiment, the corynebacterium glutamicum includes corynebacterium glutamicum subsp.

The third purpose of the invention is to provide a method for constructing the quorum sensing positive regulation type self-induction system, which comprises the following steps:

1) Construction of the Sensor plasmid: mixing lrp-P _brnFE The biosensor was ligated upstream of the comQXPA operon and onto the pDTW107 plasmid, resulting in the quorum-sensing auto-inducible system sensor plasmid pS1.

2) Construction of Target plasmid: the promoter P _srfA Ligated to pJYW-5 plasmid (disclosed in patent publication No. CN 103834679B) upstream of the first target gene to obtain sensor plasmid pT2 of quorum sensing self-induction system.

3) Transformation of the two plasmids: the Sensor plasmid constructed in the step 1) and the Target plasmid constructed in the step 2) are introduced into Corynebacterium glutamicum SN01 together.

In one embodiment, the lrp-P _brnFE The nucleotide sequence of the sensor is shown in SEQ ID NO. 22.

In one embodiment, the comQXPA operon has a nucleotide sequence set forth in SEQ ID No. 23.

In one embodiment, the promoter P _srfA The nucleotide sequence of (A) is shown in any one of SEQ ID NO. 3-21.

The fourth purpose of the invention is to provide a method for constructing the quorum sensing negative regulation type self-induction system, which comprises the following steps:

1) Construction of the Sensor plasmid: mixing lrp-P _brnFE The biosensor was ligated upstream of comQXPA operon and cloned into pDTW107 plasmid to give sensor plasmid pS1。

2) Construction of Target plasmid: with P _tacM -sRNA(gfp)-scaffold-rrnB T1T2-P _tacM Fragment as template, amplifying P _tacM -sRNA (target) -scaffold-rrnB T1T2 fragment with P _srfA Promoter, hfq gene, first target gene, and promoter P _tacM The fragments were fused in sequence and cloned into pJYW-5 plasmid.

3) Transformation of the plasmid: introducing the Target plasmid constructed in the step 2) and the Sensor plasmid constructed in the step 1) into the corynebacterium glutamicum SN01 together.

In one embodiment, said P _tacM -sRNA(gfp)-scaffold-rrnB T1T2-P _tacM The nucleotide sequence of the fragment is shown as SEQID NO. 1.

In one embodiment, the nucleotide sequence of the hfq gene is set forth in SEQ ID No. 25.

The fifth purpose of the invention is to provide a method for constructing the positive and negative bidirectional dynamic regulation and control system, which comprises the following steps:

1) Construction of the Sensor plasmid: will P _srfA The promoter was fused to the second target gene and inserted into lrp-P _brnFE Upstream of the biosensor, lrp-P _brnFE The biosensor was ligated upstream of the comQXPA operon and cloned into the pDTW107 plasmid.

2) Construction of Target plasmid: with P _tacM -sRNA(gfp)-scaffold-rrnB T1T2-P _tacM Amplification of P with fragment as template _tacM -sRNA (target) -scaffold-rrnB T1T2 fragment with P _srfA Promoter, hfq gene, first target gene, and promoter P _tacM The fragments were fused in sequence and cloned into pJYW-5 plasmid.

3) Transformation of the two plasmids: the Target plasmid constructed in the step 2) and the Sensor plasmid constructed in the step 1) are jointly added into the corynebacterium glutamicum SN01.

The invention also protects the application of the quorum sensing positive regulation type self-induction system in the dynamic regulation and metabolic engineering modification of corynebacterium glutamicum.

The invention also protects the use of a quorum sensing positively regulated autoinduction system in the production of corynebacterium glutamicum metabolites or products containing corynebacterium glutamicum metabolites.

The invention also protects the application of the quorum sensing negative regulation type self-induction system in dynamic regulation and metabolic engineering modification of corynebacterium glutamicum.

The invention also protects the application of the quorum sensing negative regulated self-induction system in the production of corynebacterium glutamicum metabolites or products containing corynebacterium glutamicum metabolites.

The invention also protects the application of the positive and negative bidirectional dynamic regulation system in the dynamic regulation and metabolic engineering modification of corynebacterium glutamicum.

The invention also protects the application of the positive and negative bidirectional dynamic regulation system in the production of corynebacterium glutamicum metabolites or products containing corynebacterium glutamicum metabolites.

Has the advantages that:

the invention provides a method based on ComQXPA-P _srfA The difunctional quorum sensing regulation system can be used for automatically regulating the expression of target genes in corynebacterium glutamicum according to cell density.

ComQXPA-P _srfA The mediated quorum sensing positive regulation system can up-regulate the expression of target genes such as GFP in a self-inducing manner, and the activation multiple of GFP protein expression is 6.35 times.

ComQXPA-P _srfA The expression of target genes such as gfp can be self-induced down-regulated by combining with the hfq-sRNA mediated quorum sensing negative regulation system, and the inhibition rate of self-induced down-regulation is 36-96%.

From P _srfA The 18 population density-dependent promoters P with different strengths are obtained by co-random screening in a mutant library _srfA M, expression intensity of which is native type P _srfA Starting up0.4-1.5 times of the total weight of the seed.

ComQXPA-P _srfA The mediated quorum sensing bidirectional dynamic regulation system can simultaneously self-inducibly up-regulate and down-regulate the expression of different or identical target genes. For example, the expression of the red fluorescent protein mCherry can be simultaneously up-regulated and the expression of the green fluorescent protein gfp can be simultaneously down-regulated, and the expression of the same gene, such as the alpha-amylase gene amyE, can be simultaneously up-regulated and down-regulated and the expression intensity can be flexibly regulated, thereby well proving that the system can automatically and flexibly regulate the expression of a target gene in Corynebacterium glutamicum in a population density dependent manner.

Meanwhile, the population density-dependent mutant promoter obtained by screening is applied to a gene expression positive regulation system or negative regulation system of corynebacterium glutamicum, so that the expression of a target gene in the corynebacterium glutamicum can be regulated and controlled more flexibly and in a self-inducing manner.

Drawings

FIG. 1 is based on ComQXPA-P _srfA The group induction self-induction positive regulation system.

FIG. 2 is based on ComQXPA-P _srfA The quorum sensing negative regulation system.

