CN101899459A - Application of saussurea involucrata sikRbcS2 gene for culturing cold resistant plant - Google Patents

Abstract

The invention relates to application of a saussurea involucrata sikRbcS2 gene for culturing a cold resistant plant. In the invention, the sikRbcS2 gene is cloned from saussurea involucrata, and then a plant expression vector PCAMBIA2301-sikRbcS2 is established by virtue of the gene to finally obtain the cold and stress resistant transgenic plant by genetic transformation. The sikRbcS2 gene is cloned from the saussurea involucrata and expressed in the transgenic plant to improve cold resistance of the transgenic plant; and by means of overexpression of the gene, low temperature stress resistant performance of the plant is improved to finally obtain the plant with obviously enhanced cold and stress resistant capability.

Description

The application of Herba Saussureae Involueratae sikRbcS2 gene in cultivating cold resistant plant

Technical field:

The present invention relates to a kind of from composite family phoenix hair Chrysanthemum plant Herba Saussureae Involueratae (Saussurea involucrata Kar.et Kir), clone and obtain the sikRbcS2 gene, make up the constitutive plant expression vector, transform plant, and cold-resistant effect is estimated, increase the cold performance of plant.

Background technology:

Low temperature is one of main natural disaster of harm agriculture production.Low temperature stress can make photosynthesis of plant reduce, respiration strengthens, and energy produces and the material biosynthesis block, consumes to strengthen, plant is in starvation, the normal growth that has had a strong impact on plant is grown, even causes death (Guo Ziwu, Li Xianli etc., the biochemistry and the The Molecular Biology Mechanism progress of plant low temperature stress response, the Chinese Ecological Agriculture journal, 2004,12 (2): 54-57).

The winter resistance that improves plant is scientific worker's problem demanding prompt solution.Since 18 end of the centurys, many scientific workers study plant cold resistance freeze injury mechanism, " physiological drought " proposed in succession, " hunger ", " Metabolic disorder ", hypothesis such as " poisonous substance accumulation " and " phase transformation of film fat " (Ma Jianzhong. the winter resistance of film fat and plant [J]. biotechnology circular .1997, (2): 6-9), to 20th century inferior lobe, development along with molecular biotechnology, cold freeze injury of plant and cold-resistant research of freezing mechanism are further goed deep into, and separate and identified plant cold resistance freeze genes involved (Ma Jianzhong. the cold induced gene [J] of plant. Journal of Agricultural Biotechnology .1996,4 (1): 8-14).

Low temperature has tangible influence to plurality of enzymes activity in the vegetable cell.As for the mechanism that influences altogether, Guy (Guy GL.Cold acclimationand freezing stress tolerance:role of protein metabolism[J] .Ann Rev Plant Physiol.1990,41:187-223) think it to be because the destruction of its three grades or quaternary structure, changed pH value and ionic strength significantly, the protein of thylakoid membrane discharges and causes dissociating or causing enzyme and albumen passivation by intermolecular gathering (as forming disulfide bond) of film enzyme complex.When tissue froze dehydration, sulfydryl (SH) reduce, and disulfide linkage (S-S-) increased.Disulfide linkage is that the sulfydryl dehydration owing to inner dehydration of protein molecule or adjacent protein molecule forms.When thawing dehydration once again, peptide chain is loose, hydrogen bond rupture, but-S-S-key is also preserved, the locus of peptide chain changes, and the space conformation of protein molecule changes, thereby protein structure is destroyed, and then cause the injury of cell and death (Levitt J.Responses of Plants to Environmental Stress[M] .New York:Academic Press.1972,697).For example, the two kinases of the key enzyme pyruvate phosphate in the C4 plant photosynthesis process become dimer by the tetramer under cold condition, cause loss of activity; Ribulose-1,5-bisphosphate, the reversible change of structure picture takes place in 5-bisphosphate carboxylase at low temperatures, and its inner hydrophobic base is exposed, and causes afunction.In addition, many studies show that arranged, quantity that low temperature also can be by influencing enzyme and isozymogram wait influence its activity (Shen Man, Wang Mingma, Dong Minren. plant cold resistance mechanism progress [J]. BULLETIN OF BOTANY Vol. .1997,14 (2): 1-8).These creeping chill enzymes are after cold domestication, its susceptibility reduces, active increasing, cold-resistant freezing property also improves (Schaffer MA in various degree, Fischer RL.Analysis of mRNAs thataccumulate in response to low temperature identifies a thiolprotease gene in Tomato[J] .Plant Physiol.1988,87:431-436).Also have some enzymes to freeze in the process, can regulate its dynamic behavior of positive regulation, overcome cryogenic passivation to reach by allosteric cold.

Rubisco (1,5-diphosphoribulose carboxylase/oxygenase, ribulose-1,5-bisphosphate carboxylase/oxygenase) is the key enzyme in the photosynthetic carbon metabolism, catalysis 1,5-ribulose diphosphate and CO ₂Generate the enzyme of two molecule glycerol 3-phosphate acid-responss, also claim carboxydismutase, can exist by the Mg ionic to be activated.1,5-diphosphoribulose carboxylase/oxygenase is fixation of C O in the photosynthesis ₂Enzyme, be the CO in the catalysis Calvin cycle ₂Fixed the first step reaction: Rubp and CO ₂Reaction generates 3-phoshoglyceric acid; This enzyme is the first step of the photorespiration of catalysis simultaneously also, makes Rubp and O ₂Reaction generates 3-phoshoglyceric acid and phosphoglycollic acid.It is opposite but mutually on the round-robin point of crossing of interconnected lock, regulating the metabolism ratio of photosynthesis and photorespiration to be in photosynthetic carbon reduction and this both direction of photosynthetic carbon oxidation, and it is the key enzyme that photosynthetic carbon assimilates to the Net Photosynthetic Rate person of rising decisive influence.Its active size plays decisive role to photosynthetic rate.All find to some extent in the biology of nourishing one's nature at all.

As the characteristic plant in Xinjiang, Herba Saussureae Involueratae (Saussurea involucrata Kar.et Kir) has another name called Herba Saussureae Involueratae, Snow Lotus Herb etc.Belong to composite family phoenix hair Chrysanthemum, the high mountain steppe, high mountain moraine and stone crack, flowstone beach, the crag crack of stone etc. that mainly grow in height above sea level 2400～4100m are located.The there climate variability, cold and hot impermanence, sleet replaces, 3～5 ℃ of the highest monthly average temperature, minimum monthly average temperature-19～-21 ℃, about 800 millimeters of annual precipitation, frostless season only had about 50 days.

Herba Saussureae Involueratae is through secular natural selection, stable special construction, function and gene have been formed, the physiology and the biochemical mechanism that adapt under the extreme environmental conditions have been produced, this mechanism that adapts to environmental facies, different with general adaptation mechanism cold-resistant, cold-resistant responsiveness, mainly show under its cold condition and can grow normally, and general winter resistance plant is under corresponding cold condition, growing is suppressed.

Summary of the invention:

An object of the present invention is provides valuable Rubisco gene sikRbcS2 for the plant cold resistance breeding, the order of its invention also is to make up plant expression vector: pCAMBIA2301-sikRbcS2, in transgenic plant, obtain expressing, improve the winter resistance of transgenic plant, overexpression by this gene, the anti-low temperature stress performance of plant is improved, the anti-obvious enhanced plant of (anti-) low temperature ability of final acquisition.

The objective of the invention is to realize by following process and method:

The sikRbcS2 gene of cloning from Herba Saussureae Involueratae of the present invention, its sequence is＜210〉1.

Of the present invention from Herba Saussureae Involueratae the process of clone's sikRbcS2 gene as follows:

With Herba Saussureae Involueratae cDNA library mono-clonal plasmid is template, with its sequence of RP1 for＜210〉2 and its sequence of RP2 for＜210〉3 for primer increases, obtain goal gene;

SikRbcS2 gene plant expression vector establishment: make up plant expression vector pCAMBIA2301-sikRbcS2;

Utilize said gene to make up plant expression vector, obtain cold-resistant transgenic plant by the agrobacterium-mediated transformation genetic transformation:

Change the sikRbcS2 genetic tobacco and carry out photochemistry efficiency analysis after the subzero treatment, can fall into three classes (height, in, low), to insert in the tobacco gene group different positions relevant with the sikRbcS2 gene for this, causes the expression of gene amount different, cause subzero treatment after photochemistry efficient different.Its photochemistry efficient is not directly related with temperature.