FIG. 3 quorum-sensing P _srfA And (5) characterizing the strength of the M promoter.

FIG. 4 is based on ComQXPA-P _srfA The group induction bidirectional dynamic regulation and control system.

Detailed Description

The detection method comprises the following steps:

the fluorescence intensity detection method comprises the following steps: the strain is activated on an LBB solid plate for 36-48h, then is transferred into an LBG liquid culture medium for pre-culture for 12h, and is transferred into the LBG culture medium for formal culture for 36h. Sampling from a shake flask at intervals of 4h during formal culture, centrifuging, then suspending in 0.9% NaCl solution, diluting to a proper multiple, adding a 96-well plate, and monitoring the fluorescence intensity by using an enzyme-labeling instrument, wherein the excitation wavelength of green fluorescence is 490nm (the bandwidth is 20 nm), and the emission wavelength is 520nm (the bandwidth is 20 nm); the excitation wavelength of the red fluorescence is 579nm (bandwidth 20 nm) and the emission wavelength is 616nm (bandwidth 20 nm).

And (3) detecting the activity of the alpha-amylase: the alpha-amylase expression strain (including up-regulation expression strain and down-regulation expression strain) is pre-cultured in LBG liquid culture medium for 12h, then transferred to LBG culture medium for formal culture for 36h, samples are taken at 12h and 48h respectively, the activity of the alpha-amylase is detected by an iodine colorimetric method (national standard), and the activity of the alpha-amylase is calculated according to a formula.

SDS-PAGE: the alpha-amylase expression strain (including up-regulation expression strain and down-regulation expression strain) is pre-cultured in LBG liquid culture medium for 12h, then transferred to LBG culture medium for formal culture for 36h, samples are respectively taken at 12h and 48h, the samples are lyophilized and concentrated, then resuspended in PBS buffer solution, boiled and then subjected to SDS-PAGE protein electrophoresis.

Culture medium:

LBB medium: 2.5g/L of yeast extract, 5g/L of sodium chloride, 5g/L of peptone and 18.5g/L of brain-heart infusion.

LBG medium: 5g/L of yeast extract, 10g/L of sodium chloride, 10g/L of peptone and 15g/L of glucose.

PBS buffer: weighing 8gNaCl,0.2g KCl,1.44g K ₂ HPO ₄ ，0.24g KH ₂ PO ₄ Using 900ml ddH ₂ Dissolving O, then making the volume to be 1L, and adjusting the pH to 7.4.

Strains and plasmids:

corynebacterium glutamicum subsp lactofermentum SN01: the strain has a accession number of CCTCC NO: M2014410, and is described and published in an article by Appl Microbiol Biotechnol,2015,99 (9): 3851-3863.

Bacillus subtilis 168: the strain deposit number is ATCC 23857.

pJYW-4-gfp plasmid: it is disclosed in Dynamic control of 4-hydroxyisoeucine biosyntheses by modified l-isoeucine biosensior in recombinant Corynebacterium glutamicum ACS Synth. Biol.9, 2378-2389.

pJYW-5 plasmid: disclosed in publication No. CN 103834679B.

pIL-I plasmid: it is disclosed in the patent publications Dynamic control of 4-hydroxyisoglucine biosyntheses by modified L-isoglucine biosensin in recombinant Corynebacterium glutamicum ACS Synth. Biol.9, 2378-2389.

pDTW107 plasmid: disclosed in patent publication No. CN 103409446A.

The sRNA design approach is: the sequence of the sRNA targeting gfp is a fragment from the translation initiation site (AUG) of the gfp gene to the 24 th base; the amyE secreted protein, and therefore the sequence of sRNA targeting amyE, is a fragment from the translation start site to base 24 after the signal peptide.

Example 1 based on ComQXPA-P _srfA The construction and verification of the group induction self-induction positive regulation system

(1) Construction of pTarget plasmid pT 2:

bacillus subtilis 168 genome is used as a template, and primers F1 and R1 are used for amplifying P _srfA A promoter, taking pJYW-4-gfp as a template, and amplifying a target gene gfp fragment by using a primer F2 and a primer R2; then P was subjected to overlap PCR by primers F1 and R2 _srfA The promoter was ligated to the gfp fragment and ligated to Kpn I-BamHI-digested pJYW-5 vector to construct the basic pTarget plasmid pT2 (FIG. 1).

(2) Construction of pSensor plasmid pS 1:

taking the plasmid pIL-I as a template, and amplifying lrp-P by using primers F3 and R3 _brnFE Fragments were amplified using b.subtilis 168 genome as template and primers F4 and R4 to obtain comQXPA gene cluster without promoter, and the two fragments were fused by overlap PCR using primers F3 and R4 and then ligated to BstZ 17I-treated pDTW107 plasmid in a one-step cloning manner to construct pSensor plasmid pS1 (fig. 1).

(3) Based on ComQXPA-P _srfA Strain construction of quorum sensing systems of (1):

simultaneously electrotransfering pTarget plasmid pT2 and pSensor plasmid pS1 into Corynebacterium glutamicum SN01, culturing for 12-16 h, extracting plasmid, and performing PCR verification to obtain the plasmid containing ComQXPA-P _srfA Strain QS1T2 of quorum sensing system.

And (3) electrically transferring the pTarget plasmid pT2 into Corynebacterium glutamicum SN01, culturing for 12-16 h, extracting the plasmid, and performing PCR verification to obtain the correct RT2 strain.

RT1 strains: plasmid pJYW-4-gfp is used as template, and primers F0 and R7 are used to amplify the plasmid with P _tacM Of gfp fragment byThe step cloning mode is connected to a pJYW-5 vector, the E.coli JM109 competent cells are chemically transformed, and the electric transfer is carried out to SN01, namely the strain RT1, after the plasmid is extracted and verified to be correct.

(4) Based on ComQXPA-P _srfA Basic characterization of a quorum-sensing positive regulation system

Respectively activating the strains QS1TA, RT2 and RT1 obtained in the step (3) on an LBB flat plate for 36-48h, transferring the strains to an LBG liquid culture medium for pre-culture for 12h, and then transferring the strains to the LBG liquid culture medium for formal culture for 36h. During the culture period, samples were taken at intervals of4 hours and cell density and fluorescence were measured.