Change the sikRbcS2 genetic tobacco from room temperature is reduced to 0 ℃ process, the specific conductivity difference less (about 1%) of transgene tobacco and contrast tobacco; When temperature is reduced to 0 ℃, change sikRbcS2 tobacco specific conductivity and be lower than contrast tobacco 7%; In the time of-2 ℃, change sikRbcS2 tobacco specific conductivity and then be lower than contrast tobacco 92%.Change the sikRbcS2 genetic tobacco and show extremely strong resistance at low temperatures, improve photosynthesis of plants, improve the winter resistance of plant.

The present invention not only obtains Herba Saussureae Involueratae Rubisco gene sikRbcS2, and with its plant expression vector that is built into, has studied the critical function of this gene in improving the plant frigostabile performance in transgenic plant.This enriches plant cold resistance molecular biology theory for the cold-resistant mechanism that discloses saussurea involucrata, improves the low temperature tolerance ability of plant, has great importance.

Description of drawings:

Fig. 1 is Herba Saussureae Involueratae sikRbcS2 gene PCR amplification figure Fig1:sikRbcS2gene PCR amplified

Fig. 2 is that the pUCm-sikRbcS2 enzyme is cut evaluation figure Fig2:Restriction enzyme digestion identification of pUCm-sikRbcS2

Fig. 3 is that pCAMBIA1301-sikRbcS2 PCR identifies Fig3:PCR identification of pCAMBIA1301-sikRbcS2

Fig. 4 is that pCAMBIA2301-sikRbcS2 PCR identifies Fig4:PCR identification of pCAMBIA2301-sikRbcS

Fig. 5 is that the pCAMBIA2301-sikRbcS2 enzyme is cut evaluation Fig5:Restriction enzyme digestion identification ofpCAMBIA2301-sikRbcS2

Fig. 6 is that pCAMBIA2301-sikRbcS2 transforms AGL1PCR evaluation Fig6:PCR identification ofpCAMBIA2301-sikRbcS2-AGL1

Fig. 7 is that pCAMBIA2301-sikRbcS2 transformation of tobacco PCR detects Fig7:PCR identification ofpCAMBIA2301-sikRbcS2transformed tobacco

Fig. 8 is that transgene tobacco RT-PCR analyzes Fig8:RT-PCR analysis on transgenic tobacco

Fig. 9 is the influence of Temperature Treatment to different tobacco Fv/Fm, data are three multiple mean values ± S.EFig 9:Effect of temperature treatment on the Fv/Fm in different tobacco among the figure, Resultasmeans ± S.E. (n=3)

Figure 10: the mensuration Fig10:Relative conductivity of tobaccoleaves that is sikRbcS2 gene transformation tobacco leaf relative conductivity

Figure 11 is the structure schema of Herba Saussureae Involueratae sikRbcS2 plant expression vector pCAMBIA2301-sikRbcS2

Among Fig. 1:

1,2:sikRbcS2; 3: negative control; M:Marker

Among Fig. 2:

1，2：pUCm-sikRbcS2；3：plasmid；M：Marker?III；

Among Fig. 3:

1: negative control; 2-4:pCAMBIA1301-sikRbcS2; M:Marker III

Among Fig. 4:

1: negative control; 2-4:pCAMBIA2301-sikRbcS2; M:Marker III

Among Fig. 5:

1：plasmid；2-5：pCAMBIA2301-sikRbcS2；M：Marker

Among Fig. 6:

1: negative control; 2-6:pCAMBIA2301-sikRbcS2-AGL1; M:Marker

Among Fig. 7:

1：Negetive?control；2：positive?control；3-12：Transgenic?tobacco；M：MarkerIII

Among Fig. 8:

1: negative control; The 2-5:pCAMBIA2301-sikRbcS2 transformation of tobacco; M:Marker

Embodiment:

Testing related medicine sepharose DNA recovery test kit is that the production of worker company is given birth in Shanghai; LA PCRTM in vitro CloningKit is available from TaKaRa company; RNA enzyme, Taq enzyme, T4-DNA ligase enzyme (T4-DNA ligase), Marker, TRNzol total RNA extraction reagent are purchased the company in TIANGEN; Restriction enzyme is that Fermentas company is original-pack; Microbiotic is available from Shanghai Sangon company.

Embodiment 1: the extraction of Herba Saussureae Involueratae cDNA library mono-clonal plasmid

The glycerine pipe of getting the mono-clonal preservation of Herba Saussureae Involueratae cDNA library is in 10mlLB liquid nutrient medium (Cm 50 μ g/ml), and 37 ℃ of 220rpm shaking culture are spent the night.Dip in that to get bacterium liquid streak culture on LB solid medium (Cm 50 μ g/ml) flat board, 37 ℃ of dark 12-16hr that cultivate.The picking mono-clonal is in 20mlLB liquid nutrient medium (Cm 50 μ g/ml), and 37 ℃ of 220rpm shaking culture 14hr extract plasmid, and concrete grammar is as follows:

1) bacterium liquid is sub-packed in 1.5ml Ep pipe, the centrifugal 3min of 12000rpm abandons supernatant liquor;

2) add 400ml STE solution, resuspended, the centrifugal 3min of 12000rpm abandons supernatant liquor;

3) precipitation is resuspended with 150 μ L alkaline lysis solution I, mixing;

4) add freshly prepared 300 μ L alkaline lysis solution II, mixing is limpid to solution gently;

5) add 225 μ L alkaline lysis solution III, mixing is placed 5min on ice gently; Centrifugal (12000rpm, 5min);

6) draw supernatant in another new Ep pipe, add the equal-volume trichloromethane, abundant mixing, room temperature is placed 5min; Centrifugal (10000rpm, 5min);

7) carefully draw supernatant in another new Ep pipe, add the two volumes dehydrated alcohol and be about 850 μ L, place 10min for-20 ℃; Centrifugal (12000rpm, 5min);

8) supernatant discarded, precipitation is dissolved in 40 μ L TE (the containing RNase A 20 μ g/ml) solution 37 ℃ of incubation 30min with 70% washing with alcohol twice after room temperature dries up.

Embodiment 2: be cloned into the sikRbcS2 gene from Herba Saussureae Involueratae

With Herba Saussureae Involueratae cDNA library mono-clonal plasmid is template, with its sequence of RP1 for＜210〉2 and its sequence of RP2 for＜210〉3 for primer increases, obtain goal gene; Be that template increases as negative control with the deionized water simultaneously.

RP1 is:＜210〉2

5′ttatcagtcgaaggtacgg?3′

RP2 is:＜210〉3

5′gctttctagaccattcgttggcgcg?3′

PCR reaction system (20 μ l) is:

10×PCR?Buffer 2.0μ1

DNTPs (each 2.5mM) 0.5 μ l

MgCl2(25mM) 1.0μl

Upstream primer (25 μ M) 0.5 μ l

Downstream primer (25 μ M) 0.5 μ l

Template DNA (ddH ₂O) 0.5 μ l

Taq?DNA?Polymerase(2.5U/μl) 0.3ul

ddH ₂O 14.7μl

Total 20.0μl

The PCR response procedures is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30s, 68 ℃ of renaturation 120s, 30cycles; 72 ℃ are extended 10min; 4 ℃ of insulations.

After PCR reaction finished, product was after 1.0% agarose gel electrophoresis separates through concentration, the sepharose that uses Shanghai to give birth to the worker reclaim test kit to specifications method reclaim goal gene respectively, the purpose fragment called after sikRbcS2 that obtains.As shown in Figure 1.

Embodiment 3: make up sikRbcS2 gene plant expression vector

Make up plant expression vector: pCAMBIA1301-sikRbcS2 and pCAMBIA2301-sikRbcS2.E.coli DH5 α Nco I/BstE II double digestion plant expression vector respectively with pCAMBIA1301 and pCAMBIA2301 obtains carrier segments.Reclaim target gene fragment and carrier segments.Target gene fragment is carried out external the connection with carrier segments, through identifying correct recombinant plasmid called after pCAMBIA1301-sikRbcS2 and pCAMBIA2301-sikRbcS2 respectively.In the present embodiment, we select for use tobacco as transgenic plant material, also can select for use other plant as transgenic line.

In the present embodiment, sikRbcS2 gene and pCAMBIA2301 constitute plant expression vector, are used for the conversion of plant.According to this embodiment of the present invention, make up selected plant expression vector except pCAMBIA2301, can also select the other plant expression vector for use.Shown in Fig. 3,4,5.