The results showed that the fluorescence intensity of strain QS1T2 was increased 6.35-fold in a cell density-dependent manner between 8 and 36h, whereas the fluorescence intensity of RT2 strain without pSensor plasmid pS1 and with pT2 plasmid only was increased only 1.88-fold. Compared with the RT2 strain, the fluorescence of the strain QS1T2 is enhanced by 4.07 times, and is positively correlated with the cell density, and the fluorescence is enhanced in a cell density-dependent mode. With constitutive strong promoter P _tacM Compared with an RT1 strain for regulating gfp gene expression, the fluorescence level of the strain QS1T2 is enhanced by 2.07 times, so that a quorum-sensing promoter P can be seen _srfA Stronger than the strong constitutive promoter P _tacM 。

The above results indicate that ComQXPA-P _srfA The mediated quorum sensing system can activate the transcription of a target promoter in corynebacterium glutamicum, so as to activate the expression of a target gene, and the activation mode is a cell density sensing type.

TABLE 1 sequence listing

Example 2 based on ComQXPA-P _srfA Construction and verification of quorum-sensing self-induced negative regulation system of hfq-sRNA

Primer sequences are shown in example 1.

(1) Construction of downregulated/negatively regulated pTarget plasmid pT 6:

by chemically synthesized P _tacM -sRNA(gfp)-scaffold-rrnB T1T2-P _tacM The fragment (SEQ ID NO. 1) is used as a template, and primers F5 and R5 are used for amplifying a DNA fragment containing a constitutive promoter P _tacM And fragments of sRNA of the target gene, i.e. sRNA (gfp), micC scaffold sequence and rrnB T1T2; amplification of P ahead of hfq with primers F8 and R1 using B.subtilis 168 genomic DNA as template _srfA A promoter; amplifying the hfq fragment by using primers F6 and R6 by using Escherichia coli MG1655 genome DNA as a template; pJYW-4-gfp as template was used to amplify the DNA fragment carrying P with primers F7 and R7 _tacM A target gene gfp fragment of the promoter. These four fragments were joined by overlap PCR using primers F5 and R7, wherein the gfp gene orientation was opposite to hfq, the MicC scaffold sequence was followed by a terminator, and ligated with Kpn I, bamHI-digested pJYW-5 vector to construct a down-regulated pTarget plasmid pT6 for the target gene gfp (FIG. 2).

(2) Construction of downregulated/negatively regulated pTarget plasmid pT 7:

by chemically synthesized P _tacM -sRNA(gfp)-scaffold-rrnB T1T2-P _tacM The fragment (SEQ ID NO. 1) was used as a template to amplify a DNA fragment containing sRNA (gfp), a MicC scaffold sequence, rrnB T1T2 and P using primers F10 and R9 _tacM A fragment of (a); amplification of P preceding sRNA (gfp) with primers F9 and R8 using B.subtilis 168 genomic DNA as a template _srfA A promoter; amplifying the hfq fragment by using primers F6 and R6 by using Escherichia coli MG1655 genome DNA as a template; pJYW-4-gfp as template and primer F7 and R7 for amplifying gene carrying P _tacM Gfp fragment of promoter. These four fragments were subjected to overlap PCR ligation using primers F9 and R7, wherein the gfp gene orientation was opposite to hfq, the MicC scaffold sequence was followed by a terminator, and ligated with Kpn I, bamHI-digested pJYW-5 vector to construct a down-regulated pTarget plasmid pT7 for the target gene gfp (FIG. 2).

(3) Construction of downregulated/negatively regulated pTarget plasmid pT 8:

by chemically synthesized P _tacM -sRNA(gfp)-scaffold-rrnB T1T2-P _tacM The fragment (SEQ ID NO. 1) was used as a template to amplify a DNA fragment containing sRNA (gfp) and MicC scaffold sequences using primers F11 and R5A fragment of rrnB T1T2; amplification of P preceding sRNA (gfp) with primers F9 and R8 using B.subtilis 168 genomic DNA as a template _srfA A promoter; amplification of P ahead of hfq with primers F8 and R1 using B.subtilis 168 genomic DNA as template _srfA A promoter; taking the genome DNA of Escherichia coli MG1655 as a template, and amplifying the hfq fragment by using primers F6 and R6; pJYW-4-gfp as template and primer F7 and R7 for amplifying gene carrying P _tacM Gfp fragment of promoter. These five fragments were subjected to overlapping PCR ligation by primers F9 and R7, wherein the gfp gene was in the opposite orientation to hfq, the MicC scaffold sequence was followed by a terminator and ligated to Kpn I, bamHI-digested pJYW-5 vector to construct a downregulated pTarget plasmid pT8 for the target gene gfp (FIG. 2).

(4)ComQXPA-P _srfA And construction of hfq-sRNA mediated negative regulatory strains:

respectively transferring pTarget plasmids pT6, pT7 and pT8 into Corynebacterium glutamicum SN01 (Corynebacterium glutamicum SN01/pS 1) carrying Sensor plasmid pS1, culturing for 12-16 h, extracting plasmids, and performing PCR verification to verify correctness, namely negative regulation strains QS1T6, QS1T7 and QS1T8 of target gene gfp.

(5) Based on ComQXPA-P _srfA And characterization of the quorum-sensing negative regulatory System of hfq-sRNA

The bacterial strains QS1T6, QS1T7 and QS1T8 are respectively activated on an LBB plate for 36-48h, transferred into an LBG liquid medium for pre-culture for 12h, and then transferred into the LBG liquid medium for formal culture for 24h. During the culture period, samples were taken at intervals of4 hours and cell density and fluorescence were measured.

The results show that the QS1T6 strain has the best down-regulation effect, and compared with the positive control strain RT1 obtained in example 1, the efficiency of the QS1T6 strain down-regulation or inhibition is 96.1% at the end of the culture period; the effect of the downregulation of QS1T7 and QS1T8 strains was similar to two times, with a downregulation or inhibition efficiency of the QS1T7 and QS1T8 strains of 39.6% and 36.0% respectively at the end of the culture compared to the positive control strain RT1 obtained in example 1.