Embodiment 4: the conversion of Agrobacterium:

4.1 the competent preparation of Agrobacterium

1) from fresh AGL1 flat board single bacterium colony of picking in LB liquid nutrient medium (5ml)+Rif (50ug/ml)+Gen (50ug/ml), in 28 ℃, 200rpm shaking culture 48hr;

2) get 200ul bacterium liquid in the LB liquid nutrient medium that contains Rif (50ug/ml) and Gen (50ug/ml) of 20ml activation culture to OD ₆₀₀=0.5-0.8 collects bacterium liquid, ice bath 30min;

3) packing bacterium liquid is in the 1.5ml centrifuge tube, and in 4 ℃, the centrifugal 5min of 6000rpm abandons most supernatant, collects agrobatcerium cell;

4) with the 0.05mol/LCaCl of sedimentary Agrobacterium with the 750ul precooling ₂Resuspended, 4 ℃, the centrifugal 5min of 8000rpm;

5) abandon supernatant 75ul 0.05mol/lCaCl ₂(10% glycerine) re-suspended cell is stored in-70 ℃.

4.2 plant expression vector transforms agrobacterium tumefaciens AGL1 (freeze-thaw method)

1) draws the above-mentioned transfer vector plasmids of 10 μ l (about 0.5 μ g/ μ l), with 75 μ l AGL1 competent cells mixing gently, ice bath 30min, liquid nitrogen cryopreservation 5min then;

2) place 37 ℃ of water-bath 2min rapidly;

3) add 600 μ l liquid LB substratum (Rif+Gen), 28 ℃, 200rpm shaking culture 5hr;

4) with above-mentioned nutrient solution in the centrifugal 5min of 6000rpm, collect agrobatcerium cell, discard 500 μ l liquid nutrient mediums, remain 100 μ l re-suspended cells;

5) bacterium liquid is coated on contains Kan 50 μ g/ml, on the solid LB culture medium flat plate of Rif50 μ g/ml and Gen50 μ g/ml, cultivate 24-48hr for 28 ℃.

4.3 positive colony screening

The some single bacterium colonies of picking carry out bacterium colony PCR, with the positive colony called after that filters out: pCAMBIA2301-sikRbcS2-AGL1.

In the present embodiment, the method that plant expression vector imports Agrobacterium is a freeze-thaw method.Freeze-thaw method is the technological operation that those skilled in the art are familiar with very much, is not key of the present invention.Detect the male agrobacterium strains by PCR, be used to transform plant.As shown in Figure 6.

Embodiment 5: tobacco genetic transformation and regeneration

Method for transformation for the target plant among the present invention is not crucial, and the various transformation technology that can use those skilled in the art to be familiar with imports target vegetable cell to be transformed with recombinant DNA sequence.These methods include but are not limited to the Agrobacterium infestation method, microprojectile bombardment methods, and microinjection, coprecipitation method, electroporation, and ovary injection plant fertilization blastular method etc. all can.

Be used to the method that transforms in this programme, can use to be suitable for other target plants.Preferably make in the stable genome that is incorporated into the target vegetable cell of the sequence that transformed, thereby it is not lost in the process that goes down to posterity.In addition, the nucleotide sequence that is used to transform the target plant can be with linearity, and the form of annular or other recombinant vectors such as the form of artificial chromosome exist.

5.1 the preparation of During Agrobacterium liquid

1) containing from-70 ℃ of preservations: picking bacterium piece the pCAMBIA2301-sikRbcS2-AGL1 Agrobacterium glycerine pipe, be inoculated in that 5ml is additional Kan 50 μ g/ml, Rif50 μ g/ml is in the LB liquid nutrient medium of Gen 50 μ g/ml, 28 ℃, the about 30hr of 200rpm shaking culture;

2) draw 200 μ l bacterium liquid, use 20ml LB liquid nutrient medium (Kan 50 μ g/ml, Rif50 μ g/ml, Gen 50 μ g/ml) dilution again, 28 ℃, the about 4hr of 200rpm shaking culture;

3) activatory bacterium liquid is cultured to OD ₆₀₀During=0.4-0.6, be the dip-dyeing solution that transforms usefulness.

5.2 contaminate

1) on the Bechtop dip-dyeing solution is poured in the sterile petri dish, aseptic tobacco leaf is cut into 1cm ²The square of size is put into bacterium liquid, and 10min is contaminated in vibration;

2) take out tobacco leaf, blot the bacterium liquid that adheres on the clean leaf dish with filter paper;

3) covering an aseptic filter paper on the substratum (MS+6-BA2.0mg/L+IAA0.3mg/L) altogether, be placed in the leaf dish of contaminating on the filter paper equably; Under 26 ℃ of dark culture condition, cultivated altogether 2-3 days.

5.3 resistant calli screens and sprouts and induces

The tobacco that the tobacco leaf disc of cultivating altogether is transferred to MS+6-BA 2.0mg/L+IAA 0.3mg/L+Kan 50mg/L+Cb 500mg/L is induced on the selection substratum, and leaf dish wound fully contacts substratum.Switching in every 15-20 days once transfer after 1-2 time, and the leaf plate edge produces light green, fine and close callus gradually, and the continuation cultivation is until inducing the bud of growing thickly.

5.4 the root culture of transformed plant and transplanting

When bud to be grown thickly grew to the 2-3cm left and right sides, the tobacco that its cutting-out is transferred to MS+IAA 0.3mg/L+Kan 50mg/L+Cb 500mg/L took root and selects to carry out root culture on the substratum.

Transgene tobacco begins to have root to generate about 15 days, when treating well developed root system, and the transformed plant that root growth is good, film is sealed in removal, carries out hardening in the room temperature environment about 7 days, washes substratum then, with seedling change over to matrix (vermiculite: detritus soil=2: 1), 26 ℃, 16hr40 μ molm ^-2S ^-1Illumination is cultivated under the 70% relative humidity condition, need shelter from heat or light in preceding 2-3 days, lucifuge, preserve moisture.

Embodiment 6: the Molecular Detection of transgene tobacco

6.1 the PCR of transgene tobacco identifies

6.1.1 the extraction of tobacco DNA (SDS method)

1) gets the fresh blade of 0.1g, in the 1.5ml centrifuge tube, fully grind with glass rod;

2) add 400 μ l and extract damping fluid, abundant mixing, the centrifugal 5min of 12000rpm;

3) carefully draw 300 μ l supernatant liquors, add 300 μ l Virahols, precipitation at room temperature 20min, the centrifugal 10min of 12000rpm, collecting precipitation;

4) will precipitate fully air-dryly, add 400 μ l TE dissolution precipitations;

5) add 400 μ l chloroform/primary isoamyl alcohol (24/1), fully mixing leaves standstill 20min, the centrifugal 10min of 12000rpm;

6) carefully draw supernatant, add 40 μ l 3MNaAC (pH5.2), 800 μ l dehydrated alcohols ,-20 ℃ of precipitations are spent the night;

7) 4 ℃, the centrifugal 15min of 12000rpm abandons supernatant;

8) 70% alcohol washed twice dries up back with 30 μ l ddH ₂The O dissolving.

6.1.2 the PCR of transgene tobacco identifies

Tobacco DNA with the transforming gene that extracts is a template, with its sequence of RP3 for＜210〉4 and its sequence of RP4 for＜210〉5 for primer increases, the while is that template increases as negative control with the deionized water, amplification system such as embodiment 2.As shown in Figure 7.

6.2 the RT-PCR of transgene tobacco detects

6.2.1 the extraction of the total RNA of plant to be detected

The TRNzol total RNA extraction reagent of TIANGEN company extracts transgene tobacco and the total RNA of unconverted tobacco that has identified:

1) mortar and used utensil are toasted more than the 6hr at 180 ℃ of baking ovens, all the other employed rifle heads, centrifuge tube all use 0.1% DEPC to handle autoclaving;

2) get plant young tender leaf agreement that contracts a film or TV play to an actor or actress 0.1g in mortar, liquid feeding N fully is ground to Powdered;

3) the powder branch is filled in the little centrifuge tube of 1.5mL, the TRNzol that adds 1ml extracts reagent, fully quick mixing, and room temperature is placed 3-5min.