These results indicate that the quorum sensing positively regulated auto-induction system ComQXPA-P _srfA The mediated hfq-sRNA negative regulation system can reduce the target gene in a population density dependent modeDue to gfp expression, hfq gene is replaced by P _srfA The sRNA and the gfp of the target gene are controlled by P _tacM The downregulation effect of the promoter regulated strain QS1T6 is optimal.

Example 3 population Density dependent promoter P _srfA Construction of a mutant library and mutant P _srfA Characterization of the M promoter

Primer sequences are shown in example 1.

(1)P _srfA Designing a promoter mutation library sequence: at P _srfA The-35 region (TTGNCA) and-10 region (gntanatng) of the promoter introduce random bases, namely:

5 '-TAGTGGAAATGATTGCGGCATCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCC CGCATGAACTTTTCACCCATTTTTCGTTGNCAAAAACATTTTTTTTTTCAGNTANTNGACGGTAGAAAG ATAAAAAAAAAAATATATTG-3' (the italic part is a-35 region and a-10 region design part from left to right respectively, i.e., a mutation region, N represents any random base of A, T, G and C, SEQ ID NO. 2).

(2) The method for constructing and characterizing the starter library comprises the following steps: using the pT2 plasmid obtained in example 1 as a template, a promoter part having a random sequence was amplified using a primer F1 and R10 having a random base, and P was amplified using this fragment as a forward primer, R2 as a reverse primer and pJYW-4-gfp plasmid as a template _srfA The M-gfp fragment was digested and ligated with Kpn I and BamHI digested pJYW-5 vector to obtain plasmid library pT2lib.

The obtained plasmid library is transferred into Escherichia coli JM109, cultured for 12 to 16 hours, mixed plasmids are extracted, then the mixed plasmids are transferred into a Corynebacterium glutamicum SN01/pS1 strain and coated with an LBB plate, and cultured for 12 to 16 hours. Firstly, randomly selecting 40 transformants from an LBB plate for colony PCR verification, randomly selecting 30 transformants from the correctly verified transformants for separation, purification and enrichment, then respectively inoculating the transformants into a 96-well plate containing 150 mu L of LBG culture medium for culture for 24 hours, respectively absorbing 150 mu L of bacterial liquid from the transformants, transferring the bacterial liquid into a 96-well black transparent bottom-well plate containing 150 mu L of LBG culture medium of a corresponding hole position, and detecting green fluorescence by using a microplate reader.

(3)P _srfA Obtaining the M mutant promoterTaking: measuring the fluorescence levels of 30 transformants by a microplate reader, extracting pT2lib-n plasmids carried by the transformants with different fluorescence levels, and detecting a target promoter P in the plasmids _srfA Sequencing analysis is carried out, and 18 different mutant types P are obtained _srfA The M promoter comprises the following components in sequence from low to high in fluorescence intensity: m26, M6, M21, M16, M1, M2, M3, M10, M40, M18, M11, M22, M36, M20, M29, M28, M35, M14. The fluorescence intensity corresponding to the promoter is natural P _srfA 0.4-1.5 times of the promoter (FIG. 3).

TABLE 2 promoter P _srfA M/P _srfA Sequence listing of mutated regions

Example 4 based on ComQXPA-P _srfA The construction of the group induction self-induction forward and reverse bidirectional dynamic regulation system

Primer sequences are shown in example 1.

(1) Construction of the series upregulation/upregulation plasmid pS (illustrated by the construction of the pS2 plasmid): the pS1 plasmid obtained in example 1 was used as a base plasmid, and pT2lib-n plasmids carried by transformants having different fluorescence levels obtained in example 3 were used as templates, and the mutant promoter M1 was amplified using primers F12 and R1; the mCherry gene synthesized by the chemical total synthesis method is used as a template, and target gene mCherry fragments are amplified by using primers F13 and R11. The two fragments were then ligated to the Pst I-digested pS1 plasmid by PCR using primers F12 and R11, followed by one-step cloning to obtain the pS2 plasmid (FIG. 4). The pS3, pS4 and pS5 plasmids were constructed in the same manner as pS2 except that the mutant promoters were replaced with M11, M22 and P, respectively _srfA Thus obtaining pS3, pS4 and pS5 plasmids.

(2) Construction of pT plasmid of series down-regulation/negative regulation system: plasmids pT9, pT10 and pT11 were constructed in the same manner as the pT6 plasmid (see example 2), and P was isolated _srfA The promoters were replaced with M1, M11 and M22 promoters, respectively, to obtain pT9, pT10 and pT11 plasmids in which the gfp target gene was down-regulated (FIG. 4).

(3) Construction of bidirectional dynamic regulation strains: pS2, pS3, pS4 and pS5 plasmids and pT6, pT9, pT10 and pT11 plasmids are combined in pairs and then are electrically transferred into Corynebacterium glutamicum SN01 to obtain 16 bidirectional dynamic control strains, wherein the bidirectional dynamic control strains are QS2T9, QS3T9, QS4T9, QS5T9, QS2T10, QS3T10, QS4T10, QS5T10, QS2T11, QS3T11, QS4T11, QS5T11, QS2T6, QS3T6, QS4T6 and QS5T6, and the target gene gfp is negatively controlled while the target gene gherry is positively controlled.

These strains were grouped according to the presence of the same pT plasmid and were divided into 4 groups, namely group A QS2T9, QS3T9, QS4T9, QS5T9, all down-regulated with M1 for gfp and four different P' s _srfA M/P _srfA Regulating mCherry; group B QS2T10, QS3T10, QS4T10, QS5T10, all down-regulated for gfp with M11 and with four different P' s _srfA M/P _srfA Regulating mCherry; group C QS2T11, QS3T11, QS4T11, QS5T11, with M22 downregulating gfp and four different P' s _srfA M/P _srfA Regulating mCherry; p is used in group D QS2T6, QS3T6, QS4T6 and QS5T6 _srfA Down-regulating gfp with four different P _srfA M/P _srfA Regulating mCherry to mCheerry.

These strains were grouped according to the plasmid carrying the same pS, but could also be divided into 4 groups, i.e. group E QS2T9, QS2T10, QS2T11, QS2T6, all with M1 up-regulating mCherry, with four different P' s _srfA M/P _srfA Respectively regulating gfp negatively; the F groups QS3T9, QS3T10, QS3T11, QS3T6, all with M11 up-regulating mCherry, with four different P _srfA M/P _srfA Respectively regulating gfp negatively; g groups QS4T9, QS4T10, QS4T11, QS4T6, all with M22 up-regulating mCherry, with four different P _srfA M/P _srfA Respectively regulating gfp negatively; h groups QS5T9, QS5T10, QS5T11 and QS5T6, all using P _srfA Up-regulating mCherry with four different P _srfA M/P _srfA Gfp were modulated negatively, respectively.

The strains can simultaneously up-regulate gfp gene and down-regulate mCherry gene expression.

(4) Fluorescence detection of the bidirectional dynamic control strain: activating the strain obtained in the step (3) on an LBB plate for 36-48h, transferring the strain into an LBG liquid culture medium for pre-culture for 12h, and transferring the strain into the LBG liquid culture medium for formal culture for 36h. During the incubation period, samples were taken at 4h intervals and fluorescence was detected.

In each group, the gfp gene was negatively regulated by carrying the same pT plasmid for the strain, while the P on the pS plasmid, which positively regulated the mCherry gene, was positively regulated _srfA M/P _srfA The promoter intensities are different, and the fluorescence detection result shows that the intensity of the positively regulated promoter is consistent with the red fluorescence level, and the red fluorescence is enhanced along with the increase of the promoter intensity. For each strain, the expression of the mCherry gene is enhanced in a cell density-dependent manner, which proves that a positive regulation system in a bidirectional dynamic regulation system can normally operate, i.e., the mCherry gene is positively regulated in a quorum-sensing self-induction manner.

In each group, when the strain carries the same pS plasmid to positively regulate the mCherry gene, the P of the gfp gene is negatively regulated along with the pT plasmid _srfA M/P _srfA The strength of the promoter is enhanced, and the promoter shows stronger inhibition level on green fluorescence, wherein M1 promoter is weakest and does not show inhibition effect on green fluorescence, M11 shows better gfp expression and inhibition effect on green fluorescence, M22 and P _srfA Also, a certain inhibitory effect on gfp expression and green fluorescence was exhibited over a certain period of time. Proves that the negative regulation system in the bidirectional dynamic regulation system can normally operate, namely, the gfp gene can be negatively regulated in a quorum sensing manner.

Example 5 ComQXPA-P based _srfA The bidirectional dynamic regulation and control system is applied to regulating and controlling the expression of alpha-amylase

Primer sequences F0-F13, R1-R11 are shown in example 1.

(1) Construction of up-regulation/up-regulation plasmid for alpha-amylase gene: amplifying a signal peptide part of CGB98_ RS08395 (peptidoglycan endopeptidase, which is recorded as cgR 2070) by using primers F14 and R12 by using a Corynebacterium glutamicum SN01 genome DNA as a template; amplifying a target gene, namely alpha-amylase gene amyE, by using a primer F15 and a primer R13 by using B.subtilis 168 genome DNA as a template; the pT2lib-n plasmids carried by the transformants with different fluorescence levels obtained in example 3 were used as templates, M14, M20 and M28 promoters were amplified by using primers F8 and R1, the promoters were ligated to signal peptide cgR 2070 and amyE genes by overlap PCR using primers F8 and R13 in sequence, and finally, the clones were ligated to KpnI and BamHI-treated pJYW-5 vectors as modified plasmids pT12, pT13 and pT14 of the target gene amyE.

(2) Construction of bidirectional regulation plasmid of alpha-amylase gene: taking the series up-regulated plasmids pT12, pT13 and pT14 constructed in the step (1) as templates, and performing enzyme digestion by BamH I to be used as a basic vector. By synthetic P _tacM -sRNA(gfp)-scaffold-rrnB T1T2-P _tacM Sequence as template, amplification of the upper part P of the sRNA Module containing the target Gene amyE with primers F16 and R14 _tacM -sRNA (amyE); amplifying the lower half of the sRNA module containing the target gene amyE, sRNA (amyE) -scaffold-rrnB T1T2, using primers F17 and R5; using pT2lib-n plasmids carried by the transformants with different fluorescence levels obtained in example 3 as templates, the M1 and M11 promoters preceding hfq were amplified using primers F8 and R1; the hfq fragment was amplified using primers F6 and R15, using E.coli MG1655 as a template. The fragments were ligated by PCR with primers F16 and R15, and ligated to BamHI-digested pT12, pT13 and pT14 vectors (the ligation direction of the M1-hfq fragment is opposite to the translation direction of the amyE gene), thereby constructing positive and negative bidirectional regulatory plasmids pT16, pT17, pT18, pT19, pT20 and pT21 of the target gene amyE.

(3) Transformation of the plasmid: respectively transferring the pT 12-pT 21 plasmids constructed in the step (1) and the step (2) into SN01 strains carrying the pS1 plasmids constructed in the example 1, namely, quorum sensing regulatory strains QS1T 12-QS 1T21 expressed by amyE.

(4) Detection of alpha-amylase activity: the alpha-amylase expression regulation and control strain (including up-regulation expression strain and down-regulation expression strain) is pre-cultured in an LBG liquid culture medium for 12 hours, then is transferred to the LBG culture medium for formal culture for 36 hours, samples are taken at 12 hours and 48 hours respectively, the activity of the alpha-amylase is detected by an iodine colorimetric method (national standard), and the activity of the alpha-amylase is calculated according to a formula.

(5) SDS-PAGE: the alpha-amylase expression strain (including up-regulation expression strain and down-regulation expression strain) is pre-cultured in LBG liquid culture medium for 12h, then transferred to LBG culture medium for formal culture for 36h, samples are respectively taken at 12h and 48h, the samples are lyophilized and concentrated, then resuspended in PBS buffer solution, boiled and then subjected to SDS-PAGE protein electrophoresis.