4) 10000rpm, 4 ℃ of centrifugal 5min suct clearly to a new centrifuge tube, add 200 μ l chloroforms, the thermal agitation mixing;

5) 10000rpm, 4 ℃ of centrifugal 5min draw supernatant liquid to another new centrifuge tube, add the Virahol of 600 μ l precoolings, in-20 ℃ of precipitation 30min;

6) 10000rpm behind 4 ℃ of centrifugal 10min, outwells liquid, can see white precipitate in the centrifuge tube bottom, is total RNA.

7) with after 70% ethanol (DEPC processing) washing precipitation 2 times, blot liquid, dry up the back and add 30 μ l ddH ₂O (DEPC processing) dissolving, be stored in-20 ℃ standby.

6.2.2cDNA first chain is synthetic

In the 0.2ml centrifuge tube that DEPC handles, add RNA 2 μ l, dNTP (2.5mM) 1 μ l, Oligo dT 1 μ l behind the ddH2O 5 μ l, places 1min on ice rapidly behind 70 ℃ of water-bath 5min.In centrifuge tube, add Rnase Inhibitor 0.5 μ l then, AMV ThermoScript II 0.5 μ l, 42 ℃ of 1hr behind 95 ℃ of 5min, are cooled to 4 ℃.

7.2.3cDNA the synthetic and amplification of second chain

In the PCR reaction tubes, add the cDNA first chain reaction product 1 μ l, 5 * Taq buffer, 4 μ l, MgCl ₂(25mM) 1.0 μ l, dNTP (2.5mM) 0.5 μ l, each 0.5 μ l of upstream and downstream primer (25 μ mol), ddH ₂O complements to 20 μ l, and reaction conditions is with embodiment 2.As shown in Figure 8.

Embodiment 7: the mensuration of photochemistry efficient

Fv/Fm is one of important fluorescence parameter, is called the maximum photochemistry efficient of PS II traditionally, and it is the maximum photochemistry efficient when PS II reactive center is open fully under the dark adatpation, has reflected the maximum light energy use efficiency of PS II reactive center.Under non-stress conditions, the value of Fv/Fm is very stable, but under adverse environmental factor, Fv/Fm significantly reduces.Therefore, the index that light suppresses or PSII sustains an injury takes place in the reduction Chang Zuowei of Fv/Fm.The Dual-pam100 Instrument measuring is adopted in this test, as shown in Figure 9.

Embodiment 8: the simulation cold damage of transfer-gen plant is handled and the blade membrane permeability is measured

After transfer-gen plant is identified, obtain aseptic seedling by vegetative propagation, after taking root on the MS substratum.Choose the consistent seedling (5-7 leaf phase) of growth after plant survives, simulate cold damage and handle.Beat from blade with punch tool respectively and get sequin mensuration blade membrane permeability.As shown in figure 10.

Sequence table

＜110〉Shihezi Univ

＜120〉application of Herba Saussureae Involueratae sikRbcS2 gene in cultivating cold resistant plant

<160>3

<210>1

<211>965

<212>DNA

＜213〉Herba Saussureae Involueratae (Saurrea.involucrata Kar.et Kir.)

<220>

<221>5’UTP

<222>(1)...(142)

<220>

<221>CDS

<222>(143)...(563)

<220>

<221>3’UTP

<222>(564)...(965)

<400>1

Translation?of?DNAMAN2(143-563)

Universal code

Total?amino?acid?number：140，MW＝35075

Max?ORF?starts?at?AA?pos?47(may?be?DNA?pos?143)for?140?AA(420bases)，MW＝15631

1 gagcgaagaa?agcggccgca?taacttcgta?tagcatacat?tatacgaagt?tatcagtcga

61 cggtacggga?catatgcccg?ggaattcggc?cattacggcc?ggggggattt?gcaaaggcta

130 140 150 160 170 179

120 ccctttaaag?caaaattacc?aaa?atg?gcc?tcc?atc?tcc?tcc?tcc?gcg?gta?gcc?acc?gtc

40 MET?Ala?Ser?Ile?Ser?Ser?Ser?Ala?Val?Ala?Thr?Val

190 200 210 220 230 239

180 aac?cgg?tcc?gcc?tcc?gct caa?gcc?aac?atg?gtg?gct?cca?ttt?acc?ggc?ctc?aag?tcc?aac