TABLE 3 sequence listing

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> quorum-sensing type bidirectional regulation and control system and application thereof

<130> BAA210362A

<160> 27

<170> PatentIn version 3.3

<210> 1

<211> 528

<212> DNA

<213> Artificial sequence

<400> 1

tgagctgttg acaattaatc atcgtgtggt accatgtgtg gaattgtgag cggataacaa 60

ttgaaaagtt cttctccttt actcatgtta tatgccttta ttgtcacaga ttttattttc 120

tgttgggcca ttgcattgcc actgattttc caacatataa aaagacaagc ccgaacagtc 180

gtccgggctt tttttcaaat aaaacgaaag gctcagtcga aagactgggc ctttcgtttt 240

atctgttgtt tgtcggtgaa cgctctcctg agtaggacaa atccgccggg agcggatttg 300

aacgttgcga agcaacggcc cggagggtgg cgggcaggac gcccgccata aactgccagg 360

catcaaatta agcagaaggc catcctgacg gatggccttt tgctcatgaa ttaattccgc 420

tagatgacgt gcggcttcga cctcctgggc gtgagctgtt gacaattaat catcgtgtgg 480

taccatgtgt ggaattgtga gcggataaca attagaagga ggtatagg 528

<210> 2

<211> 149

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (98)..(98)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (117)..(117)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (120)..(120)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (122)..(122)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (124)..(124)

<223> n is a, c, g, or t

<400> 2

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgnca aaaacatttt tttcagntan 120

antngacggt agaaagataa aaaatattg 149

<210> 3

<211> 149

<212> DNA

<213> Artificial sequence

<400> 3

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcggtgata aaaacatttt tttcatttaa 120

actgaacggt agaaagataa aaaatattg 149

<210> 4

<211> 150

<212> DNA

<213> Artificial sequence

<400> 4

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgtca aaaacatttt tttcagttat 120

cagtggacgg tagaaagata aaaaatattg 150

<210> 5

<211> 146

<212> DNA

<213> Artificial sequence

<400> 5

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgaca aaaacatttt tttcagctaa 120

ctcgacggag aagataaaaa atattg 146

<210> 6

<211> 148

<212> DNA

<213> Artificial sequence

<400> 6

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgtca aaaacatttt tttcagttat 120

atcgacggta gaaagataaa aaatattg 148

<210> 7

<211> 145

<212> DNA

<213> Artificial sequence

<400> 7

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcggcaaaa catttttttc agttacaatt 120

gacggtagaa agataaaaaa tattg 145

<210> 8

<211> 145

<212> DNA

<213> Artificial sequence

<400> 8

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgaaa catttttttc agataaagtc 120

gacggtagaa agataaaaaa tattg 145

<210> 9

<211> 141

<212> DNA

<213> Artificial sequence

<400> 9

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttggca aaaacatttt tttcagatac 120

gtagaaagat aaaaaatatt g 141

<210> 10

<211> 146

<212> DNA

<213> Artificial sequence

<400> 10

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgtaa aaacattttt cagctacact 120

cgacggtaga aagataaaaa atattg 146

<210> 11

<211> 150

<212> DNA

<213> Artificial sequence

<400> 11

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgcca aaaacatttt tttcagttaa 120

tagtagacgg tagaaagata aaaaatattg 150

<210> 12

<211> 145

<212> DNA

<213> Artificial sequence

<400> 12

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgaca aaaacatttt tttcagatat 120

gacggtagaa agataaaaaa tattg 145

<210> 13

<211> 149

<212> DNA

<213> Artificial sequence

<400> 13

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgctgaca aaaacatttt tttcagctag 120

actagacggt agaaagataa aaaatattg 149

<210> 14

<211> 148

<212> DNA

<213> Artificial sequence

<400> 14

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgtgccaa aaacattttt ttcagataaa 120

gtcgacggta gaaagataaa aaatattg 148

<210> 15

<211> 148

<212> DNA

<213> Artificial sequence

<400> 15

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgtggcaa aaacattttt ttcagataga 120

ctggacggta gaaagataaa aaatattg 148

<210> 16

<211> 150

<212> DNA

<213> Artificial sequence

<400> 16

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgtca agaacatttt tttcaaggta 120

aagttgacgg tagaaagata aaaaatattg 150

<210> 17

<211> 149

<212> DNA

<213> Artificial sequence

<400> 17

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttggca aaaacatttt tttcagatag 120

attcgacggt agaaagataa aaaatattg 149

<210> 18

<211> 148

<212> DNA

<213> Artificial sequence

<400> 18

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgtca aaaacatttt tttcactaca 120

gttgacggta gaaagataaa aaatattg 148

<210> 19

<211> 150

<212> DNA

<213> Artificial sequence

<400> 19

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgcca aaaaacattt ttttcagata 120

gacttgacgg tagaaagata aaaaatattg 150

<210> 20

<211> 149

<212> DNA

<213> Artificial sequence

<400> 20

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgtca aaaacatttt tttcaggtta 120

gagttgaggt agaaagataa aaaatattg 149

<210> 21

<211> 149

<212> DNA

<213> Artificial sequence

<400> 21

tagtggaaat gattgcggca tcccgcaaaa aatattgctg taaataaact ggaatctttc 60

ggcatcccgc atgaaacttt tcacccattt ttcgttgcca aaaacatttt tttcagatac 120

aatagacggt aggaagataa aaaatattg 149

<210> 22

<211> 581

<212> DNA

<213> Artificial sequence

<400> 22

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa actacccggc aattgtgtga tgattgtagt gtgcaaaaaa 540

cgcaagagat tcattcaagc ctggagagaa ggagttatag g 581

<210> 23

<211> 4104

<212> DNA

<213> Artificial sequence

<400> 23

atgaaggaga ttgtggagca aaacatattt aacgaggatt tgtcacaact tctttactca 60

tttattgatt ctaaagaaac attctccttt gctgaatcca caatcttaca ttatgttgtt 120

tttggagggg agaatttaga tgttgcaaca aggcttggcg cgggaataga aattcttatt 180

ctttcatcag atattatgga tgatcttgaa gatgaagata atcaccatgc attatggatg 240

aaaattaatc gctcggagtc gttaaatgca gcactttcct tgtatacagt aggattaacg 300

agtatttatt cattaaataa caatcctcta atttttaaat atgttttaaa atacgtaaac 360

gaggccatgc aaggtcaaca tgacgatatc actaataaat ctaaaacaga agatgaaagt 420

ttagaagtaa ttagattaaa atgtggaagt ctgattgcac tagcaaatgt agcaggtgtt 480

ttattggcta caggagaata taatgaaaca gttgaaagat attcctacta taaagggatt 540

atagctcaaa tttctggaga ttattatgtt cttttatccg gaaatcgcag tgatattgaa 600

aaaaacaaac atacactgat ttacttatat cttaagcgcc tttttaatga tgcttcggaa 660

gatttattat acttaatttc acataaagac ttatattata aatcgttact tgataaagag 720

aaattccaag aaaaattaat taaagcggga gttactcaat acatttcggt attattggaa 780

atatataaac agaaatgtat ttctgctata gaacaattaa atttagataa agaaaaaaaa 840

gagctaataa aggaatgctt attaagttat acaaaggggg atacaagatg caagacctaa 900

ttaactactt tttaaattat cctgaggctt taaaaaaatt gaaaaataaa gaagcctgcc 960

ttataggttt tgatgtgcaa gaaactgaaa caataattaa agcttataat gattattatc 1020

tggctgatcc aataacccgt caatggggtg attaataggt ggattaatat tgaagaactt 1080

aataaaaaaa ttcacaatag ctgtaattgt tttgagtatc ctttatataa gctatacaac 1140

ttatatcagt atgaatggaa ttattattgg gactaagatt cataaaaatg ataaaagtca 1200

atttatgata gaagaaatat cggaatcttc atatggacaa tttgttggtc tgagacaggg 1260

agacatcata ttaaaaatta ataaagaaaa accttcagac aaacatttga aatggggata 1320

tttgagtcat attaacagtc tggatatttt gagaagtgga aaaaagattc atctcaaaga 1380

ttttgattta gttactctaa atagacctta tagttttttt ctgttcgtac ttcctttgtt 1440

tttttatttt ttaagcataa tatgtatttt ttatatactt aaagtaaata aaaaaaggag 1500

atcatttgct gcctatattc ttattctatt gttattagac atttcgatag catatataag 1560

tgcaggcgga ccatttagag gacatataat caatcggtat attaacttgt ttacttttat 1620

atcttctcct attctttatc ttcaatttat acaaagatac cttggagaaa taggtaaaac 1680

ttttttgaat agaatttctt ttctttatat cataccaata tttaatcttg gtattgagtt 1740

ttttcaagac tatttacaag tagatattga ttttttagca actcttaatt tggtttcttt 1800

tgcaactttg actctatttt ctttttcagc gatatactta catcttaata aatataaata 1860

tgctgagcat tcgtttattc ttaaattact aattttaaca aacactcttt catttgcgcc 1920

ttttttgata ttttttgttc ttccaataat atttacaggt aattatattt tcccggcatt 1980

agcttcggcg tcattactag tactaattcc gttcgggtta gtataccaat ttgtagccaa 2040

taagatgttt gatatagagt ttatcttagg aagaatgaga tactatgctc tacttgccat 2100

gataccaact cttctaatag ttggtgcatt agttctgttt gatgtaatgg acatccagat 2160

gaaccctgtg cgtcaaactg tatttttttt cgttgtcatg ttcgctgtct tttattttaa 2220

agaggtcatg gattttaaat ttcggttaaa acgtttctcc gaaaaattca actatcagga 2280

cagtattttt aaatatactc agctaatgag gggtgtaact tctcttcaac aagtttttaa 2340

agaactgaaa aatactatac tggatgtttt gcttgtaagc aaagcttata cctttgaggt 2400

tactcctgat cacaaagtga tatttttaga taagcatgaa gttggaccgg actggaattt 2460

ttatcaagag gaatttgaaa acgtaacttc agaaattggg aaaattatag aagtcaatca 2520

aggctttctt atgaaagttg gtgaacgagg cggtagttct tatgttctgc tttgtttatc 2580

taatattaac actccccggc taacacgtga tgaaatatcg tggctgaaaa cactgtcttt 2640

ttatacaagt gtgtccatgg aaaatgtcct gcatattgag gagctcatgg aacatttgaa 2700

ggacttaaaa caagagggaa ccaaccccat ctggctgaaa aagctaatgt ttgcaatcga 2760

agaaaaacag cgttcaggac tcgcccgcga tctccacgat tcggttcttc aggatttgat 2820

ttccttaaaa cgccagtgtg agctgttttt gggtgatttc aagaaggatg ataatccgtg 2880

ccgtgaagag gtgcaggaca agcttgtaca gatgaatgag cagatgtctg atgtgatttc 2940

gatgacgagg gagacgtgtc atgagctgcg gccgcagctt ctgtatgatc ttggattggt 3000

gaaggcgctg tcgaagctgg tggcgcagca gcaggagcgg gttccgtttc atatccgttt 3060

aaataccggg agatttacgg cttcccttga tctggattcg cagctgaatt tgtaccggat 3120

cattcaagag tttctgtcta atgcggtcaa gcactctcag gcgacggatg tgctgattat 3180

gctcatcagt attcaaaaca aaatcgttct tcattatgag gacgatggcg ttgggtttga 3240

tcaagaaaaa aatactgagc attccatgag catggggctt tctggcatta aggagagagt 3300

cagggcttta gatgggcgcc ttcggattga aacaagtgaa ggaaagggct ttaaggctga 3360

tattgaaatc gaattgtaat ggatttataa cggaaacgac ttggcacagg ccaagtcttt 3420

tttataaaat ggaaaagagt gagtaaaagg gaggaaaaca tgaaaaagat actagtgatt 3480

gatgaccatc cggctgtcat ggaaggcacc aagacaattt tggaaacgga ttcgaatttg 3540

tctgttgatt gtctcagtcc tgaaccgagc gaacagttta tcaagcagca tgatttctcg 3600

tcatatgatc tcattttaat ggatctgaat ctaggcggcg aggtcaatgg gatggagctt 3660

tctaaacaga ttttacaaga gaatcctcat tgtaaaatta tcgtgtatac cggttatgag 3720

gtcgaggatt atttcgagga agcgattcgt gcgggtctgc acggtgccat cagcaaaacg 3780

gaatctaaag aaaagatcac ccaatacata taccacgtac tcaacggaga aattttagtc 3840

gattttgctt actttaaaca gctgatgact cagcaaaaaa caaagccggc tccttcctct 3900

caaaaagaac aagatgtgct cacacctaga gaatgcctga ttcttcaaga agttgaaaag 3960

ggatttacaa accaagaaat cgcagatgcc cttcatttaa gcaagcggtc cattgaatac 4020

agcttgacat cgattttcaa taagctgaat gtcggttcac ggacggaagc ggttttgatt 4080

gcgaaatcag acggtgtact ttaa 4104

<210> 24

<211> 62

<212> DNA

<213> Artificial sequence

<400> 24

tgagctgttg acaattaatc atcgtgtggt accatgtgtg gaattgtgag cggataacaa 60

tt 62

<210> 25

<211> 309

<212> DNA

<213> Artificial sequence

<400> 25