60 Asn?Arg?Ser?Ala Ser?Ala?Gln?Ala?Asn?MET?Val?Ala?Pro?Phe?Thr?Gly?Leu?Lys?Ser?Asn

250 260 270 280 290 299

240 gtc?gcc?ttc?cca?gtt?acc?aag?aag?gcc?aac?gac?ttt?tcc?tcc?ctt?ccc?agc?aac?ggt?gga

80 Val?Ala?Phe?Pro?Val?Thr?Lys?Lys?Ala?Asn?Asp?Phe?Ser?Ser?Leu?Pro?Ser?Asn?Gly?Gly

310 320 330 340 350 359

300 aga?gtt?cag?tgc?atg?aag?gtg?tgg?cca?cca?ctt?gga?ttg?aag?aag?tac?gag?act?ctt?tcg

100 Arg?Val?Gln?Cys?MET?Lys?Val?Trp?Pro?Pro?Leu?Gly?Leu?Lys?Lys?Tyr?Glu?Thr?Leu?Ser

370 380 390 400 410 419

360 tac?cta?ccc?cca?tta?agt?gaa?gca?tcg?ttg?gcc?aag?gaa?gtg?gac?tac?tta?ttc?cgc?aac

120 Tyr?Leu?Pro?Pro?Leu?Ser?Glu?Ala?Ser?Leu?Ala?Lys?Glu?Val?Asp?Tyr?Leu?Phe?Arg?Asn

430 440 450 460 470 479

420 aaa?tgg?gtt?cct?tgc?ttg?gaa?ttc?gag?ttg?gag?cac?ggt?ttc?gtg?tac?cgt?gag?cac?aac

140 Lys?Trp?Val?Pro?Cys?Leu?Glu?Phe?Glu?Leu?Glu?His?Gly?Phe?Val?Tyr?Arg?Glu?His?Asn

490 500 510 520 530 539

480 tca?tcc?ctg?gat?att?atg?acg?gaa?gat?act?gga?caa?tgt?gga?agt?tgc?cta?tgt?tcg?ggt

160 Ser?Ser?Leu?Asp?Ile?MET?Thr?Glu?Asp?Thr?Gly?Gln?Cys?Gly?Ser?Cys?Leu?Cys?Ser?Gly

550 560 570 580 590 600

540 gca?ctg?att?ccg?ccc?agg?tgt?tgaaggagct?tgaagagtgc?aagaaggagt?acccgaacgc

180 Ala?Leu?Ile?Pro?Pro?Arg?Cys＊＊＊

610 620 630 640 650 660

601 cttcgtccgt?attatcggat?tggacaacgt?tcgtcaagtc?cagtgtgtga?gtttcatcgc

661 tgccaagcca?ccaggttatt?aagcaattta?tcaacaattt?tgttttaatc?ccgggtcggg

721 tcgggtttgt?ttgaatcttt?agggtttttc?atcaattttt?ttttttttat?attgggattt

781 cgtcaattta?atttcatgtc?catttccttg?ttcattcctg?aatttttatg?agggggataa

841 aaagatatca?tatataaaat?aataatttgt?caaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa

901 acagtcggcc?gcctcggccc?tcgagaagct?ttctagacca?ttcgttggcg?cgcgacccag

961 agagg

<210>2

<211>20

<212>DNA

＜213〉artificial sequence

<400>2

gttatcagtcgaaggtacgg

<210>3

<211>25

<212>DNA

＜213〉artificial sequence

<400>3

gctttctagaccattcgttggcgcg

<210>4

<211>22

<212>DNA

＜213〉artificial sequence

<400>4

ggcctccatctcctcctccgcg

<210>5

<211>22

<212>DNA

＜213〉artificial sequence

<400>5

actgattccgcccaggtgttga

Claims (3)

1. a clone sik RbcS2 gene from Herba Saussureae Involueratae is characterized in that this full length gene 965bp, and its sequence is＜210〉1, coding region 420bp, 139 amino acid of encoding, 5 ' non-coding region 142bp, 3 ' non-coding region 402bp.

2. one kind is utilized the gene constructed plant expression vector of said gene sik RbcS2.

One kind from Herba Saussureae Involueratae cloned sequence be the purposes of＜210〉1 sik RbcS2 gene, it is characterized in that utilizing said gene to make up plant expression vector, obtain cold-resistant transgenic plant by genetic transformation.

Images