atggctaagg ggcaatcttt acaagatccg ttcctgaacg cactgcgtcg ggaacgtgtt 60

ccagtttcta tttatttggt gaatggtatt aagctgcaag ggcaaatcga gtcttttgat 120

cagttcgtga tcctgttgaa aaacacggtc agccagatgg tttacaagca cgcgatttct 180

actgttgtcc cgtctcgccc ggtttctcat cacagtaaca acgccggtgg cggtaccagc 240

agtaactacc atcatggtag cagcgcgcag aatacttccg cgcaacagga cagcgaagaa 300

accgaataa 309

<210> 26

<211> 109

<212> DNA

<213> Artificial sequence

<400> 26

gttatatgcc tttattgtca cagattttat tttctgttgg gccattgcat tgccactgat 60

tttccaacat ataaaaagac aagcccgaac agtcgtccgg gcttttttt 109

<210> 27

<211> 206

<212> DNA

<213> Artificial sequence

<400> 27

caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg 60

gtgaacgctc tcctgagtag gacaaatccg ccgggagcgg atttgaacgt tgcgaagcaa 120

cggcccggag ggtggcgggc aggacgcccg ccataaactg ccaggcatca aattaagcag 180

aaggccatcc tgacggatgg cctttt 206

Claims

1. A quorum sensing self-induction system is characterized by comprising a positive regulation type self-induction system, a negative regulation type self-induction system and a positive and negative bidirectional dynamic regulation system;

the positive regulation type self-induction system comprises a Sensor module and a Target module,

the Sensor module is provided with a Sensorlrp-P _brnFE Regulated by biosensorscomQXPAAn operator is controlled by the control device,

the Target module contains a promoter P _srfA A regulated first target gene;

the negative regulation type self-induction system comprises a Sensor module and a Target module,

the Target module contains a promoter P _srfA Promoter P _tacM A first target gene and a second target genehfq-a sRNA expression cassette; sRNA and on the Target modulehfqThe gene expression direction is the same and opposite to the expression direction of the first target gene; the describedhfqGene receptor P _srfA The sRNA and the first target gene are controlled by the promoter P _tacM Regulating and controlling; the downstream of the sRNA is also connected with a MicC scaffold sequence; terminatorrrnBT1T2 in the MicC scaffold sequence andhfqthe genes are arranged;

the positive and negative bidirectional dynamic regulation and control system comprises a Sensor module and a Target module,

the Sensor module contains a promoter P _srfA A second target gene,lrp-P _brnFE Biosensor andcomQXPAan operon, a second target gene on the Sensor module being subjected to promoter P _srfA The regulation and control are carried out according to the formula,comQXPAmanipulator receiverlrp-P _brnFE The regulation and control of the biosensor are carried out,

the Target module contains a promoter P _srfA Promoter P _tacM A first target gene and a second target genehfq-a sRNA expression cassette; sRNA and on the Target modulehfqThe gene expression direction is the same and opposite to the expression direction of the first target gene; the above-mentionedhfqGene receptor promoter P _srfA Regulation, sRNA and the first target Gene are separately controlled by promoter P _tacM Regulating and controlling; the downstream of the sRNA is also connected with a MicC scaffold sequence; terminatorrrnBT1T2 in the MicC scaffold sequence andhfqthe genes are arranged in sequence;

the describedlrp-P _brnFE The nucleotide sequence of the biosensor is shown in SEQ ID NO. 22; the describedcomQXPAThe nucleotide sequence of the operon is shown as SEQ ID NO. 23;

the describedhfq-the sequence of the sRNA expression cassette is a fragment from the translation initiation site of the first target gene to base 24 or a fragment from the translation initiation site after the signal peptide of the first target gene to base 24; the above-mentionedhfqThe nucleotide sequence of the gene is shown in SEQ ID NO. 25.

2. The quorum-sensing self-induction system of claim 1, wherein the promoter P is _srfA The nucleotide sequence of (A) is shown in any one of SEQ ID NO. 3-21.

3. The quorum-sensing self-induction system of claim 1, wherein the promoter P is _tacM The nucleotide sequence of (A) is shown in SEQ ID NO. 24.

4. The quorum-sensing autoinducing system of claim 1, wherein the nucleotide sequence of the MicC scaffold sequence is shown in SEQ ID No.26, and the terminatorrrnBThe nucleotide sequence of T1T2 is shown in SEQ ID NO. 27.

5. The quorum-sensing self-induction system of claim 1, wherein the Sensor module and the Target module are located on two plasmids respectively; the Sensor module is located on the pDTW107 plasmid, and the Target module is located on the pJYW-5 plasmid, respectively.

6. A cell comprising the quorum-sensing self-induction system according to any one of claims 1 to 5.

7. The cell of claim 6, wherein the cell is Corynebacterium glutamicum.

8. The cell of claim 7, wherein the Corynebacterium glutamicum comprises the subspecies lactofermentum (C.glutamicum)Corynebacterium. glutamicum ssp. lactofermentum）SN01。

9. Use of the quorum-sensing self-induction system according to claim 1 for the dynamic regulation and metabolic engineering of corynebacterium glutamicum.

10. Use of the quorum-sensing self-induction system according to claim 1 in the production of a metabolite of corynebacterium glutamicum or a product containing a metabolite of corynebacterium glutamicum.